ID: 1168316194

View in Genome Browser
Species Human (GRCh38)
Location 19:55485766-55485788
Sequence CTGGAGATGCTGAAGGTGAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 514
Summary {0: 1, 1: 1, 2: 2, 3: 47, 4: 463}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168316178_1168316194 30 Left 1168316178 19:55485713-55485735 CCCCCAGCCACCTGTCAGTGCGG 0: 1
1: 0
2: 0
3: 17
4: 173
Right 1168316194 19:55485766-55485788 CTGGAGATGCTGAAGGTGAGAGG 0: 1
1: 1
2: 2
3: 47
4: 463
1168316182_1168316194 28 Left 1168316182 19:55485715-55485737 CCCAGCCACCTGTCAGTGCGGGA 0: 1
1: 0
2: 0
3: 10
4: 91
Right 1168316194 19:55485766-55485788 CTGGAGATGCTGAAGGTGAGAGG 0: 1
1: 1
2: 2
3: 47
4: 463
1168316183_1168316194 27 Left 1168316183 19:55485716-55485738 CCAGCCACCTGTCAGTGCGGGAG 0: 1
1: 0
2: 0
3: 12
4: 120
Right 1168316194 19:55485766-55485788 CTGGAGATGCTGAAGGTGAGAGG 0: 1
1: 1
2: 2
3: 47
4: 463
1168316180_1168316194 29 Left 1168316180 19:55485714-55485736 CCCCAGCCACCTGTCAGTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 182
Right 1168316194 19:55485766-55485788 CTGGAGATGCTGAAGGTGAGAGG 0: 1
1: 1
2: 2
3: 47
4: 463
1168316186_1168316194 20 Left 1168316186 19:55485723-55485745 CCTGTCAGTGCGGGAGATGAGGG 0: 1
1: 0
2: 0
3: 13
4: 460
Right 1168316194 19:55485766-55485788 CTGGAGATGCTGAAGGTGAGAGG 0: 1
1: 1
2: 2
3: 47
4: 463
1168316184_1168316194 23 Left 1168316184 19:55485720-55485742 CCACCTGTCAGTGCGGGAGATGA 0: 1
1: 0
2: 1
3: 9
4: 74
Right 1168316194 19:55485766-55485788 CTGGAGATGCTGAAGGTGAGAGG 0: 1
1: 1
2: 2
3: 47
4: 463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168316194 Original CRISPR CTGGAGATGCTGAAGGTGAG AGG Exonic
900119617 1:1042910-1042932 CTGGGGATGCTGGTGGTCAGGGG + Intronic
900180539 1:1309116-1309138 CTGGAGATGGTGAACCTGACCGG - Exonic
902758656 1:18566578-18566600 ATGTAGATGGTGAAGGTGGGTGG + Intergenic
902768871 1:18634268-18634290 GGGGAGATGCAGAAGGAGAGAGG - Intronic
902839959 1:19068319-19068341 CTGCAGATGCTGAAGGTCACTGG + Intergenic
903779790 1:25813979-25814001 CTGGAGGAACTGCAGGTGAGCGG + Exonic
904035981 1:27558747-27558769 CTGGAGATGCTGATGAAGACAGG - Exonic
904603239 1:31684813-31684835 CTGAAGGGGCAGAAGGTGAGAGG - Exonic
905266984 1:36761104-36761126 CTGGAGATGCTTCAGCAGAGAGG + Intergenic
905795299 1:40812695-40812717 ATGGAGATGGTCAAGGTCAGAGG + Intronic
906154669 1:43606886-43606908 CCGGAGATGCTGTGGGTGACGGG + Exonic
906564779 1:46791153-46791175 CTGGATATGGTGAAAGTGAGGGG - Intronic
907306035 1:53513663-53513685 CTGGAGATGCTTACTGTGAGAGG - Intronic
908457251 1:64315783-64315805 CAGGACAAGCTGAAGTTGAGGGG + Intergenic
910013135 1:82490099-82490121 CTGGAGATGCGAAAGATCAGAGG + Intergenic
910792941 1:91069876-91069898 CTTGAAAGGCTGAAGGTGGGAGG - Intergenic
910803591 1:91168224-91168246 TTGGAGAAGCTGAAGAAGAGAGG + Intergenic
910935500 1:92482864-92482886 CTGGAGACGCGGAGGGTGACGGG + Exonic
912702739 1:111890253-111890275 CTGAAGATGGAGATGGTGAGAGG + Intronic
912943286 1:114063731-114063753 CAGGAGATGCTGAAGCTGATAGG - Intergenic
913325264 1:117622828-117622850 CTGGGGAAACTGAAAGTGAGGGG - Exonic
913544483 1:119853720-119853742 CTGGGAACGCTGAAGGTGGGAGG - Intergenic
913602316 1:120433658-120433680 CTGGGAACGCTGAAGGTGGGAGG + Intergenic
914084730 1:144442979-144443001 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914190742 1:145408145-145408167 CTGGGAACGCTGAAGGTGGGAGG - Intergenic
914363490 1:146957264-146957286 CTGGGAACGCTGAAGGTGGGAGG + Intronic
914488187 1:148129870-148129892 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914588551 1:149084990-149085012 CTGGGAACGCTGAAGGTGGGAGG - Intronic
915047682 1:153032383-153032405 CTGCTGCTGCTGAAGCTGAGGGG - Exonic
915507153 1:156365143-156365165 CTTGGGAGGCTGAAAGTGAGAGG + Intronic
915541884 1:156572575-156572597 CTGGCGGTGCCGACGGTGAGGGG - Intronic
916764012 1:167842925-167842947 CTGGAATTACTGAAGGTGTGTGG + Intronic
917742451 1:177974194-177974216 TTGCACATGCTGAATGTGAGGGG + Intronic
918146179 1:181758097-181758119 GTGCTGATGATGAAGGTGAGAGG + Exonic
918697173 1:187559272-187559294 TTGGAGTAACTGAAGGTGAGGGG - Intergenic
919068642 1:192726245-192726267 CTGAAGATGCTGAAGCTTAAAGG - Intergenic
920660820 1:207912724-207912746 CTGGAGCTGAGGAAGTTGAGGGG - Intergenic
920930538 1:210383686-210383708 TGGGAGATGCTGATGGAGAGGGG + Intronic
921045072 1:211470387-211470409 CTGGAGCTAGTAAAGGTGAGTGG - Intergenic
921169138 1:212530328-212530350 ATGGAGATGTAGAAGGGGAGAGG - Intergenic
921364388 1:214359978-214360000 ATGGACATGGTGAAGGTGAGGGG - Intronic
923102350 1:230826572-230826594 CGGGGGAAGCTGGAGGTGAGGGG - Intergenic
923143697 1:231183131-231183153 GTGGAGATGGTGATGATGAGAGG - Intronic
923311397 1:232739027-232739049 TTTGGGAGGCTGAAGGTGAGAGG - Intergenic
924623870 1:245684813-245684835 CTGGACATGCAGCAGGGGAGGGG - Intronic
1063011909 10:2030640-2030662 AGGGAGATGTTGATGGTGAGGGG - Intergenic
1064336443 10:14447888-14447910 TTGAAGCTGCTGAAGGTCAGAGG + Intronic
1065127127 10:22584481-22584503 CTGGAGAAACAGAAGGGGAGAGG + Intronic
1069556223 10:69400310-69400332 CTGAAGATGCTTGTGGTGAGGGG - Intronic
1070333804 10:75437146-75437168 CTGGAGATGTTGAGGGTGTCAGG + Intronic
1070657833 10:78283369-78283391 CTGGAGCTGCTGCAGGTGGGAGG + Intergenic
1070789587 10:79181326-79181348 CTGAGGAGGCTGGAGGTGAGCGG + Intronic
1071432588 10:85618017-85618039 CTGGAGAAGGTGGAGATGAGTGG - Intronic
1073099500 10:100999454-100999476 CTGGAGAAGCGGAGGGGGAGGGG + Exonic
1073606572 10:104901593-104901615 CTGGAGAGACTGTAGGTGAGGGG - Intronic
1074474160 10:113754463-113754485 CTGGAGAAACTGAATCTGAGAGG - Intronic
1075321950 10:121498542-121498564 ATGGAGATGATGAAGATGATTGG - Exonic
1075508340 10:123047076-123047098 CTGGAGATGCTGAGGTGGTGAGG - Intronic
1075648178 10:124110019-124110041 CTGCAGATGGTGGAGGTGGGTGG - Intergenic
1075712869 10:124540177-124540199 GTGGAGATGCTGTGGGTGGGTGG + Intronic
1076062453 10:127424032-127424054 CTGGAGACCCTGTAGTTGAGTGG - Intronic
1076067932 10:127463851-127463873 CTGGAGCTGGGGAAGCTGAGTGG + Intergenic
1076141124 10:128079090-128079112 CAGGTGATGCTGAAAGGGAGGGG - Intronic
1076344038 10:129768501-129768523 TTGACGTTGCTGAAGGTGAGTGG + Intergenic
1076461463 10:130650119-130650141 CAGCTGATGCTGCAGGTGAGGGG + Intergenic
1076606523 10:131693056-131693078 CTGGAGAAACTGAAGCTGCGGGG - Intergenic
1076920993 10:133454593-133454615 CAGGAGAGGCTGGAGGTGAGAGG + Intergenic
1077035121 11:490709-490731 CTGGCGAGGCTGAAGGCGAGGGG + Exonic
1077530533 11:3092759-3092781 GGGGACAGGCTGAAGGTGAGAGG + Intronic
1078107602 11:8368439-8368461 CTGGGTCTGCTGAGGGTGAGGGG - Intergenic
1078941823 11:16014934-16014956 CAGAAGATGCAGAGGGTGAGTGG - Exonic
1079536590 11:21522548-21522570 ATGGAGACTCTGAAGGTGTGCGG + Intronic
1079712723 11:23707408-23707430 TTGCAGATGCTGAGGGTGGGGGG - Intergenic
1080944516 11:36956533-36956555 CATGGGATGCTGAAGGTGGGAGG + Intergenic
1081489508 11:43556632-43556654 GGGGGGATGCTGAAGGAGAGAGG - Intronic
1081690705 11:45075924-45075946 CTGGAGAAGATGACGGTCAGTGG + Intergenic
1082104889 11:48211081-48211103 ATGCAGATGCAGAAGCTGAGTGG + Intergenic
1083258182 11:61509134-61509156 CTGCAGAAGCTGTATGTGAGCGG + Exonic
1083799104 11:65036028-65036050 CTGCAGATCCTGAAGGCAAGAGG + Intronic
1083841180 11:65305085-65305107 ATGGAGATGATGAAGTTGAAAGG - Intronic
1084188779 11:67489441-67489463 ATGGAGATGCTGAAGGTGAGGGG + Exonic
1084289851 11:68155616-68155638 CTGGAGGTGCTGGAGGGCAGCGG - Exonic
1084400539 11:68940429-68940451 CTGAAGATGCTGAGGCTGTGGGG - Exonic
1084534515 11:69748754-69748776 CTGGAGGTCTTGGAGGTGAGAGG + Intergenic
1084697196 11:70762753-70762775 CTGGAGAGGCAAGAGGTGAGGGG + Intronic
1084921869 11:72477466-72477488 CTGAAGAGGCTGAAGGAGGGCGG + Intergenic
1085126807 11:74007537-74007559 CTCGGGAGGCTGAAGGTGGGAGG - Intronic
1086166799 11:83788801-83788823 CTGGAAATGGAGATGGTGAGGGG - Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1088987441 11:114922101-114922123 CTGCATATGCTGAGGGAGAGAGG - Intergenic
1089004898 11:115083256-115083278 ATGCAGATGATGAAGATGAGAGG - Intergenic
1089067005 11:115669823-115669845 TAGGAGAAGCTGCAGGTGAGTGG + Intergenic
1089299634 11:117490824-117490846 CTGGGGAGAGTGAAGGTGAGTGG + Intronic
1089357908 11:117867332-117867354 GTGGAGATGGGGAAGGAGAGAGG - Intronic
1089519579 11:119054976-119054998 CTGAAGATTTTGCAGGTGAGTGG - Exonic
1089737002 11:120556514-120556536 CTGGAGTGGCAGGAGGTGAGTGG - Intronic
1089969246 11:122679168-122679190 CTGGACATGTTGAGGGTGAAGGG + Intronic
1090206022 11:124884905-124884927 CAGGAGAAGCTGAAGGACAGTGG + Exonic
1090458467 11:126869393-126869415 CTGGAGACACTGCAGGAGAGTGG - Intronic
1090991236 11:131818707-131818729 CTGGAGATAATGAATGTGAAAGG + Intronic
1091558447 12:1593612-1593634 CTGGAGGTGCTGGAGCTGGGAGG - Exonic
1091617285 12:2059219-2059241 GCTGAGATGCAGAAGGTGAGGGG + Intronic
1092482121 12:8869121-8869143 CTGGAGAAGCTGAATAAGAGAGG - Exonic
1093091763 12:14929312-14929334 CTGGAGAGACTGCAGGAGAGTGG - Intronic
1095722753 12:45418368-45418390 CAGTAGATGTTGAAGGTGTGGGG - Intronic
1095793669 12:46194549-46194571 CTGGTGTTCCTGAAAGTGAGGGG - Intronic
1096028624 12:48390652-48390674 CAGGAGATGCTCAAGGAGAATGG - Intergenic
1097045074 12:56181510-56181532 CTGGGGTTGGTGAAGGAGAGGGG + Exonic
1097059070 12:56268945-56268967 CTGTAGTTCCTGAAGGTGCGTGG + Intronic
1097405385 12:59183105-59183127 TTTGAGAGGCTGAAAGTGAGGGG + Intergenic
1097732612 12:63146661-63146683 ACTGAGATGCTGAAGGTGAGAGG - Exonic
1098971712 12:76863973-76863995 CTGGAGAAGCTGCTGGGGAGAGG - Intronic
1099989504 12:89708386-89708408 CGGGAGATTGTGAAGGTGAGCGG - Intronic
1100275072 12:93064293-93064315 CTGGTGAGGCTGAAGCCGAGTGG - Intergenic
1100504533 12:95206580-95206602 CTTGGGAGGCTGAAGGTGGGTGG + Intronic
1101365287 12:104064757-104064779 CTGGAGCTGCGGAGGGGGAGGGG + Intronic
1101502577 12:105317709-105317731 CTGGAGAAACTCAAGGTGGGTGG + Intronic
1101612452 12:106303456-106303478 CTGGTGCTGCTGGAGGGGAGGGG + Intronic
1102146113 12:110656234-110656256 GTGAAGATGGTGAAGGGGAGAGG + Intronic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1103887533 12:124214158-124214180 CTGGAGATTAGGAAGCTGAGGGG - Intronic
1103934383 12:124467617-124467639 GTGAAGATGATGAAGATGAGGGG - Intronic
1104031121 12:125066156-125066178 CTGGAGATGAGGGAGGTCAGGGG - Intronic
1104098448 12:125583307-125583329 CTGGAGATTCTGGAGGTGTCGGG + Intronic
1104648476 12:130514004-130514026 CTGGGGAGGCTGAAGGTGTGGGG - Intronic
1105486105 13:20834462-20834484 CTCAAGAGGCTGAAGTTGAGAGG + Intronic
1105612288 13:21978872-21978894 CTGGAGAAAGTGCAGGTGAGTGG - Intergenic
1106005833 13:25769525-25769547 ATGCAGAAGCTGAAGGTGAGAGG - Intronic
1108297938 13:49043829-49043851 TTTGAGTTGCTGAAGGAGAGGGG - Intronic
1108713394 13:53056114-53056136 CTGGAAAGGCTGAAGGTGCAGGG + Intergenic
1109198294 13:59403476-59403498 CTGGAGATCATGACGTTGAGTGG + Intergenic
1109257244 13:60098059-60098081 CTGGACTTGGTGAAGGTCAGTGG + Intronic
1112137371 13:96596101-96596123 CTGGAGATTCACAAGGGGAGAGG - Intronic
1112288412 13:98124213-98124235 CTGGAAATGGTGGAGGTGACGGG - Intergenic
1113717591 13:112524056-112524078 CTGCAGATGCTGAGGGTGACGGG - Intronic
1113855701 13:113444331-113444353 CTGGAGATGCTGGGGGTTAGTGG + Intronic
1114526868 14:23371983-23372005 CTGGACCTGCTGAGGCTGAGTGG + Intergenic
1114785106 14:25587614-25587636 CTGGATATAGTGATGGTGAGTGG + Intergenic
1117070142 14:52048818-52048840 CTGGAGGTGTTGAAGGAGTGAGG + Intronic
1117978215 14:61319151-61319173 CTGGAGCTGAGGAAGGTGAGGGG - Intronic
1118065381 14:62185076-62185098 CTGGAGATAGTCAAGGAGAGTGG + Intergenic
1118644607 14:67825485-67825507 CTGGAGCTTATGAAGGTGACTGG + Exonic
1118723412 14:68609751-68609773 CTGGAGAAGAGGAAGGTGAAAGG - Intronic
1118839649 14:69500919-69500941 CTGGAGATGCTGCAGGAGTCTGG + Exonic
1119907175 14:78316437-78316459 CTGGAGATGCAGGAAGGGAGGGG + Intronic
1119909799 14:78339151-78339173 TTGGAGAAGCTGAAGGAAAGAGG + Intronic
1120616437 14:86711115-86711137 CTGGGCATGCTTAAGTTGAGAGG + Intergenic
1121699222 14:95939564-95939586 CTGGATACGCTGGAAGTGAGTGG - Intergenic
1121701178 14:95955217-95955239 CTGGAGATGCTGTTGGTCAGGGG + Intergenic
1121781712 14:96626212-96626234 CTGGCGATGATGACGCTGAGAGG - Intergenic
1121936867 14:98027935-98027957 CTGGTGATGCTGCAGGGGAGGGG - Intergenic
1122090289 14:99334041-99334063 AGGGGGATGCTGGAGGTGAGGGG + Intergenic
1122293155 14:100690284-100690306 CAGGAGGTGCTGCAGGTGGGAGG + Intergenic
1122509598 14:102255652-102255674 CTGGAGAAGCTTATGGAGAGTGG - Intronic
1122695940 14:103552170-103552192 CTGGAGCCTCTGAAGATGAGGGG - Intergenic
1123189721 14:106557314-106557336 CTAGAGATACTGAGTGTGAGGGG - Intergenic
1123215221 14:106803070-106803092 CTAGAGATACTGAGTGTGAGTGG - Intergenic
1125953948 15:43776683-43776705 CTGGAGAAGGTGCAGGGGAGAGG - Intronic
1126594575 15:50372745-50372767 CTGGAGATGCAGAAAGCTAGAGG - Intergenic
1127047262 15:55039975-55039997 CTGCAGACCCTGAATGTGAGGGG + Intergenic
1127844137 15:62854833-62854855 ATGCAGATGCTGAAGCTCAGAGG + Intergenic
1128145859 15:65332188-65332210 CTGGAGATACACAGGGTGAGAGG + Intronic
1128383102 15:67127641-67127663 CTGGAGTTCCTGAAGATGAAGGG + Intronic
1129755164 15:78093733-78093755 CTGGAGATGTTGAGGTTTAGTGG - Intronic
1129973437 15:79800905-79800927 CTATAGCTCCTGAAGGTGAGAGG + Intergenic
1130361063 15:83186717-83186739 CTGGAGATTCAGAAGGGAAGAGG + Intronic
1131117284 15:89803175-89803197 CTTGAGATGCTGAAGGTACCTGG - Intronic
1132956295 16:2595836-2595858 GTGGATAAGCGGAAGGTGAGTGG + Exonic
1134172300 16:11977660-11977682 ATGGGGATGCTGGAAGTGAGAGG + Intronic
1134311457 16:13078845-13078867 GTGGAGATGCTGCAGGGCAGTGG + Intronic
1135398169 16:22146982-22147004 CTGGAGATGCAGATGGTAAGGGG + Intronic
1136024750 16:27462286-27462308 CTGGAGTTGCTCCAGGTGTGGGG - Exonic
1136025864 16:27468823-27468845 CAGGAGATCATGAATGTGAGCGG + Intronic
1137565866 16:49532224-49532246 CTGGAGACTCTGACGGTGGGTGG + Intronic
1137669732 16:50272118-50272140 CAGGACATGCTGGAGGTGACAGG + Intronic
1137812260 16:51364127-51364149 CTGGAGATGCCGAGGAAGAGAGG + Intergenic
1137846606 16:51695962-51695984 CTGGAGAGGCTGAAGTGGAAGGG + Intergenic
1138604956 16:58082661-58082683 CTGTAATTGCTGAAGATGAGGGG - Intergenic
1139532147 16:67547641-67547663 CTGGAAGTGCTGAGGGAGAGGGG - Intergenic
1141041324 16:80675231-80675253 CTGGGGATGCTGAAGCTGTTGGG - Intronic
1141243593 16:82285852-82285874 CTGGTGATGCTCAAGGTAACTGG - Intergenic
1141850301 16:86640531-86640553 CTGGACATGCTGGAGCTCAGAGG + Intergenic
1142218971 16:88843668-88843690 CTGGAGAGCCTGAGGGGGAGGGG + Intronic
1142669378 17:1480698-1480720 CTGTACCTGGTGAAGGTGAGTGG - Exonic
1143483140 17:7238558-7238580 TGGGAGTTGCTGAGGGTGAGGGG - Intronic
1143747293 17:9003646-9003668 CTGGAGATGGGGAAAGCGAGGGG - Intergenic
1145788225 17:27607996-27608018 CAGGAGATCATCAAGGTGAGGGG + Exonic
1146085227 17:29822162-29822184 CTGGAGATGCTGAAGGGGATGGG - Intronic
1147202203 17:38810268-38810290 TTGGAGATGCTAAATGTGAGTGG - Intronic
1147364337 17:39950651-39950673 ATGGAGATGCTGAAGAAGGGGGG + Intergenic
1147556952 17:41485726-41485748 CTGGGGATGGTTAAGGAGAGGGG - Intergenic
1147664567 17:42138409-42138431 CTGGACCTCCTGAAGGTGGGAGG - Intronic
1147722650 17:42548359-42548381 GAGGAGGTGGTGAAGGTGAGCGG + Intergenic
1147921442 17:43919536-43919558 CTAGAGATGGTGAAGGTTGGGGG - Intergenic
1148546430 17:48522566-48522588 CTGGAGAGGATGAAGGAAAGGGG + Intergenic
1148716508 17:49719752-49719774 GAGGAGCTGCTGAGGGTGAGTGG - Exonic
1148860530 17:50602163-50602185 CTGGAGATGGAGAAGCTGAGTGG - Intronic
1149751988 17:59154895-59154917 CGGGAGATGCTGAGGGTGCGGGG - Intronic
1151160781 17:72163702-72163724 CAGGATAAGCTGAAGGTGGGTGG - Intergenic
1151226217 17:72650212-72650234 CTGCAGAGGCAGGAGGTGAGAGG - Intronic
1151872903 17:76848698-76848720 CTGGAGATGCTGCAGGCCTGAGG - Intergenic
1152461689 17:80445231-80445253 CTGGGGATGCTGGTGGGGAGGGG + Intergenic
1153025331 18:667259-667281 ATGGAGATGGTGATGGTGATGGG + Intronic
1153528209 18:6017156-6017178 CTGGAGATGCTGAATGCTTGTGG - Intronic
1153676001 18:7456117-7456139 CTGGTGATGCAGATGGTGACGGG - Intergenic
1154383583 18:13873390-13873412 CTGGAGATGAGCAAGGGGAGAGG + Intergenic
1155222728 18:23699848-23699870 CTGGAGATGCTTACAGTTAGGGG + Intronic
1155229296 18:23757423-23757445 CTGGAGAGGAGGAAGGGGAGGGG - Intronic
1156395240 18:36693350-36693372 CTTGAGAGTCTGAAGATGAGGGG - Exonic
1156489131 18:37485973-37485995 CTAGAGGTGCTGGGGGTGAGGGG - Intronic
1157898087 18:51487337-51487359 CTGGAGAAGCTGAGGCTGAGTGG - Intergenic
1158440091 18:57467834-57467856 CTGGAGATGCTGGAGGGTGGGGG - Intronic
1158727139 18:59983838-59983860 CTTGGGAGGCTCAAGGTGAGAGG - Intergenic
1158958076 18:62561369-62561391 CAGGAGAAACTGGAGGTGAGTGG - Intronic
1159908236 18:74118103-74118125 CTTGAGAGGCTGAGGGTGGGAGG - Intronic
1159936416 18:74371657-74371679 CTGGAGATGCAGAAGGCTAGGGG + Intergenic
1160288813 18:77571726-77571748 CTTGAGATGGGGAAGGTGAGTGG + Intergenic
1160348444 18:78153565-78153587 GTGGAAATGCTTAAAGTGAGTGG + Intergenic
1160444826 18:78919122-78919144 GTGGAGATGATGAAGATGAGGGG - Intergenic
1160680460 19:409635-409657 CTGTAGATGAGGAAGGTGGGGGG + Intergenic
1161102353 19:2427406-2427428 CAGGAGCTGCTGCAGGTGCGGGG - Exonic
1161124085 19:2546299-2546321 CTGGAGAGGCTGCAGGTGCAGGG - Intronic
1161284894 19:3463905-3463927 GTGGAGAGGCTGGAGGGGAGGGG - Intronic
1161491098 19:4562111-4562133 CTGGAGATGGTGGTGGTGATGGG - Intergenic
1161491340 19:4563585-4563607 CTGGAGATGGTGGTGGTGATGGG - Intergenic
1161500885 19:4614902-4614924 CTGGAGAGGCTCAAGGTAAGGGG + Intergenic
1161991629 19:7687475-7687497 CTGGACAGGCTGATGGGGAGTGG - Exonic
1162563358 19:11430891-11430913 CTGGACCTGCTCAAGGTAAGGGG - Exonic
1162749693 19:12821307-12821329 CTTGGGAGGCTGAAGGTGGGAGG - Intronic
1162824190 19:13241531-13241553 ATGCAGATGTTGAAGATGAGGGG + Intronic
1162925175 19:13927251-13927273 CGGGAGATCCTTGAGGTGAGAGG + Exonic
1163226015 19:15961931-15961953 TTGGGGATGCTGAAGCTGGGTGG - Intergenic
1163270026 19:16247576-16247598 CTGGAGTGGCTGGAGGGGAGGGG - Intergenic
1163368511 19:16889284-16889306 CCGGAGGTGGTGATGGTGAGTGG + Exonic
1163528289 19:17834713-17834735 TTGGAGTTTCTGAGGGTGAGAGG + Exonic
1164612072 19:29639314-29639336 CTGGAGATCCCACAGGTGAGGGG + Intergenic
1164863827 19:31587248-31587270 CTGGAGTTGCTGAATGCGTGAGG + Intergenic
1165097563 19:33417903-33417925 CTGGAGATGCTGGGAGTGTGTGG - Intronic
1165504212 19:36214614-36214636 CAGGGGAGGCAGAAGGTGAGGGG - Exonic
1166357024 19:42233278-42233300 GTGGAGATCATCAAGGTGAGGGG - Exonic
1166734421 19:45075912-45075934 CTGAGGGTGCTGAAGGAGAGGGG + Intronic
1166855190 19:45779797-45779819 TTCGAGATTCTGAAGGTGATCGG - Exonic
1167724273 19:51200134-51200156 CTGGATGGGCTGAAAGTGAGGGG - Intergenic
1168316194 19:55485766-55485788 CTGGAGATGCTGAAGGTGAGAGG + Exonic
1168519195 19:57035196-57035218 CTGCAGAGCCTGAGGGTGAGGGG - Intergenic
925913183 2:8586652-8586674 CTGGACATCCTGAAGGGGAATGG - Intergenic
926150383 2:10422667-10422689 CTGGGAATGCTGAGGGAGAGTGG - Intronic
927279925 2:21295864-21295886 CTGGAGATGCTGAACATGTTGGG - Intergenic
927887779 2:26729035-26729057 CTGGGGATGAGGAAGGGGAGTGG - Exonic
927889756 2:26740962-26740984 CTGGAGCTGCTCAAGGAGACAGG + Intergenic
927919912 2:26964264-26964286 ATGGAGATGCAGAAGCTGGGAGG + Intergenic
928600133 2:32896442-32896464 CTGGAGCTGCTGAAGTGGAAGGG + Intergenic
929521473 2:42655946-42655968 CTGGAGTAGCTGTATGTGAGAGG - Intronic
929529759 2:42741593-42741615 ATAGAGATGCTCAAGGAGAGGGG + Intronic
929622350 2:43368374-43368396 GTGGAGATGATGAAGATAAGGGG - Intronic
929689802 2:44064731-44064753 CTAGAGAGGCTGAGGGGGAGAGG + Intergenic
929762515 2:44817777-44817799 CAGGAGATGGTGGGGGTGAGGGG - Intergenic
930584202 2:53250394-53250416 GTGGAGATGGTGTAGGGGAGTGG + Intergenic
932033792 2:68219438-68219460 CTTAAGAAGCTGAACGTGAGGGG - Intronic
932103155 2:68919302-68919324 CAGGAGGTGAAGAAGGTGAGAGG + Intergenic
932722528 2:74148128-74148150 CTGGGGAGACTGAAGGAGAGCGG - Intergenic
933811282 2:86034281-86034303 CTGGAGATGCTGCAGGTTGTGGG - Intronic
934296777 2:91748892-91748914 CTGGAGATGGTGGAGCGGAGGGG - Intergenic
934687695 2:96333794-96333816 CTGGAGAGGCTGCAGGGGTGGGG + Intergenic
935022290 2:99243322-99243344 TGGGAGATGCTGAACTTGAGGGG + Intronic
935371759 2:102355587-102355609 CGGGGGATGCCGAAGGTGAGAGG - Intronic
936156027 2:110048010-110048032 CAGGAACTGCTGATGGTGAGTGG + Intergenic
936188661 2:110323418-110323440 CAGGAACTGCTGATGGTGAGTGG - Intergenic
937107426 2:119330663-119330685 TTGGAGATAGTGAAGGAGAGAGG - Intronic
937449779 2:121992610-121992632 CTGGAGGTGCTGGAGGAGGGAGG + Intergenic
937918329 2:127111766-127111788 CTGGGGATGTTGATAGTGAGGGG - Intergenic
938041788 2:128082244-128082266 CTGGAGAGGCTGAAGTGCAGTGG + Intergenic
940031485 2:149267286-149267308 CTCGAGATGTTGGGGGTGAGAGG - Intergenic
940848723 2:158668138-158668160 CTGGAGAGGCAGAAGGCCAGTGG - Intronic
941223358 2:162813145-162813167 TTGGAAATGTTGAAGGTGAGAGG + Intronic
944206834 2:197165295-197165317 CTGGAGATGCTCAGGATCAGAGG + Intronic
946027596 2:216681229-216681251 GTGGTGATGCTGAGGTTGAGTGG - Intronic
946448836 2:219762704-219762726 CTAGAGATGCTCAAGGTATGGGG + Intergenic
946587031 2:221201229-221201251 TTGAGAATGCTGAAGGTGAGTGG + Intergenic
946919691 2:224566065-224566087 CTGTAGATGGGGAAGGTGGGGGG - Intronic
948229064 2:236336517-236336539 CTGGAGATGATGATGGTCAGTGG - Intronic
948664497 2:239526655-239526677 CTGGAGGGGCTGAGGGTGAATGG - Intergenic
948765689 2:240217589-240217611 GTGGAGCTGGTGAAGGTGGGTGG - Intergenic
948765700 2:240217626-240217648 GTGGAGTTGGTGGAGGTGAGTGG - Intergenic
948935056 2:241158535-241158557 CTGAAGAAAGTGAAGGTGAGAGG + Exonic
1168967145 20:1905579-1905601 CTGGAGAGGCTGAGGTTGGGAGG - Intronic
1169424563 20:5485853-5485875 CTGGCGGGGCTGAAGGTCAGTGG - Intergenic
1170723670 20:18906164-18906186 CTGTGGATGCAGAGGGTGAGAGG + Intergenic
1170994045 20:21334834-21334856 TTGGAGATGTTTAATGTGAGGGG + Intronic
1171092015 20:22294237-22294259 CTTCAGATGCAAAAGGTGAGAGG - Intergenic
1172012102 20:31851519-31851541 CTGAAGATGGTGGAGGTGAAGGG + Intronic
1173434237 20:43017884-43017906 CTGGAGGTGCTGCAGTTGGGAGG + Intronic
1174167103 20:48592789-48592811 CAGGACAGGCTGCAGGTGAGAGG + Intergenic
1174414858 20:50359950-50359972 GTGTAGATGTGGAAGGTGAGAGG + Intergenic
1175135587 20:56821230-56821252 CTGGAGCACCCGAAGGTGAGAGG + Intergenic
1175686073 20:61029749-61029771 AAGGAGATTATGAAGGTGAGAGG - Intergenic
1175893657 20:62326669-62326691 CTGCAGCTGGTGGAGGTGAGGGG - Exonic
1175998363 20:62821320-62821342 CCGGAGAGGCTGCAGATGAGAGG - Intronic
1177198106 21:17924075-17924097 CTGAGGAAGCTAAAGGTGAGAGG + Intronic
1177869795 21:26557698-26557720 CTGGAGATGCTGGGGTTGAAAGG - Intronic
1178167060 21:29991283-29991305 TGGGAGATGCTGTAGGGGAGGGG + Intergenic
1179247072 21:39643187-39643209 GTGGAGATGCTGACGGAGATGGG + Intronic
1179658751 21:42861520-42861542 CGAGAGATGGTGAAGGGGAGGGG + Intronic
1180061013 21:45385110-45385132 CTGGAGCTGCTGGAGCTGGGTGG - Intergenic
1180138475 21:45876430-45876452 CTGGAGCAGGGGAAGGTGAGCGG + Intronic
1181161755 22:20963941-20963963 GAGGAGATTCTGAAGGTGGGTGG + Intergenic
1181364310 22:22363370-22363392 CTTTTGATGCTGAAGGTGCGTGG + Intergenic
1181373753 22:22439973-22439995 CTTTTGATGCTGAAGGTGGGTGG + Intergenic
1181919017 22:26305441-26305463 CTGGAGATGGTAAGGGTGATGGG - Intronic
1181932742 22:26415763-26415785 CTAGAAATGCAGAAGGTGGGTGG - Intergenic
1182306383 22:29371907-29371929 CTGTAAATGCTGAAATTGAGGGG - Intronic
1182443276 22:30376363-30376385 CTGGAGGTGGGGCAGGTGAGTGG + Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1183083760 22:35474112-35474134 CTGGACAGGCTGGTGGTGAGAGG + Intergenic
1183413828 22:37671515-37671537 CTGGCGGTGCTGAAGGAGGGCGG - Intergenic
1184023470 22:41836482-41836504 TTGGGCATGCTGAAGGTCAGTGG + Intronic
1184259966 22:43309120-43309142 CTGGAGCTGGTGAAGGTGCAGGG - Intronic
1184608487 22:45587697-45587719 CTGGAGTGGCTGAAGCAGAGCGG - Intronic
1184800115 22:46753924-46753946 ATGGACATCCTGAGGGTGAGGGG - Intergenic
949481302 3:4495837-4495859 TTGGGGATGCTGGTGGTGAGAGG + Intronic
950109823 3:10411910-10411932 CTGGAAATGCAGATGGTGGGTGG - Intronic
950199724 3:11034508-11034530 CTGGAGAGGGTGGAGGGGAGGGG - Intronic
950275712 3:11658950-11658972 CTGGAGGTGCTGTATGTGTGTGG - Intronic
950418847 3:12884851-12884873 CTGGAGAACTTGGAGGTGAGTGG - Intergenic
950493749 3:13321577-13321599 CTGGAGAACTTGGAGGTGAGTGG - Exonic
950887449 3:16374112-16374134 CATGAGATGGTGAAGGTGAAAGG - Intronic
950890285 3:16398631-16398653 TGGGAGCTCCTGAAGGTGAGGGG - Intronic
951565866 3:24012070-24012092 CTGGAGAGGCTGAAGGCGGGAGG - Intergenic
951595549 3:24314733-24314755 CTGTAGAGGCTGAAGGTTTGGGG - Intronic
953370475 3:42383399-42383421 CTGGAGATACTGGAGATGATGGG - Intergenic
953441861 3:42925128-42925150 CTGGAGCTGCAGAAGTGGAGAGG + Intronic
953616188 3:44492829-44492851 CTGGACATGTTGCAGGTCAGGGG + Intergenic
953831090 3:46298073-46298095 CTGGAGATGCTGCACATGGGAGG + Intergenic
953843962 3:46412251-46412273 CTGGAGATGTTGGAGGGGAGAGG + Intronic
954199443 3:49015421-49015443 GTGCAGGAGCTGAAGGTGAGTGG + Exonic
956176499 3:66478099-66478121 GTGGAGATGGTGGAGGTGATAGG - Intronic
956980801 3:74634976-74634998 CTGGAGAGGCTGAAACTGGGAGG - Intergenic
958907926 3:99962144-99962166 CTGGAAAGGCTGAAGGTGAGGGG + Intronic
959214745 3:103437347-103437369 GTGGAGCTGCTGAAGGTGGTGGG - Intergenic
959647505 3:108720494-108720516 CTGTAGATGCTGAGTGTGTGTGG + Intergenic
960944525 3:122957031-122957053 CTGGAGAAGCTGGTGGAGAGAGG + Intronic
961265741 3:125640941-125640963 CTGGAGATTCCAAAGGTGTGGGG + Intergenic
961500364 3:127328266-127328288 CTGGACATGCTGTAGGTGCTTGG - Intergenic
961622266 3:128233658-128233680 AAGGAGATGCTCAAGGTCAGAGG - Intronic
962035608 3:131648262-131648284 CTTGGGAGGCTGAAGGTGGGAGG + Intronic
962975362 3:140441610-140441632 GTGCAGAGGCTGAAAGTGAGGGG - Intronic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
964917595 3:161855082-161855104 CTGGAGAAGTTGAAGGTCTGTGG - Intergenic
966750610 3:183318060-183318082 CGGGACAAGCTGCAGGTGAGCGG - Exonic
968662762 4:1805600-1805622 ATGGAGATGATGAAGATGATCGG + Exonic
968936532 4:3614039-3614061 CTGGAGAAGCTGAGGATGGGAGG - Intergenic
969456142 4:7300758-7300780 CTGGAGATGAGGAAGGCCAGCGG - Intronic
969863759 4:10058502-10058524 CGGGGGATGGTAAAGGTGAGGGG + Intergenic
971767438 4:30851111-30851133 CTGTAGACCCTGAAGCTGAGAGG + Intronic
971802807 4:31314794-31314816 CTGAACATGCTGATAGTGAGTGG + Intergenic
972757535 4:42063835-42063857 CATGAGATGCAGAAGCTGAGAGG - Intronic
972889456 4:43538363-43538385 CTGGAGATTCAGAAAGGGAGAGG + Intergenic
974532175 4:63123149-63123171 CTGGAGATTTTGAAGATCAGTGG + Intergenic
975353588 4:73373097-73373119 CTGGAAAGGGTGAGGGTGAGAGG + Intergenic
975468819 4:74740486-74740508 ATGGAGATGCCAAAGTTGAGAGG + Intergenic
975869899 4:78768493-78768515 CTTGAGATGCAGAAGGACAGCGG + Intergenic
975905354 4:79204716-79204738 CTGGAGACTCAGAAGGGGAGTGG - Intergenic
976077921 4:81320512-81320534 GTGGTGAAGCTGAAGGTCAGTGG - Intergenic
977064847 4:92302552-92302574 CTTGAGATGGTGAAGGAGAGTGG + Intronic
977324030 4:95552382-95552404 CTTGAGAGGCTGAAGAGGAGAGG - Intergenic
977632069 4:99254049-99254071 CTTGAGCAGCTGAAGGTGGGTGG + Intergenic
978043627 4:104099708-104099730 CTGGAGATGCCCAAGATGATGGG + Intergenic
979656362 4:123198990-123199012 CTGGTGATGCTGTGAGTGAGTGG + Intronic
980511215 4:133790136-133790158 ATGAAGATGGTGAAGGTGGGTGG + Intergenic
981576853 4:146214543-146214565 CTGGAGATGCTGAGGATTAGTGG + Intergenic
982946098 4:161625678-161625700 CTAGAAATGATGAAGGTAAGTGG + Intronic
983654802 4:170071907-170071929 ATGGAGATGGAGAATGTGAGAGG + Intronic
985017410 4:185651014-185651036 TTGCAGCTGCTGAAGGGGAGGGG + Intronic
985068742 4:186147273-186147295 CTAGAGAGGCTGAAGGTGGGAGG + Intronic
985302104 4:188500998-188501020 CTGGACTTGCTCAAGGTGACTGG + Intergenic
985643501 5:1074453-1074475 CCTGAGCGGCTGAAGGTGAGAGG + Intronic
985675589 5:1229854-1229876 CTGGAGATGGGGGAGGGGAGAGG + Intronic
985762333 5:1756047-1756069 CTGGAGCTGCTGAGGGTGCGGGG - Intergenic
985913510 5:2900766-2900788 CTGGAGAGGATGAAGGTGGAGGG - Intergenic
986056005 5:4137290-4137312 TGGAAGATGCTGAAGGTGTGAGG + Intergenic
986329212 5:6705100-6705122 CAGGAGATTCTGGAGGTAAGGGG - Intergenic
987062812 5:14258660-14258682 CTGGGGAGGTAGAAGGTGAGAGG - Intronic
987464065 5:18251627-18251649 CTGGAGATGATAAAGCTTAGAGG + Intergenic
987528439 5:19082616-19082638 ATGTGGATGCTGAAGTTGAGAGG - Intergenic
988599863 5:32630131-32630153 CTGGAGAAGCATAAGGTCAGTGG - Intergenic
990006032 5:50945366-50945388 CTAGAGCTGCTGAAGCTGACAGG - Intergenic
991960248 5:72037085-72037107 CTGGAGCTGCTGAGGGTGCAGGG - Intergenic
992317613 5:75573912-75573934 CTTGAGATTCTGTAGGTGACAGG - Intronic
993027163 5:82660478-82660500 CTGGAGATGATGGATGGGAGAGG + Intergenic
993856184 5:93078637-93078659 CTGGTGCTGCTGAAGGACAGAGG - Intergenic
993977478 5:94499912-94499934 ATGGAGATGCTGTAGGAGCGTGG + Intronic
994135321 5:96279907-96279929 TTGGAGATTCTGAATGTTAGTGG - Intergenic
994165218 5:96601097-96601119 AAGGAGATGTTGAAGGAGAGAGG - Intronic
995403079 5:111763255-111763277 CTGGGGATGCTGACAATGAGAGG + Intronic
996303902 5:122023932-122023954 CAGTAGATGCTGAATGAGAGCGG - Intronic
997452252 5:133993253-133993275 CTGGGGATGCTGAGGAGGAGAGG - Intronic
997709306 5:135990540-135990562 CTGGAGGTGCTGGAGGTGCTGGG + Intergenic
997926049 5:138032487-138032509 CTGGAGGGGCTGGAGGTGAGGGG + Intronic
999019289 5:148145523-148145545 ATGGAGATCCTGAAGCTGAGAGG + Intergenic
999068544 5:148717497-148717519 CAGGAGAGGCAGAAGGTGAAGGG - Intergenic
999392336 5:151202655-151202677 GAGGAGACGCTAAAGGTGAGGGG - Intronic
999623172 5:153492212-153492234 CTGGAGAGGCTGAAAGAGATGGG - Exonic
1002132706 5:177091293-177091315 ATGGAGTTGCTGAGGCTGAGAGG - Intronic
1002642533 5:180637020-180637042 CTGTCGATGCTGAGAGTGAGAGG - Intronic
1004603907 6:17176181-17176203 CTGAAGATGGTCAAGGAGAGGGG + Intergenic
1006058628 6:31403688-31403710 CGGGAGCTGCTGCTGGTGAGTGG + Exonic
1006154709 6:32007919-32007941 CCGGAGATGCTGAAGGGGGCTGG - Intergenic
1006161021 6:32040654-32040676 CCGGAGATGCTGAAGGGGGCTGG - Exonic
1006460598 6:34155391-34155413 CAGGAGATGCTGAGAGTGGGAGG - Intronic
1006912443 6:37572142-37572164 CTGGAGACGCTGAAGCTTTGGGG + Intergenic
1006914462 6:37585459-37585481 CTGGGGAGGCTGAAGGCAAGGGG - Intergenic
1007252866 6:40508243-40508265 CAGGACATGCTGCAGGTAAGGGG + Intronic
1007671688 6:43559922-43559944 CTGGGGAGGCTTAAGGTGGGAGG - Intronic
1008923081 6:56863080-56863102 CTGGAGCTGCTGCGAGTGAGTGG + Intronic
1009764291 6:68049195-68049217 TTCGAGAGGCTGAAGGTTAGAGG + Intergenic
1010112636 6:72258201-72258223 GAGGAGATACTGAACGTGAGCGG - Exonic
1010185379 6:73138014-73138036 CTTGAGATGATGTAGTTGAGAGG - Intronic
1010524491 6:76884104-76884126 CTGGAATTAATGAAGGTGAGAGG + Intergenic
1010676731 6:78754086-78754108 CTGGAACTGCTTAAGGTGTGGGG + Intergenic
1012157225 6:95834594-95834616 CCTGAGAAGCTGAAGTTGAGAGG + Intergenic
1012645935 6:101681331-101681353 CTCGAGAAGCTGAGGTTGAGAGG - Intronic
1012966202 6:105676191-105676213 CAGGAGATGCTGAAGGAGACAGG + Intergenic
1012988260 6:105898057-105898079 CTGGAGATGCTGCAGCTGCCAGG - Intergenic
1015359825 6:132327090-132327112 CTGGAGATGCTGAAGGGTTAGGG - Intronic
1015579042 6:134703510-134703532 CCAGAGATGGTTAAGGTGAGTGG + Intergenic
1017441697 6:154470307-154470329 CTTGGGAGGCTGAAGGTGGGAGG - Intronic
1017702676 6:157090872-157090894 CTGGAGAGGGAGAAGGGGAGGGG - Intronic
1018393778 6:163361349-163361371 TTGCAGATGCAGAAGGGGAGAGG - Intergenic
1018572051 6:165222178-165222200 CTCAAGATGCAGACGGTGAGAGG + Intergenic
1019495430 7:1337301-1337323 TTGGAGTTCCTGAAGGAGAGGGG - Intergenic
1019723556 7:2587863-2587885 GTGGAGCTGGAGAAGGTGAGCGG + Exonic
1021285291 7:18773503-18773525 CTGCAGTTGCTGAAGGTAAATGG + Intronic
1021512726 7:21451740-21451762 CTGGATGGCCTGAAGGTGAGAGG + Intronic
1022545123 7:31180066-31180088 CTGGAAATGCTGGTGGGGAGAGG + Intergenic
1023394916 7:39743756-39743778 CTGGACATGCTGGAGGTAGGGGG + Intergenic
1024141094 7:46464095-46464117 CTAGAGATGGAGAAAGTGAGGGG + Intergenic
1024983918 7:55179862-55179884 CAGGAGATGCTGTAGATGGGAGG + Intronic
1025199856 7:56955474-56955496 CTGGGGAGGCAGAAGGAGAGGGG + Intergenic
1025672090 7:63621458-63621480 CTGGGGAGGCAGAAGGAGAGGGG - Intergenic
1027765688 7:82338697-82338719 CTAGAGCAGCCGAAGGTGAGTGG + Intronic
1028107850 7:86901812-86901834 CCTGAGATGCCAAAGGTGAGAGG - Intronic
1028616063 7:92768142-92768164 CAAGGGATGCTGAAGGTGGGAGG + Intronic
1029805036 7:102987139-102987161 CTGGAGACTCTGAAAGGGAGAGG + Intronic
1030120476 7:106105756-106105778 CTGGGTATCCTGAAGGTAAGGGG + Intronic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1030597415 7:111556652-111556674 GTAAAGATGCTGAAGGAGAGTGG - Intronic
1030916760 7:115324409-115324431 CTGGATATGCTAGAAGTGAGAGG + Intergenic
1031570503 7:123353412-123353434 TTGGAGATGCAGAAGATTAGAGG + Intergenic
1031793001 7:126134086-126134108 CTGGAGGTGCTGAATGAGATAGG + Intergenic
1032013958 7:128364413-128364435 CTGAAAATGCTGAAAATGAGGGG + Intergenic
1032310901 7:130786470-130786492 CTGGAGATGTTGGTGCTGAGGGG + Intergenic
1032360398 7:131249819-131249841 CAGGAGATGCTGCTGGAGAGGGG + Intronic
1032710074 7:134453408-134453430 CTGGAGCTGCTGCAGGAAAGTGG + Intronic
1032844673 7:135742210-135742232 CTGGAGAGGCTGGAGGTGGTGGG + Intronic
1034393636 7:150803818-150803840 ATGGACATGCTGAAGGTAGGTGG + Exonic
1034977119 7:155455219-155455241 CTGGAAAGGAGGAAGGTGAGAGG - Intergenic
1035470865 7:159107742-159107764 CTGGAGCTGCTGCAGGGCAGGGG + Intronic
1036009140 8:4701432-4701454 CTGGAGAGTCTGATGGGGAGGGG + Intronic
1036474968 8:9084832-9084854 CTGAAGAAGCTGAAGTGGAGAGG + Intronic
1036987547 8:13553593-13553615 TTTGGGAGGCTGAAGGTGAGAGG - Intergenic
1037124093 8:15324037-15324059 GTGGAGATGTTAAAGTTGAGTGG + Intergenic
1037190556 8:16119467-16119489 TTTGGGATGCTGAAGGTGGGTGG - Intronic
1037433547 8:18839676-18839698 GTGGTGATGCTGGTGGTGAGTGG - Intronic
1037519063 8:19662086-19662108 CTGAAGCTGCTGAAGATGCGGGG - Intronic
1037685145 8:21132126-21132148 TTGGAGATGCTGAGAGTGAGAGG - Intergenic
1038537665 8:28365390-28365412 GTGGAGATTCTGGAGGAGAGAGG - Intronic
1039506349 8:38055162-38055184 CGTGAGATGCTGAAGGGCAGAGG - Intronic
1039546965 8:38417353-38417375 ATGGAGATGATGAAGATGATCGG - Exonic
1040510272 8:48087217-48087239 CTGGAGCTGCTGCAGGAGAGGGG + Intergenic
1040876435 8:52157260-52157282 ATGGAGAATCTGAAGGTGAGAGG + Intronic
1044216345 8:89615585-89615607 CTGTACATGCTGAAGATCAGAGG + Intergenic
1044850645 8:96424197-96424219 CTGGAGAAGAAGAGGGTGAGGGG + Intergenic
1045270781 8:100659303-100659325 CTGGAGAGGCTGGAGGGCAGTGG - Intronic
1045880137 8:107028970-107028992 ATGGAGTTGCTGAAGCTTAGGGG - Intergenic
1046555673 8:115769391-115769413 CTGTAAATGCGGAAGGTGTGAGG + Intronic
1047605931 8:126474317-126474339 CTGCAGATGATGAAGCTGAGTGG + Intergenic
1047715794 8:127594017-127594039 CTGTAAATGTTGAAGCTGAGAGG - Intergenic
1047812419 8:128425055-128425077 CTGGGGATGCTAAGGATGAGGGG + Intergenic
1048370403 8:133771809-133771831 CTGGACATGTTGAGGGTGGGAGG + Intergenic
1048608005 8:135990202-135990224 CAGGAGATGGTAAGGGTGAGGGG + Intergenic
1048828320 8:138451507-138451529 CTGGAGATGTTTAAAGTAAGGGG + Intronic
1048898788 8:139018367-139018389 ATGGCGATGATGAAGGTGATGGG + Intergenic
1049473807 8:142787788-142787810 CTGGCTAGGCTGAAGGTGAGTGG + Intergenic
1049483898 8:142841451-142841473 CTGGAGACGCTGCAGATGTGTGG - Intronic
1052404582 9:28043445-28043467 CTGCAGTGGTTGAAGGTGAGGGG + Intronic
1052755491 9:32536821-32536843 CAGGTGAAGCTGAAGGTGACTGG - Intergenic
1053287522 9:36859500-36859522 GTGCAGACGCTGAAGGAGAGGGG - Intronic
1055241103 9:74187622-74187644 CTGGGGCTGCTGTAGGGGAGGGG - Intergenic
1055552809 9:77446640-77446662 GGGGAGATGCTCAAGGTGATGGG + Intronic
1056164934 9:83931758-83931780 CTTGGGAGGCTGAGGGTGAGAGG + Intergenic
1056447313 9:86678399-86678421 CTGTAAATGTTGAAGGTTAGGGG + Intergenic
1057034480 9:91801819-91801841 CTGGATATGCTGAACATGAACGG + Intronic
1058198232 9:102006085-102006107 CTGGAGATGGAGGAGGTTAGAGG - Intergenic
1059008800 9:110433922-110433944 CTGGAGATGCAGCAGTTCAGGGG - Intronic
1059309254 9:113377081-113377103 CGGGAGAGGGCGAAGGTGAGGGG - Intergenic
1059806249 9:117803731-117803753 TAGGTGATGCAGAAGGTGAGTGG + Intergenic
1060016078 9:120087629-120087651 GTGGAGATTCTGGAGATGAGGGG - Intergenic
1060102329 9:120851489-120851511 CTGTAGAGGCTGAAGGTCTGAGG + Intergenic
1060301250 9:122375769-122375791 ATGGAGATGCTGAGGGTTTGGGG + Intronic
1060934393 9:127506980-127507002 CAGGAGATGCTGGAGGGGTGAGG + Exonic
1060984165 9:127810092-127810114 CTGAAGCTGCTGCAGGTGAGGGG + Exonic
1062722654 9:138052487-138052509 AGGGAGATGCTGGAGGTGAGGGG + Intronic
1186137980 X:6539702-6539724 CTGGACTTGCTGAGGGTGTGTGG - Intergenic
1186360113 X:8832103-8832125 CAGGAGAAGCTGAAGGTAACAGG + Intergenic
1187485757 X:19701576-19701598 CTGAAGATGCAGATGGTGAGTGG - Intronic
1190398656 X:50010029-50010051 CTGCATATACTGAGGGTGAGTGG + Intronic
1190713138 X:53083493-53083515 CTGGAGATGATGAAGGGTGGTGG + Intronic
1191842398 X:65522578-65522600 CTGAAGGTGCTGATGATGAGTGG + Intronic
1193120254 X:77815910-77815932 CTTGAGAGTCTGAAGGTGGGAGG - Intergenic
1195622189 X:106967841-106967863 CTGGTGATCCTGAAAGTGACAGG + Intronic
1196141281 X:112265930-112265952 CTGGAGAGGGTGACTGTGAGGGG - Intergenic
1198421309 X:136472771-136472793 CCAGACATCCTGAAGGTGAGTGG - Intergenic
1200039600 X:153355710-153355732 CTGGGGGTGCAGGAGGTGAGGGG - Intronic
1200353995 X:155528489-155528511 CTGGAGACTCAGAAGGGGAGAGG - Intronic