ID: 1168317208

View in Genome Browser
Species Human (GRCh38)
Location 19:55489514-55489536
Sequence AGGCGCCTTCTTCGGGGAGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168317189_1168317208 20 Left 1168317189 19:55489471-55489493 CCTGCCGGCAGCTGGGCTGCGGA 0: 1
1: 0
2: 2
3: 22
4: 202
Right 1168317208 19:55489514-55489536 AGGCGCCTTCTTCGGGGAGGGGG 0: 1
1: 0
2: 2
3: 10
4: 123
1168317187_1168317208 26 Left 1168317187 19:55489465-55489487 CCGTGGCCTGCCGGCAGCTGGGC 0: 1
1: 0
2: 3
3: 40
4: 388
Right 1168317208 19:55489514-55489536 AGGCGCCTTCTTCGGGGAGGGGG 0: 1
1: 0
2: 2
3: 10
4: 123
1168317184_1168317208 29 Left 1168317184 19:55489462-55489484 CCGCCGTGGCCTGCCGGCAGCTG 0: 1
1: 0
2: 2
3: 33
4: 379
Right 1168317208 19:55489514-55489536 AGGCGCCTTCTTCGGGGAGGGGG 0: 1
1: 0
2: 2
3: 10
4: 123
1168317192_1168317208 16 Left 1168317192 19:55489475-55489497 CCGGCAGCTGGGCTGCGGAGGGG 0: 1
1: 0
2: 2
3: 46
4: 458
Right 1168317208 19:55489514-55489536 AGGCGCCTTCTTCGGGGAGGGGG 0: 1
1: 0
2: 2
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168317208 Original CRISPR AGGCGCCTTCTTCGGGGAGG GGG Exonic
900157286 1:1208345-1208367 AGGGGCCTTCTGCGGCGAGAGGG - Intergenic
900335482 1:2160949-2160971 AGGCGCCGCCGTCGGGGTGGAGG + Intronic
901161041 1:7177037-7177059 AGGGGCCTTGTGAGGGGAGGGGG - Intronic
907646727 1:56251876-56251898 AGGTGCCTTCTTCCGGGGTGTGG - Intergenic
910041974 1:82863482-82863504 TGGGGCCTTCTTCAGGGAGGAGG - Intergenic
913138522 1:115916476-115916498 AGGCGCCTCCTGCGATGAGGTGG - Intergenic
919939701 1:202277838-202277860 AGGAGGCTTCCTGGGGGAGGTGG + Intronic
1066254459 10:33664995-33665017 AGCTGCCTTTTTCGGGGTGGGGG - Intergenic
1067041268 10:42954440-42954462 AGGTGCCCTCTCCTGGGAGGTGG - Intergenic
1067066035 10:43104877-43104899 AGCCGCTTTCCTCGGGAAGGGGG - Intronic
1067077393 10:43196021-43196043 AGGGCCCTGCTTTGGGGAGGGGG - Exonic
1068873084 10:61966339-61966361 AGATGACTTCTTGGGGGAGGAGG - Intronic
1071598185 10:86942932-86942954 GGCCGCGCTCTTCGGGGAGGAGG - Exonic
1075678891 10:124318340-124318362 AGGTGCCTTCATGGGGCAGGAGG + Intergenic
1076311925 10:129514732-129514754 AGGCGCCATCTGCGAGGAAGTGG + Intronic
1077359103 11:2132824-2132846 AGTAGCCTGTTTCGGGGAGGCGG + Exonic
1078561592 11:12377652-12377674 AGGCGACTTCTGCGGGGAGGTGG - Exonic
1083852604 11:65376941-65376963 AGCCTCCATCTTCCGGGAGGAGG - Exonic
1084721154 11:70906487-70906509 AGGAGGCTTCGTCGGGGCGGTGG - Intronic
1084817543 11:71658106-71658128 AGGCCCCTCCTGTGGGGAGGAGG + Intergenic
1084953044 11:72677202-72677224 AGCCGCCTTCTTCGGCAAAGAGG - Intergenic
1085079722 11:73624280-73624302 AAGCTCATTCTTTGGGGAGGTGG - Intergenic
1085170654 11:74447126-74447148 AGACTCCTTCTTGGTGGAGGGGG - Intergenic
1087212821 11:95460810-95460832 TGGCCCCTTCCTCGGGGAGCAGG - Intergenic
1089353346 11:117833826-117833848 TGGCCCCTTCCTCTGGGAGGAGG - Intronic
1089420428 11:118329095-118329117 AGGGGCCTACTTCAGGGTGGAGG + Intergenic
1089496120 11:118909501-118909523 TGCCGGCTTCTCCGGGGAGGGGG + Intronic
1089586659 11:119513794-119513816 AGGGGCCCTCCTGGGGGAGGAGG + Intergenic
1092532005 12:9352633-9352655 GGAAGCCTTCTTGGGGGAGGGGG - Intergenic
1096981280 12:55729191-55729213 GGGCGCCTTCTTCCGGGTAGGGG - Intronic
1097034049 12:56110636-56110658 ACGTGCCTTCTTCAGTGAGGTGG + Exonic
1097454590 12:59781959-59781981 AGTGGCCTTCTCCAGGGAGGAGG + Exonic
1102158687 12:110751092-110751114 AGGAGCCTTCTTGGAGCAGGGGG + Intergenic
1103321896 12:120097010-120097032 AGGCGCCTTGGCCGGGGAGGAGG + Exonic
1103474713 12:121210057-121210079 CGGCGCCGTCATCGCGGAGGAGG - Exonic
1104763928 12:131314332-131314354 AGAAGCCTTCTTGGAGGAGGGGG - Intergenic
1109284925 13:60397755-60397777 GCGCGGCTTCTCCGGGGAGGGGG + Intronic
1114309750 14:21456077-21456099 AGGCGCCTTGTTCTCGGAGAGGG - Intronic
1119261527 14:73240791-73240813 AGGCCCCACCTTTGGGGAGGAGG + Intronic
1125541119 15:40470849-40470871 AGGCGCCCTCTTCCGGGTAGGGG + Intergenic
1125664274 15:41417521-41417543 TGGCGCCTTGGGCGGGGAGGCGG + Intronic
1128109362 15:65067175-65067197 AGCTCCCTTCTACGGGGAGGGGG + Intronic
1128867483 15:71125636-71125658 AGGCGCCTTCTTCGGACCTGGGG - Intronic
1130009691 15:80141278-80141300 AGGCTCCGTCTCGGGGGAGGGGG - Intergenic
1132458372 16:36752-36774 AGGAGCCTTCTTGGTGGACGTGG - Intergenic
1132507631 16:319640-319662 AGGTGCCTTCCTGGGGCAGGAGG - Intronic
1132808134 16:1785160-1785182 ACTCGCCTTCCTCGGGGAGATGG + Intronic
1132994125 16:2814146-2814168 AGGAGCCTCCTTCAGGGAGGTGG + Intergenic
1132996842 16:2827910-2827932 AGGAGCCTTCTTCAGGGAGGTGG - Intergenic
1133454955 16:5933949-5933971 AGGCGCCTACTTGAGGGTGGAGG - Intergenic
1142106172 16:88304079-88304101 AGGAGGCTTGTTCTGGGAGGAGG + Intergenic
1142119394 16:88378496-88378518 AGGAGCCGTCCTCAGGGAGGTGG + Intergenic
1142998859 17:3777874-3777896 GGGCGGCTTCTTGGAGGAGGGGG - Intronic
1143537217 17:7548825-7548847 GGGCACCTCCTGCGGGGAGGTGG - Intergenic
1145972308 17:28963577-28963599 AGGAGGCTTCCTAGGGGAGGAGG - Intronic
1148890097 17:50801016-50801038 AGCAGCCTTCTTAGAGGAGGAGG + Intergenic
1150621914 17:66814153-66814175 AGATGCCTTCCTGGGGGAGGAGG + Intergenic
1151157636 17:72137513-72137535 AGGCGGCCTTTTGGGGGAGGAGG + Intergenic
1151724131 17:75874941-75874963 AGGCACCTACTACTGGGAGGTGG - Exonic
1152024151 17:77797830-77797852 AGCCTCCTTATTCTGGGAGGGGG + Intergenic
1152093699 17:78260605-78260627 AGGTGCCTGCTTCGGGAGGGCGG + Intergenic
1152537484 17:80959206-80959228 TGGCACCTTCTTTGGGGTGGGGG + Intronic
1152570327 17:81118844-81118866 GGGGGCCTTCTCCGAGGAGGTGG + Intronic
1154043736 18:10884588-10884610 AGCTGCCTGCTTCGTGGAGGTGG + Intronic
1155593272 18:27452880-27452902 ACGTGCCTTCTTCAGCGAGGTGG - Intergenic
1160988120 19:1848844-1848866 AGGAGAGTTCTGCGGGGAGGTGG + Intergenic
1161491876 19:4566744-4566766 GGGCGCCTTGTTGGGGGAGAGGG + Intergenic
1165289475 19:34871543-34871565 ATGCTCCTTCTTCCGGGAGGTGG - Intergenic
1167255015 19:48422103-48422125 AGGAGCCTGCTCCTGGGAGGAGG - Intronic
1168317208 19:55489514-55489536 AGGCGCCTTCTTCGGGGAGGGGG + Exonic
927053215 2:19349664-19349686 AGGCTCGATCTTCAGGGAGGTGG + Intergenic
928155230 2:28870405-28870427 CTGCGCCTGCGTCGGGGAGGGGG + Intergenic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
941051223 2:160736310-160736332 AGGTGGCTTCTCAGGGGAGGTGG - Intergenic
942449638 2:176100804-176100826 AGAGGCCTTGTTTGGGGAGGGGG + Exonic
948828978 2:240588272-240588294 AGAGGCATTCTTCTGGGAGGCGG + Intronic
1170072151 20:12380846-12380868 ACGTGCCTTCTTCAGTGAGGTGG + Intergenic
1172818639 20:37711876-37711898 AGGGGTCAGCTTCGGGGAGGAGG + Intronic
1173292481 20:41726921-41726943 AGGCCCCTTCCTCTGGCAGGTGG - Intergenic
1174846803 20:53950315-53950337 AGGCTCTTTCTTCCAGGAGGAGG - Intronic
1175968212 20:62670505-62670527 AGGCGCCTCCTTCAGCGAGAAGG + Intronic
1176189414 20:63800816-63800838 AGGAGCCCACTGCGGGGAGGGGG - Intronic
1179359339 21:40690919-40690941 TGGGGCCTACTTCGGGGTGGAGG + Intronic
1180187259 21:46145874-46145896 GCGCGCCTTCGTGGGGGAGGTGG - Exonic
1181612864 22:24030705-24030727 AGGTGCCTTCTTTATGGAGGAGG + Intronic
1182665901 22:31959719-31959741 AGGCACCTTCTTTGGGAATGAGG + Intergenic
1182693822 22:32182865-32182887 AGGCGCCATCTACGAGGAGCAGG - Intergenic
1182775051 22:32824918-32824940 AGGGACCTTGTTTGGGGAGGCGG + Intronic
1183994334 22:41621500-41621522 ACGCTCCTTCCTCGGGAAGGAGG + Exonic
1184244512 22:43229024-43229046 AGGCGCGTGCCTCGGGGGGGAGG + Intronic
1185082710 22:48718635-48718657 AGGGTCCTTGTGCGGGGAGGGGG - Intronic
951966515 3:28391793-28391815 TGGCTCCTTCTTAGGGGATGAGG - Intronic
954004968 3:47583455-47583477 AGGTGCCTTCTTGGGGCAGTTGG - Intergenic
954457629 3:50608475-50608497 TGGGGCCTTCCTCGAGGAGGTGG - Exonic
956463036 3:69490926-69490948 TGGCTCCTTCTTGGAGGAGGTGG - Intronic
963323510 3:143835783-143835805 AGGCCCCTTCTTGCTGGAGGAGG + Intronic
964450692 3:156809925-156809947 ACGTGCCTTCTTCAGTGAGGTGG - Intergenic
966875512 3:184319675-184319697 AGGCGCCAGCTTGGGGGAGGGGG - Exonic
968649520 4:1754944-1754966 AGGAGGCTTCCTGGGGGAGGTGG + Intergenic
969986626 4:11218029-11218051 AGAAGCCTTCTTGGAGGAGGTGG + Intergenic
981504238 4:145482225-145482247 AGGCGCCATCATGGGGGGGGGGG - Intronic
985499779 5:235690-235712 AGGCTCCTTGTTGGGCGAGGTGG + Intronic
985552492 5:540729-540751 GGGAGCCTTCTTGGAGGAGGTGG - Intergenic
990120641 5:52446776-52446798 AGGCACCTTCTTCTGAGAAGTGG + Intergenic
990812989 5:59749901-59749923 AGGAGCATTTTTAGGGGAGGTGG - Intronic
994173371 5:96682886-96682908 AGTGGCCTTCTTGGGGGTGGAGG - Intronic
998176457 5:139904687-139904709 AAGCCCCCTCTTCGGCGAGGAGG - Intronic
1006684450 6:35820820-35820842 AGGCGCTTTCTGTGGGAAGGAGG + Intronic
1006800014 6:36753704-36753726 AGGCCTCTGCTTGGGGGAGGGGG - Intronic
1019774178 7:2902517-2902539 AGGGGGCTGCTTTGGGGAGGGGG - Intergenic
1023059487 7:36314442-36314464 CAGAGCCTTCTTTGGGGAGGCGG - Intergenic
1024477913 7:49833487-49833509 AGACCCCATCTTCAGGGAGGTGG - Intronic
1028305241 7:89255144-89255166 AGGCGCCTTCTTCACAGGGGTGG + Intronic
1029496301 7:100896905-100896927 CGGCGCCTGCTTCCTGGAGGCGG + Intronic
1034938306 7:155213901-155213923 AGGCGCTTTCTCCTGGGAGGTGG + Intergenic
1035404669 7:158589140-158589162 AGGTGCTTTCTACGGGGAGGTGG - Intergenic
1039422344 8:37453683-37453705 AGGCTCCTTGTGCGGGGACGAGG + Intergenic
1041109290 8:54470101-54470123 AGCTGCCTTCCTCCGGGAGGCGG + Intergenic
1041271426 8:56113134-56113156 AGGCGCCGTATTCGGGGGAGCGG - Exonic
1041394778 8:57379215-57379237 AGGCATCTTGTTTGGGGAGGTGG - Intergenic
1045066171 8:98447075-98447097 TGGCGCCTACTTCAGGGTGGAGG + Intronic
1048898454 8:139015822-139015844 ATGCGCCTTATTTGGGGAGGAGG + Intergenic
1049610788 8:143553837-143553859 AGGCGCCGTCTGCGGGCAGGAGG - Intronic
1049761018 8:144332074-144332096 AGGGGCCTGCCTCGGAGAGGCGG + Exonic
1051062140 9:13056899-13056921 AGGCGCCATCTATGGGGAAGTGG - Intergenic
1061397217 9:130349672-130349694 ACACGCCATCCTCGGGGAGGGGG - Intronic
1062209665 9:135356767-135356789 ATGCTCCTTCTTCGGGGAGAGGG + Intergenic
1188336412 X:28939519-28939541 AGGGGCCTACTTCAGGGTGGAGG + Intronic
1189331765 X:40148546-40148568 AGGGCCCTTCATGGGGGAGGAGG + Intronic
1189545946 X:42042807-42042829 AGGTGCCTTGTTCAGGAAGGAGG + Intergenic
1193389885 X:80913919-80913941 AAGCGCCACCTTCTGGGAGGAGG - Intergenic
1194890456 X:99372154-99372176 AGGCGCCCACCGCGGGGAGGCGG + Intergenic
1197870236 X:131057598-131057620 ATGGGACTTCTTGGGGGAGGCGG + Intergenic
1198423947 X:136496929-136496951 GGGCGCCATCTTAGGGGAGTGGG - Intergenic
1198750381 X:139932399-139932421 AGGCTCCTCCTGTGGGGAGGGGG + Intronic
1200229612 X:154437479-154437501 AGGGGGCCTCTTCGGGGAGATGG - Intronic