ID: 1168315801

View in Genome Browser
Species Human (GRCh38)
Location 19:55484303-55484325
Sequence GATGGAGGGCAGGCCCTGAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 2, 2: 2, 3: 29, 4: 394}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168315801_1168315810 11 Left 1168315801 19:55484303-55484325 CCCCTCAGGGCCTGCCCTCCATC 0: 1
1: 2
2: 2
3: 29
4: 394
Right 1168315810 19:55484337-55484359 GACTCTACCCGCAGTCCAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 76
1168315801_1168315814 27 Left 1168315801 19:55484303-55484325 CCCCTCAGGGCCTGCCCTCCATC 0: 1
1: 2
2: 2
3: 29
4: 394
Right 1168315814 19:55484353-55484375 CAGCTGGTGCACACGTTTTGAGG 0: 1
1: 0
2: 1
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168315801 Original CRISPR GATGGAGGGCAGGCCCTGAG GGG (reversed) Exonic
900031564 1:376346-376368 TATGGAGGCCAAGGCCTGAGTGG + Intergenic
900052115 1:604546-604568 TATGGAGGCCAAGGCCTGAGTGG + Intergenic
900088093 1:908245-908267 GCAGGAGGGCAGGCACCGAGAGG + Intergenic
900254788 1:1692516-1692538 GCTGGCGGGCGGGGCCTGAGAGG + Exonic
900325551 1:2107091-2107113 GAGGCAGAGCAGGCCCTGCGAGG - Intronic
900343397 1:2199265-2199287 GATGGAGGACAGGCTGTGGGAGG - Intronic
900395196 1:2450601-2450623 GTTGGAGGGCAGGCCGAGTGGGG - Intronic
900623517 1:3598053-3598075 GCTGCAGGGCAGGCCCGGGGCGG - Intronic
901068144 1:6504354-6504376 CAGGGAGGGCAGGACATGAGAGG - Intronic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
902259283 1:15212416-15212438 GAATGAGGGCAGGCAGTGAGGGG + Intronic
904009010 1:27379480-27379502 GATGGAGTCCAGGCCCAAAGGGG + Exonic
904837126 1:33346240-33346262 GAGGGTGGGCAGGCTCAGAGGGG + Intronic
905451841 1:38062061-38062083 GAGGGAGGCCAGGAGCTGAGTGG - Intergenic
906058377 1:42932868-42932890 GATGGAGGCCAGGCTCCAAGGGG + Intronic
906130303 1:43451746-43451768 GAAGGAGGGCGGGGCCTGCGGGG - Exonic
907201400 1:52729785-52729807 AACTGAGGGCAGGGCCTGAGAGG + Intronic
907333453 1:53685988-53686010 GATGAAGGGCAGGGGCAGAGGGG - Intronic
910891595 1:92025973-92025995 GGTGGGGGGCAGGCCCTGCCGGG - Intergenic
911090065 1:94011051-94011073 GATGGAGGGCAGCCCTTATGAGG - Intronic
913144551 1:115976569-115976591 GCGGGAGGGCAGCGCCTGAGAGG + Exonic
914711803 1:150221446-150221468 GAGGGAGGGCAGGCTAAGAGAGG + Intronic
915299934 1:154946101-154946123 GAAGGAGGGCAGGCCAAGGGTGG - Exonic
915362977 1:155296845-155296867 GATGGAGGCCAACGCCTGAGTGG - Intronic
916059648 1:161089683-161089705 GAAGGAGGGAAGGACCTGGGTGG + Intergenic
916472284 1:165136145-165136167 GAGGGAAGACAGGCCTTGAGGGG + Intergenic
916794075 1:168149744-168149766 GAGAGAGGGCAGGACCTCAGAGG + Intergenic
918223031 1:182453488-182453510 GATGGAGAGAAGGCCATGTGAGG + Intronic
920132995 1:203747053-203747075 GATGGAGGGCAGGCTGGGCGTGG - Intergenic
920180637 1:204129950-204129972 GATGGTGGTCAGGACCTTAGGGG + Intergenic
922031798 1:221808307-221808329 GATGGTGGGCAGGGGCTGAGAGG + Intergenic
922615832 1:226960766-226960788 GAGGGTGGGCTGACCCTGAGGGG + Intronic
922744907 1:228038237-228038259 GAAGGTGGGCAGCCCCCGAGGGG + Intronic
922822346 1:228493284-228493306 GATGGTGGGCAGACCCAGCGGGG - Intronic
923773040 1:236954163-236954185 GATGGGAGGGAGGCCCTGGGTGG + Intergenic
1062930072 10:1347083-1347105 GAGGAAGTGCAGGCCCAGAGGGG + Intronic
1063077761 10:2733389-2733411 GATGGGGGGCAGCCCTGGAGGGG + Intergenic
1063159580 10:3409382-3409404 GATGGAGAGAAGGCCCAGTGAGG + Intergenic
1064186635 10:13167570-13167592 GATGGAGGGGAGGACCGGGGGGG + Intronic
1065190359 10:23202611-23202633 GATATAGGGCAGGACCTGGGTGG + Intergenic
1065317997 10:24483348-24483370 GAAGGTGGGCAGGGACTGAGTGG - Intronic
1066332379 10:34438832-34438854 GATGGAGGAAAGTCCCTGAGGGG + Intronic
1067226208 10:44377819-44377841 GCTGTGGGGCAGGCCCTGGGAGG + Exonic
1067728227 10:48789785-48789807 CCTGGAGGGCAGGCCCTCTGGGG - Intronic
1068455249 10:57247001-57247023 GATGTCGGGCAGGCCAGGAGTGG - Intergenic
1068987799 10:63123193-63123215 GATGGAGGTTTTGCCCTGAGGGG - Intergenic
1069633308 10:69910624-69910646 GCAGGAGGGCTGGCCCTGACTGG - Intronic
1069861722 10:71475764-71475786 GCTGGAATGCAGGCCCTGAGGGG + Intronic
1070955148 10:80458803-80458825 GGTGGAGCGCAGGCCCTGGCAGG + Intronic
1071288902 10:84173992-84174014 GTTGGAGGGCAGGCCTTGGCGGG + Intronic
1071434236 10:85632202-85632224 GGTGGAGGGCAGACCTGGAGGGG - Intronic
1072248846 10:93566386-93566408 GAGGTTGGGCAGGCCCTGCGGGG + Intergenic
1072518600 10:96210659-96210681 GACAGAGGGCAGGCCAGGAGGGG + Intronic
1073523050 10:104152816-104152838 GATGGAGGGCAGCCCTTGCAAGG + Intronic
1073812394 10:107164807-107164829 GAGGGAGGGCAGGCGCTGCCGGG + Intergenic
1074524306 10:114250935-114250957 GAGGCAGGGGAGGCCCAGAGAGG + Intronic
1074704724 10:116120683-116120705 GGTGGAGGGCTGGCCCTGATTGG + Intronic
1075214390 10:120519498-120519520 GATGCAGGCCAGGGACTGAGGGG + Intronic
1075245010 10:120813257-120813279 GAAGGAGTGCATGCTCTGAGAGG + Intergenic
1076552191 10:131288509-131288531 GGTGGAGGGCAGGCCCTGGGTGG - Intronic
1076729230 10:132429928-132429950 GGAGGGGGACAGGCCCTGAGAGG - Intergenic
1076835570 10:133019455-133019477 GCTGGAGGGAAGGACCCGAGCGG + Intergenic
1077093781 11:790908-790930 AAAGGAGGGTGGGCCCTGAGAGG + Exonic
1077132619 11:980860-980882 GGTGGAGGCCAGGCCAGGAGAGG + Intronic
1077173131 11:1177183-1177205 GAAGGAGGGCAGGGCCTGCCTGG + Intronic
1077246428 11:1541494-1541516 GATGCAGGCCAAGCCCTGCGGGG + Intergenic
1077327861 11:1971454-1971476 GGTGGAGGGCAGGGCCGGAGAGG - Intronic
1077455424 11:2675657-2675679 GAGTCAGGGCAGGCCCTGGGCGG - Intronic
1077979223 11:7282675-7282697 CATGGTGGGAAGTCCCTGAGAGG + Intronic
1081625956 11:44655162-44655184 GATGGAGGTCAGGTCAGGAGGGG + Intergenic
1081667459 11:44924976-44924998 AATGGAGGGCCAGCCCTGAACGG + Intronic
1081717766 11:45263046-45263068 AATGGTGGGCAGGGCCTGGGAGG - Intronic
1083558416 11:63651641-63651663 GCTGGAAGACAGACCCTGAGGGG - Intronic
1083639959 11:64140150-64140172 GATGGCAGCCAGGCCCTGACAGG + Intronic
1083890887 11:65595327-65595349 GATGGAGCCCAGGCCCTGTGAGG - Intronic
1084006149 11:66324720-66324742 GAAGAAGGGCTGGCCCAGAGAGG + Intergenic
1084462970 11:69306561-69306583 GGTGGAGGGCAGGCACTTTGCGG - Intronic
1084509376 11:69593669-69593691 GAAGGAGGGCTGGCCCAGAAAGG - Intergenic
1085510428 11:77085277-77085299 GAGGAAGTGGAGGCCCTGAGAGG - Intronic
1088250722 11:107858858-107858880 GAGGGAGCGCAGGGCCAGAGCGG - Exonic
1090659361 11:128870741-128870763 GACTCAGGGCAGACCCTGAGGGG - Intergenic
1091068114 11:132536154-132536176 AATGGAGAGCAGGCCCTGGAGGG - Intronic
1202810841 11_KI270721v1_random:26634-26656 GGTGGAGGGCAGGGCCGGAGAGG - Intergenic
1091541110 12:1463370-1463392 GTTGGGGGACAGGGCCTGAGGGG + Intronic
1091791037 12:3272349-3272371 GATGGATGGAGGGGCCTGAGTGG - Intronic
1092547848 12:9467175-9467197 GTGGGAGGGCAGGCCCTCACAGG + Intergenic
1093920734 12:24856566-24856588 GATAGAGGAAAGGCCCAGAGAGG + Intronic
1094505136 12:31055187-31055209 GTGGGAGGGCAGGCCCTCACAGG - Intergenic
1096152477 12:49323317-49323339 GAAGCTGGGTAGGCCCTGAGGGG + Exonic
1097240421 12:57571397-57571419 GAGGGAGGGCAGGACATGAGAGG + Intronic
1098379444 12:69853248-69853270 GATGGGGGGCAGCCCCTGCCCGG - Intronic
1101711154 12:107267977-107267999 GGTGGAGAGCAGGCCCCAAGTGG + Intergenic
1101740415 12:107495620-107495642 CATGGAGGGCAGGCCCTGAGAGG - Intronic
1101875237 12:108593031-108593053 CATGGGGGCCAGACCCTGAGGGG - Intronic
1102460593 12:113097364-113097386 GATGCGGGGCAAGCCCTTAGGGG + Exonic
1104045459 12:125159713-125159735 GCTGAAAAGCAGGCCCTGAGAGG - Intergenic
1104651451 12:130537434-130537456 GATGCAGGGCAGGACCTTGGAGG + Intronic
1104897637 12:132172133-132172155 CATGGAGGCCAGTCCCAGAGCGG - Intergenic
1106181310 13:27371911-27371933 GCTGGAGGGCGGGCACTCAGGGG + Intergenic
1107401382 13:40072972-40072994 AGTGGAGGGATGGCCCTGAGAGG + Intergenic
1107689168 13:42934758-42934780 GATGGGGGCCAGGCCATGAGGGG - Intronic
1110889897 13:80686115-80686137 GAAGGAGGAAGGGCCCTGAGAGG - Intergenic
1111620322 13:90716691-90716713 GATGGAAAGCAGCCCCAGAGTGG - Intergenic
1113225640 13:108156698-108156720 GATGCAGCGCAGTCCCTCAGTGG - Intergenic
1114644890 14:24249831-24249853 GATGGAGGGGATGGCATGAGAGG - Intronic
1115067361 14:29280411-29280433 GATGAGTGGCAGGCCCTGACTGG + Intergenic
1116622872 14:47227963-47227985 GATGGAGAGCAGGCACTTGGTGG - Intronic
1116978998 14:51147849-51147871 GAAGGAGGCCAGAGCCTGAGAGG - Intergenic
1117423553 14:55572346-55572368 GATGGAGTGAGGTCCCTGAGGGG + Intronic
1119185943 14:72642677-72642699 CATGGAGGGCAAGGCCTGAGGGG - Intronic
1119535952 14:75402358-75402380 AACGGCAGGCAGGCCCTGAGCGG + Intergenic
1119648553 14:76366837-76366859 GGTGCAGGGCAGGACCTGTGTGG + Intronic
1119752251 14:77087883-77087905 GAAGGAGTGCAGGCTCAGAGAGG - Intergenic
1119851952 14:77872566-77872588 GATGGGGGGCTGGCCTTGGGGGG + Intronic
1121903854 14:97721855-97721877 GATGAAGGGAAGACACTGAGAGG + Intergenic
1122129912 14:99598926-99598948 AAAGGAGGGCTGGCCTTGAGAGG - Intronic
1122977629 14:105177447-105177469 GATGGTGGGCAGGCCCTCTCAGG - Intronic
1123457756 15:20441368-20441390 GAGGGAGAGCAGGTCCTGTGGGG - Intergenic
1123660314 15:22559049-22559071 GAGGGAGAGCAGGTCCTGTGGGG + Intergenic
1123699082 15:22901492-22901514 GATGGAGGGCGTGTCCTCAGCGG - Intronic
1124263902 15:28216522-28216544 GAGGGAGAGCAGGTCCTGTGGGG - Intronic
1124314172 15:28653538-28653560 GAGGGAGAGCAGGTCCTGTGGGG + Intergenic
1124867483 15:33507392-33507414 GAGATAGGGCAGACCCTGAGAGG - Intronic
1125518243 15:40334759-40334781 GAGGGAGGCCAGGCCCTGGGGGG + Exonic
1125744090 15:41987392-41987414 GATGAAGGGCAGGTCATGAGAGG + Intronic
1126463567 15:48939329-48939351 TATGAAGGGCAGGCAATGAGAGG + Intronic
1127535164 15:59883327-59883349 GATGGTGGGGAGGCCGTGTGGGG + Intergenic
1129239369 15:74242529-74242551 GGTGGAGGCAGGGCCCTGAGGGG - Intronic
1129385108 15:75192084-75192106 GATGGATGCCAGGGACTGAGGGG + Intergenic
1130046577 15:80450473-80450495 GATGGGGCACACGCCCTGAGAGG - Intronic
1131593794 15:93775942-93775964 GAGGGAGGGCAGGCTGTGTGAGG + Intergenic
1131968041 15:97866482-97866504 GAGGCAGGGCAGGGCTTGAGTGG - Intergenic
1132390693 15:101436245-101436267 GATGGAGGGAAGGCCACGAAGGG + Intronic
1132399543 15:101496932-101496954 GAGGGAGGGGAGGTCCTCAGTGG - Intronic
1132578141 16:673332-673354 GGTGGAGGCCAGGCCCTGGAGGG - Intronic
1132663416 16:1071384-1071406 GATGGTGGGCAGAGGCTGAGGGG + Intergenic
1132665240 16:1078479-1078501 ACTGCAGGGCAGGCTCTGAGGGG + Intergenic
1132753066 16:1467744-1467766 GAAGCACGGCAGGCCTTGAGTGG - Intronic
1132845666 16:1999803-1999825 GATGGAGGCCAGCCCCAGTGTGG + Exonic
1132941237 16:2509345-2509367 GCTGGACAGCAGGCACTGAGGGG - Intronic
1133236571 16:4389951-4389973 GATAGAGGGCAGGTGCTGGGGGG + Intronic
1134241975 16:12513119-12513141 GAGGGAGGGCAGGGTCAGAGAGG - Intronic
1135413380 16:22251268-22251290 GATGGAGGCCAAGCTCTGGGGGG + Exonic
1136595841 16:31249305-31249327 GGTGGAGGCAAAGCCCTGAGGGG - Intergenic
1137901396 16:52272906-52272928 CATGGAGGTCATGCCCAGAGAGG + Intergenic
1138196011 16:55052827-55052849 GATGGGCGGCAGGGCCTGGGAGG - Intergenic
1138658097 16:58502107-58502129 TAGGGAGGGCAGGCCCTGCCAGG - Intronic
1139510229 16:67423875-67423897 GCTGGAGGGCCGCCCCTCAGAGG + Intergenic
1140230293 16:73112324-73112346 GAAGAAGGGCAGGGCCTGTGAGG + Intergenic
1141496132 16:84410955-84410977 GATGGAGCTGAGGCCCAGAGAGG - Intronic
1141733988 16:85840242-85840264 GAGGGAGTGAAGGCCCTGAGAGG - Intergenic
1142029042 16:87829383-87829405 GGTGGGGGACAGGCCCTGAGTGG - Intergenic
1142474833 17:182519-182541 GAGTGAGGGCAGGGCCTGGGCGG + Intergenic
1143028488 17:3954361-3954383 GATGGAGTGCAGGGCCTGGGGGG - Intronic
1143057620 17:4173970-4173992 GATGGTGGGCAGGTCCTGCTGGG + Exonic
1144848326 17:18231467-18231489 GGTGGACAGCAGGGCCTGAGGGG - Intronic
1144955782 17:19018157-19018179 GAAGGCGGACAGGCGCTGAGAGG + Intronic
1145062436 17:19741620-19741642 TCTGGAGAGCAGGCCCAGAGGGG - Intronic
1146507292 17:33416495-33416517 CCTGGAGGGCAGTCCCTGATAGG + Intronic
1147145015 17:38479656-38479678 GGTGGAGGGGAGGTCCCGAGGGG + Intronic
1147582897 17:41636932-41636954 GGTGGAGGACAGGCCCAGACAGG - Intergenic
1147650679 17:42060101-42060123 AATGGAGGGCTGACACTGAGTGG - Intronic
1147721623 17:42543193-42543215 GATGAAGGGCTGGCCCTGGAAGG - Exonic
1150227071 17:63530049-63530071 GATGGGGGGTGGGCCCTGAAGGG - Intronic
1150392575 17:64798489-64798511 TGTGGAGGCCAGGCTCTGAGGGG - Intergenic
1151769527 17:76151016-76151038 GATGGAAGCCAGGCCAGGAGCGG + Intronic
1151880686 17:76892826-76892848 GACTGAGGTCAGCCCCTGAGTGG - Intronic
1151907006 17:77055158-77055180 CAGGGAGGCCAGTCCCTGAGAGG - Intergenic
1152195614 17:78916567-78916589 GATGGAAGGCAGGCCCTGAGCGG - Intronic
1152418192 17:80176646-80176668 GATGCAGGGCAGGGCTGGAGTGG + Intronic
1152422620 17:80202259-80202281 CATGGAGGGCAGGGCCAAAGGGG + Exonic
1152616724 17:81341372-81341394 GATGGACGGAAGGCCCAGCGCGG - Intergenic
1152829459 17:82488214-82488236 GAGGGAGGGGCTGCCCTGAGTGG + Exonic
1152948089 17:83209367-83209389 TATGGAGGCCAAGGCCTGAGTGG - Intergenic
1153496761 18:5707209-5707231 GATGGAGAGGAGGCATTGAGAGG - Intergenic
1153699100 18:7674477-7674499 GAAGATGGGCAGGCACTGAGAGG + Intronic
1155214139 18:23628158-23628180 GATGAAAGTCAGGCCCAGAGAGG + Intronic
1156295016 18:35781645-35781667 AGTGGAGGACAGGCTCTGAGCGG + Intergenic
1157591494 18:48838898-48838920 GCTGGTGGGCAGGCCCGGGGAGG - Intronic
1159030561 18:63226270-63226292 GAGGCAGGGCAGGCCATGGGTGG + Intronic
1160526899 18:79543641-79543663 GAGGGACAGGAGGCCCTGAGAGG + Intergenic
1160532773 18:79575242-79575264 GATTGAGGGGAGGCCCTGCCAGG + Intergenic
1160579563 18:79875846-79875868 GATCGGGGGCAGACACTGAGTGG - Intronic
1160607076 18:80059320-80059342 GGTGGGGTGCAGGCCCTGGGGGG - Intronic
1161234935 19:3193113-3193135 GAGGGCAGGCAGGCCCTCAGAGG - Intronic
1161356342 19:3821282-3821304 GAGGGAGGGCAGGTCCAGCGTGG - Intronic
1163114573 19:15181203-15181225 GAAGGAGGGCAGGGCCTGTGAGG - Intronic
1163364589 19:16868941-16868963 GATGGAGGGCAGAGGCAGAGAGG + Intronic
1163847476 19:19645776-19645798 CATGAAGGGCGGGCCCTGTGGGG + Exonic
1164615127 19:29663159-29663181 CATGGAGGGTAGGCCCTGGCTGG - Intergenic
1164895516 19:31873792-31873814 GAAGGAGGGCATCCCCTTAGTGG + Intergenic
1165074499 19:33273421-33273443 GGTGGAGGGCAGGACCTGCAGGG + Intergenic
1165444519 19:35849493-35849515 GATGGGGAGCAGGCACTGGGGGG - Intronic
1165728488 19:38129243-38129265 CCTGGAGGCCAGGCCCTGCGTGG + Intronic
1166039228 19:40191930-40191952 GATGGAGGGCAGTCCCTGCGGGG - Exonic
1166310251 19:41958653-41958675 GGTGAAGGGCGGGGCCTGAGCGG + Intronic
1166992070 19:46698597-46698619 GAGGGAGGTGAGGCCCAGAGAGG - Intronic
1167277273 19:48545937-48545959 AGTGGAGGGCATGTCCTGAGTGG + Intergenic
1167779708 19:51591079-51591101 GAGGAAGGGCTTGCCCTGAGGGG - Exonic
1168315801 19:55484303-55484325 GATGGAGGGCAGGCCCTGAGGGG - Exonic
925202947 2:1983654-1983676 AGTGGTGGGCAGGCCCTGGGTGG - Intronic
925442973 2:3904258-3904280 GGTGGAGGGCAGGTCTTCAGGGG - Intergenic
926150869 2:10424997-10425019 GATGGAGGGCAGGGCAGGCGAGG - Intronic
926320571 2:11746269-11746291 GATCGCGGCCAGGCCCTGGGTGG + Intronic
926341650 2:11909212-11909234 GACAGAGGGCAGCCCCTGAATGG + Intergenic
927472521 2:23386203-23386225 GACGGAGGGCTGGCCCCCAGGGG + Intronic
927772753 2:25878180-25878202 GAAGAAGGGCAGGACCTGGGCGG - Intronic
932285740 2:70530286-70530308 GATGGTGGGCAGACCCTGGAAGG - Intronic
932356752 2:71073663-71073685 GATGCAGGGGAGGGCCTGGGCGG + Intronic
932417202 2:71580546-71580568 GAGCAAGGGCAGGCCCTGGGAGG + Intronic
932651905 2:73566989-73567011 GGAGGATGGCAGGCCCAGAGAGG - Intronic
933291928 2:80447665-80447687 GATGAAGGGAAGGGCCTGACTGG - Intronic
933780233 2:85795993-85796015 GAGAGAGGGCTGGCTCTGAGAGG - Intergenic
934127962 2:88916676-88916698 GATGGAGTTCAGGGCCAGAGAGG + Intergenic
934650025 2:96085404-96085426 GAGGGAGGGCTGGGACTGAGGGG + Intergenic
934732766 2:96669804-96669826 GAGGCAGGGCAGGCTCTGATTGG + Intergenic
934942064 2:98509960-98509982 GAGGAAGGGCAGTCCCAGAGAGG + Intronic
935091476 2:99898887-99898909 GAGGCAGGACAGGCCCTGTGAGG - Intronic
935115492 2:100131955-100131977 GATGGAGTGCCTGCCTTGAGGGG + Intronic
935836574 2:107061754-107061776 GTGGAAGGGCAGGCCATGAGGGG - Intergenic
936427706 2:112434647-112434669 CTTGGAGGGCAGCCGCTGAGGGG + Intergenic
936465918 2:112750055-112750077 GATGGAGGAGAGGCCCTGCAGGG - Intronic
936497939 2:113038873-113038895 GATGGAGATCAGGCATTGAGAGG - Intronic
937012110 2:118572121-118572143 GGTGGAGGGTGGGCCCTGGGAGG + Intergenic
937084462 2:119161513-119161535 GGTGGAGGGCTGGTCTTGAGAGG - Intergenic
938490159 2:131756958-131756980 GCTGGACAGAAGGCCCTGAGGGG + Intronic
939084154 2:137697083-137697105 ACTGCAGTGCAGGCCCTGAGAGG + Intergenic
940651050 2:156441148-156441170 GAAGGAAGGCATGCCCAGAGAGG + Intronic
942485786 2:176438558-176438580 GATGTGGGGCAGGACCTGGGTGG + Intergenic
946310686 2:218880976-218880998 CATGGCGCGCAGGCCCTGACGGG - Exonic
946423545 2:219579109-219579131 GATGGAGGGCAGGGAGTGACTGG - Intergenic
946471752 2:219967083-219967105 GCTGGAGGTCAGGCCCTCAAAGG - Intergenic
947552519 2:231056839-231056861 GGTGGCGGGCAGCCCCTGGGCGG + Intergenic
948075054 2:235159374-235159396 AGTGGAGGGCAGGCAGTGAGGGG + Intergenic
948421395 2:237862749-237862771 TATGGTGGGCTGGCCCTCAGTGG + Intronic
948454176 2:238097114-238097136 GAGGGAGGGCAGGGCCTGGAGGG + Intronic
948582424 2:238997176-238997198 GCTGGAGCGCAGGCCTGGAGCGG - Intergenic
948900700 2:240955631-240955653 GACAGAGGGCAGGCGCTCAGAGG + Intronic
1170940462 20:20844361-20844383 GGTGGCCGGCAGGCTCTGAGGGG - Intergenic
1171123700 20:22584877-22584899 GGCGGACGGCAGGCGCTGAGGGG - Intronic
1171201415 20:23245100-23245122 GATGGAGAGGAGTCCGTGAGGGG - Intergenic
1171305879 20:24105339-24105361 GATGGAGTGCAGGGGCTGATAGG + Intergenic
1172022440 20:31924151-31924173 GATGGTGGCCAGGCCCGGGGTGG - Intronic
1173185533 20:40837135-40837157 CATGGAAGGAAGGCTCTGAGTGG - Intergenic
1173973049 20:47167241-47167263 TCTGGAGGTCAGGCTCTGAGAGG + Intronic
1174064026 20:47851916-47851938 CAGAGAGGGCAGGACCTGAGTGG + Intergenic
1174302747 20:49594125-49594147 GATGGAAGGGAGGCTCAGAGAGG - Intergenic
1174611450 20:51801538-51801560 GCTGGAGGTCAGGCCCCGAAAGG + Intronic
1175339767 20:58221133-58221155 GAAGGAGGGCAGCCTCTGACTGG + Intronic
1175541596 20:59751327-59751349 CATGCAGGACAGGCCCTGTGAGG + Intronic
1175901455 20:62361460-62361482 GCTGGAGGGCCGGCCCCAAGGGG - Intronic
1175966055 20:62660795-62660817 GATGGAGGCCCTGCCCTGATTGG - Intronic
1175979393 20:62729441-62729463 GATGGAGGGTGGGCCCTCAGGGG + Intronic
1176374537 21:6080565-6080587 CTTGGAGGGCAGCCGCTGAGGGG - Intergenic
1178518366 21:33266952-33266974 TAGGGAGGGCTGGCACTGAGGGG - Intronic
1178847624 21:36186911-36186933 GACAGAGGCCAGGCTCTGAGTGG - Intronic
1179005152 21:37507482-37507504 GTTGGAGGGCAGGACCTAAGTGG - Intronic
1179748938 21:43457680-43457702 CTTGGAGGGCAGCCGCTGAGGGG + Intergenic
1180043415 21:45292047-45292069 CAGGGAGGCCTGGCCCTGAGCGG - Intergenic
1180124374 21:45778981-45779003 GCTGGGGGGCAAGCCCTGTGGGG - Intronic
1180199112 21:46214172-46214194 GACAGAGGACAGGGCCTGAGGGG + Intronic
1181055769 22:20259956-20259978 GATGCAGGGGAGGCCCACAGGGG - Intronic
1182903649 22:33919777-33919799 GAAGCCGAGCAGGCCCTGAGGGG + Intronic
1183597492 22:38821561-38821583 GAGGAAGGCCAGGCCCAGAGAGG + Exonic
1183699894 22:39445345-39445367 GCTGGAGGGTTGGCCCTGTGAGG + Intergenic
1184468686 22:44683567-44683589 GAAGGAGGGCAGGGGCTGGGGGG + Intronic
1184737133 22:46405956-46405978 GCTGGAGGGGTGGCCTTGAGGGG - Intronic
1184797507 22:46740605-46740627 GGTGGGGGTCAGGCCCTGTGTGG + Intergenic
1184822123 22:46917370-46917392 GACGGAGGACTGGGCCTGAGAGG + Intronic
1185399976 22:50610659-50610681 GGTTGAGGACCGGCCCTGAGTGG + Intronic
950178551 3:10894311-10894333 GAAGGCTGGCAGGACCTGAGAGG + Intronic
950482345 3:13252208-13252230 GATGGACGCCAGGGGCTGAGGGG - Intergenic
952919587 3:38275598-38275620 GATCCAGGGCATTCCCTGAGGGG - Exonic
953168046 3:40482671-40482693 GCTGGGGGAGAGGCCCTGAGAGG + Exonic
953256766 3:41298038-41298060 GATAGAGGGAATACCCTGAGTGG - Intronic
953736453 3:45498041-45498063 TATAGAGGGAAGGCCCTGAAGGG - Intronic
954449494 3:50563985-50564007 GAATGAGGCCAGGGCCTGAGAGG - Intronic
954465511 3:50652255-50652277 GGGGGAGGGCAGGCCGTGTGTGG + Intergenic
955231060 3:57098968-57098990 GAAGGCTGGCAGGCTCTGAGAGG + Intronic
959733298 3:109628681-109628703 GATGGAGAGCAGACCTGGAGGGG + Intergenic
959946716 3:112133130-112133152 GACGGAGGGGAAGCCCTGAGAGG - Exonic
960603077 3:119477679-119477701 GATGGAGGCTAGGGCGTGAGAGG + Intronic
962346281 3:134620963-134620985 GCTGGAGGAGAGGTCCTGAGGGG + Intronic
962715799 3:138124938-138124960 GCAGGAGGCCAGGCCCAGAGAGG + Intronic
962967948 3:140371520-140371542 ACTGGAGGGCAGGGCCTCAGGGG - Intronic
963628542 3:147704507-147704529 GTTGGAGGGCAGGGGCTGGGAGG + Intergenic
963737965 3:149042572-149042594 AATGGATGGCATGCCCTGAGGGG + Intronic
964846491 3:161049805-161049827 GATGGAGGGCAGGGCTGGTGAGG - Intronic
965698554 3:171436114-171436136 GATGGAGGGAAGGTCAGGAGTGG - Intronic
968149332 3:196324645-196324667 CATGGTGGGGAGGCCGTGAGGGG + Intronic
968233338 3:197016913-197016935 GAAGGAGGGCTGGCCAGGAGAGG - Intronic
968751185 4:2389885-2389907 GCTGGAGGGGATGCCGTGAGGGG - Intronic
968889638 4:3361617-3361639 GAGCGAGGGAAGGCCCTCAGTGG + Intronic
969423069 4:7108432-7108454 CATGCAGGGCAGCACCTGAGAGG + Intergenic
971343611 4:25792474-25792496 TATGGAGGGCAACCCATGAGCGG + Intronic
973091930 4:46147716-46147738 GAGGGAGGGCATGACCTGATAGG - Intergenic
974870615 4:67637267-67637289 GGTGGAGGGCAGCCCCTGCCCGG + Intronic
975478768 4:74854426-74854448 TAAGAAGGGCATGCCCTGAGAGG + Intergenic
976144552 4:82029469-82029491 TTTGGAGGGCAGGCATTGAGTGG - Intronic
978651735 4:111013947-111013969 GATGGAGGTAAGGCCGTGTGAGG - Intergenic
979070263 4:116194848-116194870 GAAGGGTGGCATGCCCTGAGAGG - Intergenic
979531361 4:121772260-121772282 GATGGAGGGCTGGCCTGGAGTGG - Intergenic
981691731 4:147516205-147516227 GCTGCAGGGCAGGCCCTTGGAGG - Intronic
984695492 4:182775331-182775353 GAGGGAGGTCAGGTCGTGAGAGG + Intronic
985520523 5:372154-372176 GGAGGAGGGAAGGCACTGAGGGG - Intronic
985698671 5:1357652-1357674 GATGGGTGGCAGGCACTGCGGGG + Intergenic
985830051 5:2221507-2221529 GATGGAGAGGCGGCCTTGAGGGG + Intergenic
985987294 5:3526928-3526950 GGTGGAAGCCAGGGCCTGAGGGG - Intergenic
985990314 5:3552375-3552397 GTTGGAGGGCGGGGCCTGAGAGG + Intergenic
986018539 5:3779538-3779560 GGAGGAGGGCTGGCCCGGAGTGG + Intergenic
986208574 5:5648772-5648794 GATGGTGGGCAGGCCGTGCGTGG - Intergenic
988680695 5:33481195-33481217 GATGGAGGGGAGGGGATGAGGGG - Intergenic
989648762 5:43665843-43665865 GATGGGGGGCAGCCCCTGCCCGG - Intronic
990740169 5:58904220-58904242 GCAGGAGTGCAGGCCCTGGGAGG + Intergenic
995344700 5:111098459-111098481 GATGGAAGGCAGAGCCTCAGAGG + Intronic
995846862 5:116502845-116502867 TATTGAAGGCAGCCCCTGAGAGG + Intronic
998530353 5:142878798-142878820 GTTGGAATGCAGGACCTGAGGGG + Intronic
999279357 5:150354809-150354831 GATGGAGGGAATGCTCTGAGAGG - Intergenic
999640879 5:153672127-153672149 GAAGGAGAACAGTCCCTGAGGGG + Intronic
999918635 5:156292287-156292309 GATGGTTGCCAGGGCCTGAGGGG - Intronic
1001037821 5:168310545-168310567 GTTGGAGGCCAGGCACAGAGTGG + Intronic
1001629365 5:173163361-173163383 GATCGTGGGCAGGCACTGTGAGG - Intronic
1002282102 5:178137125-178137147 GATGGAGAGCAGGCCAGGTGAGG + Intronic
1002292151 5:178207262-178207284 GCTGGAGAGCTGGCCCTTAGAGG + Intronic
1002337313 5:178489010-178489032 GATGAGGGGCAGATCCTGAGGGG - Intronic
1002742256 5:181442522-181442544 TATGGAGGCCAAGGCCTGAGTGG - Intergenic
1003017880 6:2482600-2482622 CATGCAGGGGAAGCCCTGAGTGG - Intergenic
1003163750 6:3658258-3658280 GGTGGAGGGCAGACTCTGATGGG + Intergenic
1003563675 6:7204316-7204338 GATGGAGAGCAGACACAGAGAGG - Intronic
1003754465 6:9100954-9100976 GAAGGATGGCAGGCCCAGGGTGG + Intergenic
1006042572 6:31268454-31268476 GAAGGAGGGCAGGAGCTGAATGG + Intergenic
1006439844 6:34047225-34047247 GATGGAGGGGAGGCCTCCAGGGG - Intronic
1006624674 6:35388923-35388945 CACAGAGGGCAGGCACTGAGAGG - Intronic
1006802716 6:36769552-36769574 GAGGGCTGACAGGCCCTGAGGGG + Intronic
1007284999 6:40741243-40741265 GCTGGAGGACAGGACCTCAGAGG - Intergenic
1007506612 6:42340321-42340343 GAGGGAGGGCAGGCAGAGAGAGG + Intronic
1013292042 6:108728175-108728197 GAGGGAAGGCAGGGCCTCAGGGG + Intergenic
1017432873 6:154388175-154388197 GATGGTGGCCAGGGGCTGAGGGG - Exonic
1017847007 6:158267482-158267504 GAGGGAGGGTAGGACCTGGGAGG + Intronic
1018685094 6:166298092-166298114 GAAGGAGGACAGGCGCTGAGGGG - Intergenic
1018944960 6:168341189-168341211 GAGGGAGACGAGGCCCTGAGTGG - Intergenic
1019247392 6:170718260-170718282 TATGGAGGCCAAGGCCTGAGTGG - Intergenic
1019530893 7:1502847-1502869 GATGGACGGCATGAGCTGAGGGG + Intronic
1019735209 7:2647042-2647064 GACGGAGGGCGGGGCCAGAGGGG + Intronic
1019775949 7:2912354-2912376 GGTGGCAGGCAGGGCCTGAGTGG - Intronic
1020084813 7:5304390-5304412 GATGCAGTGCAGTCCCTGAGGGG - Exonic
1020760332 7:12261300-12261322 GGTGGAGCACAGGCTCTGAGTGG - Intergenic
1021125916 7:16851096-16851118 GCAGCAGGGCTGGCCCTGAGGGG + Intergenic
1021213743 7:17889407-17889429 GATAGAGGAAAGGGCCTGAGAGG + Intronic
1022318169 7:29264011-29264033 GCTGGGGGGCAGGCCCCGGGTGG + Intronic
1022648995 7:32257908-32257930 GCTGCAGGACAGTCCCTGAGAGG - Intronic
1023465128 7:40446062-40446084 GAAGGATGGCATGCCCTGGGAGG - Intronic
1024039797 7:45543208-45543230 CATGTAGTGCAGGCTCTGAGTGG + Intergenic
1024234396 7:47386956-47386978 CATGGAGGGCAGGGCATGTGAGG - Intronic
1026929907 7:74218043-74218065 GGGGGTGGGCAGGGCCTGAGGGG - Intronic
1029123029 7:98281294-98281316 GGGGGAGGGCGGGGCCTGAGAGG - Intronic
1029469978 7:100748214-100748236 GGGTGAGAGCAGGCCCTGAGAGG + Exonic
1030558113 7:111052104-111052126 GAAAGATGGCAGGCCCTGAAAGG + Intronic
1033306513 7:140229968-140229990 GATTGAGGGCGCGCCCTGGGAGG - Intergenic
1034089397 7:148350037-148350059 GATGGTGGGGAGACCATGAGTGG + Intronic
1034089523 7:148351191-148351213 GATGGTGGGAAGACCATGAGTGG + Intronic
1034529601 7:151687641-151687663 GAGGAAGTGCAGGCTCTGAGAGG + Intronic
1034718705 7:153267548-153267570 GATGGGGTACAGGCTCTGAGTGG - Intergenic
1035109779 7:156471428-156471450 CATGCAGGGGAGGCCCAGAGAGG - Intergenic
1035287203 7:157814157-157814179 GATGGAGGCCAAGCCCAGGGAGG - Intronic
1035500745 8:89676-89698 TATGGAGGCCAAGGCCTGAGTGG + Intergenic
1036611754 8:10356391-10356413 GATGGAGGAGAGGCTCTTAGGGG - Intronic
1037488703 8:19375989-19376011 GATGGAAGGGAGGCCTGGAGAGG - Intronic
1037821878 8:22139002-22139024 GATGGAGCGCAGGTCCTGCATGG + Exonic
1038135979 8:24786304-24786326 GATGGTTGCCAGGCCCTGTGTGG + Intergenic
1039558689 8:38495852-38495874 CAGGGAGGGCAGGGCCTCAGGGG - Intergenic
1039941386 8:42094297-42094319 AAAGGAGGGCAGACCCTGATAGG + Intergenic
1041699162 8:60768529-60768551 GTTGGAGGGCAGGGTCTGAGCGG - Intronic
1041751491 8:61265787-61265809 GAAAGAAGGCAGGACCTGAGTGG - Intronic
1043322696 8:79009465-79009487 GATGGAGGGCAGGAGGTGAAGGG - Intergenic
1044274379 8:90283622-90283644 GAGGCAGGGCAGGCCATGGGTGG - Intergenic
1045660113 8:104428552-104428574 AATGGAGGGCAGGCCCTCCGGGG + Intronic
1049193090 8:141299581-141299603 GGTGGTGCGCAGGCCCTGATGGG + Intronic
1049246788 8:141567172-141567194 GATGGAAGGGGAGCCCTGAGGGG + Intergenic
1049255964 8:141614048-141614070 GATGGAAAGGAGGCCCAGAGAGG - Intergenic
1049329698 8:142043636-142043658 GCAGGAGGGCAGGATCTGAGAGG + Intergenic
1049360953 8:142212430-142212452 CATGGAGGTAGGGCCCTGAGAGG + Intronic
1049602507 8:143514405-143514427 GCTGGGAGGCAGGCCCTGGGTGG - Intronic
1049690715 8:143957737-143957759 GGTGGTGGGCAGGGCCTCAGGGG - Intronic
1049773912 8:144396072-144396094 TGTGGAGGCCAGGCCCTGCGAGG + Intronic
1049794756 8:144492047-144492069 GCTGGAGGGCAGGCAATGTGGGG + Intronic
1050438603 9:5635677-5635699 TATGGAGGGCAGGACCTGGTAGG + Intronic
1051882789 9:21857058-21857080 GATGGAGTGGGGGGCCTGAGAGG + Intronic
1053484592 9:38442309-38442331 GATGGAAGGCAGAGCCTGTGGGG + Intergenic
1057016459 9:91656933-91656955 GATGCAGGGCAGATGCTGAGGGG + Intronic
1057305310 9:93908930-93908952 GCTGGAGTGCAGCCCCTGATGGG + Intergenic
1057497985 9:95575269-95575291 CACGGAGGCCAGTCCCTGAGGGG + Intergenic
1057750574 9:97789379-97789401 GAGGGTTGGCAGGCCCTGGGGGG + Intergenic
1059099755 9:111458842-111458864 CATGTAGGGCAAGGCCTGAGAGG - Intronic
1059344901 9:113621357-113621379 GATGGGAGGCAGGCCTGGAGGGG + Intergenic
1059353100 9:113679503-113679525 GCTGTGGGGCAGGCCATGAGTGG - Intergenic
1060201214 9:121652556-121652578 GAGGGAGGGAAGCCCCTGGGAGG + Intronic
1060828466 9:126699635-126699657 GATGCAGGGCCTGCCTTGAGGGG + Exonic
1061037915 9:128123694-128123716 GAAGGAGGCCAGGACGTGAGTGG - Exonic
1061216997 9:129227354-129227376 CATCGAGGGCAGTGCCTGAGAGG + Intergenic
1061327464 9:129873017-129873039 GAGGGAGGGAAGGCCCTGGCTGG - Intronic
1061773376 9:132944678-132944700 GAAGGAGGGGAGGTCCGGAGGGG - Intergenic
1061798852 9:133103517-133103539 GAGGGAAGCCAGGCCCTCAGCGG - Intronic
1061942586 9:133891508-133891530 GATGGAGGGGAGGCATGGAGGGG + Intronic
1062283579 9:135763024-135763046 CAGGCAGAGCAGGCCCTGAGTGG + Intronic
1062658290 9:137615229-137615251 GAGGCTGGGCAGGTCCTGAGTGG - Exonic
1203608165 Un_KI270748v1:73737-73759 TATGGAGGCCAAGGCCTGAGTGG - Intergenic
1186087116 X:6002748-6002770 GGTGCAGGGCAGGCCATGGGTGG - Intronic
1188090026 X:25952988-25953010 GCTTTAGGTCAGGCCCTGAGAGG + Intergenic
1189155525 X:38752565-38752587 GATGGAGAGCAGGCTTTGAGTGG + Intergenic
1189232934 X:39466166-39466188 GTAGGAGGCCAGGCCCAGAGAGG - Intergenic
1191616785 X:63177662-63177684 TCTGGAGAGCAGGCCTTGAGTGG + Intergenic
1191619512 X:63201261-63201283 TCTGGAGAGCAGGCCTTGAGTGG - Intergenic
1192196331 X:69031329-69031351 GGAGAGGGGCAGGCCCTGAGCGG - Intergenic
1192565644 X:72161186-72161208 AATGGAGGGAAGTGCCTGAGAGG - Intergenic
1192589999 X:72351700-72351722 CAAGGAGGGCAGGCCTCGAGGGG + Intronic
1194765283 X:97842024-97842046 GATGGGGGGAAGACTCTGAGTGG - Intergenic
1197715446 X:129703010-129703032 CAAGGAGGTCAGGCTCTGAGGGG - Intergenic
1197716089 X:129706961-129706983 CATGGAGAATAGGCCCTGAGAGG - Intergenic
1197752244 X:129973188-129973210 CATGGTGGGCAGGACTTGAGGGG + Intergenic
1198962429 X:142196191-142196213 GAGGGAGTACAGGCCCTGGGAGG - Intergenic
1199445077 X:147911957-147911979 GGTGGAGGGCCGCCTCTGAGCGG + Intronic
1199873356 X:151915608-151915630 GAAGCAGGCCAGGCCCTGTGAGG + Intronic
1199873883 X:151917652-151917674 GAAGCAGGCCAGGCCCTGTGAGG + Intronic
1199874061 X:151918327-151918349 GAAGCAGGCCAGGCCCTGTGAGG + Exonic
1199875081 X:151922383-151922405 GAGGAAGGGCAGGCCCTGTCAGG + Intronic
1200123185 X:153800811-153800833 CATGGGGGTGAGGCCCTGAGGGG + Intergenic
1200789210 Y:7284792-7284814 AATGGAGGGATGGCCCTGTGAGG - Intergenic