ID: 1168317155

View in Genome Browser
Species Human (GRCh38)
Location 19:55489353-55489375
Sequence GAGCGCCTGCGCCTGGCCGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1264
Summary {0: 1, 1: 1, 2: 8, 3: 196, 4: 1058}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168317149_1168317155 -5 Left 1168317149 19:55489335-55489357 CCATTCCTCCAACCCTCAGAGCG 0: 1
1: 0
2: 0
3: 14
4: 204
Right 1168317155 19:55489353-55489375 GAGCGCCTGCGCCTGGCCGATGG 0: 1
1: 1
2: 8
3: 196
4: 1058
1168317146_1168317155 7 Left 1168317146 19:55489323-55489345 CCCCAGTCACAGCCATTCCTCCA 0: 1
1: 0
2: 5
3: 33
4: 358
Right 1168317155 19:55489353-55489375 GAGCGCCTGCGCCTGGCCGATGG 0: 1
1: 1
2: 8
3: 196
4: 1058
1168317147_1168317155 6 Left 1168317147 19:55489324-55489346 CCCAGTCACAGCCATTCCTCCAA 0: 1
1: 0
2: 4
3: 29
4: 384
Right 1168317155 19:55489353-55489375 GAGCGCCTGCGCCTGGCCGATGG 0: 1
1: 1
2: 8
3: 196
4: 1058
1168317143_1168317155 12 Left 1168317143 19:55489318-55489340 CCCCTCCCCAGTCACAGCCATTC 0: 1
1: 0
2: 6
3: 42
4: 491
Right 1168317155 19:55489353-55489375 GAGCGCCTGCGCCTGGCCGATGG 0: 1
1: 1
2: 8
3: 196
4: 1058
1168317145_1168317155 10 Left 1168317145 19:55489320-55489342 CCTCCCCAGTCACAGCCATTCCT 0: 1
1: 0
2: 4
3: 45
4: 366
Right 1168317155 19:55489353-55489375 GAGCGCCTGCGCCTGGCCGATGG 0: 1
1: 1
2: 8
3: 196
4: 1058
1168317140_1168317155 22 Left 1168317140 19:55489308-55489330 CCCCAGGATGCCCCTCCCCAGTC 0: 1
1: 1
2: 1
3: 41
4: 657
Right 1168317155 19:55489353-55489375 GAGCGCCTGCGCCTGGCCGATGG 0: 1
1: 1
2: 8
3: 196
4: 1058
1168317144_1168317155 11 Left 1168317144 19:55489319-55489341 CCCTCCCCAGTCACAGCCATTCC 0: 1
1: 0
2: 3
3: 49
4: 470
Right 1168317155 19:55489353-55489375 GAGCGCCTGCGCCTGGCCGATGG 0: 1
1: 1
2: 8
3: 196
4: 1058
1168317148_1168317155 5 Left 1168317148 19:55489325-55489347 CCAGTCACAGCCATTCCTCCAAC 0: 1
1: 0
2: 1
3: 17
4: 218
Right 1168317155 19:55489353-55489375 GAGCGCCTGCGCCTGGCCGATGG 0: 1
1: 1
2: 8
3: 196
4: 1058
1168317139_1168317155 23 Left 1168317139 19:55489307-55489329 CCCCCAGGATGCCCCTCCCCAGT 0: 1
1: 0
2: 1
3: 43
4: 372
Right 1168317155 19:55489353-55489375 GAGCGCCTGCGCCTGGCCGATGG 0: 1
1: 1
2: 8
3: 196
4: 1058
1168317150_1168317155 -10 Left 1168317150 19:55489340-55489362 CCTCCAACCCTCAGAGCGCCTGC 0: 1
1: 0
2: 0
3: 19
4: 199
Right 1168317155 19:55489353-55489375 GAGCGCCTGCGCCTGGCCGATGG 0: 1
1: 1
2: 8
3: 196
4: 1058
1168317141_1168317155 21 Left 1168317141 19:55489309-55489331 CCCAGGATGCCCCTCCCCAGTCA 0: 1
1: 0
2: 1
3: 27
4: 316
Right 1168317155 19:55489353-55489375 GAGCGCCTGCGCCTGGCCGATGG 0: 1
1: 1
2: 8
3: 196
4: 1058
1168317142_1168317155 20 Left 1168317142 19:55489310-55489332 CCAGGATGCCCCTCCCCAGTCAC 0: 1
1: 0
2: 4
3: 37
4: 430
Right 1168317155 19:55489353-55489375 GAGCGCCTGCGCCTGGCCGATGG 0: 1
1: 1
2: 8
3: 196
4: 1058

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168317155 Original CRISPR GAGCGCCTGCGCCTGGCCGA TGG Exonic