ID: 1168317801

View in Genome Browser
Species Human (GRCh38)
Location 19:55491621-55491643
Sequence CATTCACGCCCCCTCAGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168317795_1168317801 -9 Left 1168317795 19:55491607-55491629 CCTCCATCTCCCCTCATTCACGC 0: 1
1: 0
2: 3
3: 26
4: 296
Right 1168317801 19:55491621-55491643 CATTCACGCCCCCTCAGCGCGGG 0: 1
1: 0
2: 1
3: 6
4: 70
1168317793_1168317801 3 Left 1168317793 19:55491595-55491617 CCCACGGGTGAGCCTCCATCTCC 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1168317801 19:55491621-55491643 CATTCACGCCCCCTCAGCGCGGG 0: 1
1: 0
2: 1
3: 6
4: 70
1168317794_1168317801 2 Left 1168317794 19:55491596-55491618 CCACGGGTGAGCCTCCATCTCCC 0: 1
1: 0
2: 2
3: 12
4: 211
Right 1168317801 19:55491621-55491643 CATTCACGCCCCCTCAGCGCGGG 0: 1
1: 0
2: 1
3: 6
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168317801 Original CRISPR CATTCACGCCCCCTCAGCGC GGG Intronic
904384410 1:30132105-30132127 CATGCACACCCCATCAGTGCAGG + Intergenic
904684001 1:32247809-32247831 CATTCCCGGCTCCTCAGCCCAGG - Intronic
906285869 1:44587527-44587549 CATTCCCGCCCCCTCTGTGCTGG + Intronic
907659204 1:56376587-56376609 CATTCAAGACCCCCCAGCCCTGG + Intergenic
910121860 1:83799052-83799074 CATACAGGCCCCCTCACCACAGG + Intergenic
1067015714 10:42755213-42755235 CGTACACGCCCCATCAGCCCTGG - Intergenic
1069813466 10:71179151-71179173 CCTTCTTTCCCCCTCAGCGCTGG + Intergenic
1076683466 10:132186760-132186782 CTTTAAAGCCCCCCCAGCGCTGG - Intergenic
1077423094 11:2462109-2462131 CAGCAACGCCCCCTCAGCCCAGG - Intronic
1080784079 11:35459034-35459056 CATTCACACCCCCAGAGGGCTGG - Intronic
1084332418 11:68437929-68437951 CATTCACTCTCCCACAGGGCCGG - Intronic
1084402861 11:68955409-68955431 CATTCAGGCCCCCACAGCACCGG - Intergenic
1084761249 11:71272562-71272584 CATTCACACCCCATCAGCCAAGG + Intergenic
1085237372 11:75025540-75025562 CATTCTCACCCCCTCTGCTCAGG + Intergenic
1091658317 12:2362196-2362218 CCTTCACGCCCCCTCAGAGCTGG - Intronic
1096228768 12:49885903-49885925 CATTCACGCGTCCTCTCCGCAGG - Intronic
1097277336 12:57822401-57822423 CACTCATTCCCCCTCAGCCCAGG + Exonic
1101241078 12:102840645-102840667 CATTCCCCCCGCCTCAGCCCTGG - Intronic
1103480270 12:121246075-121246097 CATTCACCTCCCCCCAGCCCTGG - Intronic
1104471267 12:129031816-129031838 CAATGCCGCCCCCTCAGCCCTGG + Intergenic
1118875908 14:69784808-69784830 CAGTCACCCCACCTCAGCCCTGG - Intronic
1126668928 15:51098453-51098475 CATGGAGGCCCCCTCAGCTCTGG - Intronic
1127487479 15:59432750-59432772 CACTCACCTCCCCTCAGCCCTGG - Intronic
1128381171 15:67114191-67114213 CCTTCCCACCTCCTCAGCGCTGG + Intronic
1129760191 15:78124766-78124788 CATTCACTCCTCATCAGAGCTGG - Intronic
1132101176 15:99024495-99024517 CATGCACACGCCCTCAGCGGAGG + Intergenic
1132789586 16:1678257-1678279 CGTTCCCGCCCGCCCAGCGCAGG - Exonic
1145254348 17:21314496-21314518 CATCCAGGCCCCCTCAGTCCAGG - Exonic
1145322251 17:21773466-21773488 CATTCAGGCCCCCTCAGTCCAGG + Intergenic
1147321983 17:39652113-39652135 CGTTCACGTCCACTCAGGGCAGG - Intronic
1148693655 17:49546715-49546737 CACCCAGGCCCCCTCAGTGCAGG + Intergenic
1152808877 17:82371895-82371917 CCCTCGCGCCCCCTCTGCGCTGG + Intergenic
1154385546 18:13888818-13888840 CATTGACGCCACCTCACAGCAGG - Intronic
1157446242 18:47748707-47748729 CATGCAAGACCCCTCACCGCGGG + Intergenic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1162954697 19:14091317-14091339 CCTTCCCGCATCCTCAGCGCCGG - Intergenic
1163002196 19:14375491-14375513 CATGCACTCCCCCTCAGCCCCGG + Intergenic
1166873733 19:45885319-45885341 CCTTCGCGCCCCCTCAGCCACGG + Exonic
1168317801 19:55491621-55491643 CATTCACGCCCCCTCAGCGCGGG + Intronic
924966506 2:81323-81345 CATTCAGGCCCCCACACCGCAGG + Intergenic
925004746 2:433313-433335 AATTCATTCCCCCTCAGTGCTGG + Intergenic
926727748 2:16011752-16011774 CATTCACACCAGCTCAACGCTGG + Intergenic
927516113 2:23672535-23672557 CACTCCCGGCCCCTCAGCCCTGG + Intronic
1169972936 20:11289827-11289849 CATTCAGGCTCCCTAAGCTCAGG + Intergenic
1171865454 20:30485284-30485306 GGTTCCCGCCCCCACAGCGCGGG + Intergenic
1185298863 22:50068621-50068643 CATGCCCGCCCCCCCAGCCCTGG - Intronic
949874965 3:8620566-8620588 CCTTCACGCACCCTAAGCTCTGG + Intronic
951243093 3:20309394-20309416 CATTCATGCCACTTCAGCACAGG - Intergenic
966832972 3:184026691-184026713 CATTCAGGCCAAATCAGCGCTGG - Intergenic
967232471 3:187353220-187353242 AATTAACGCCACCTCAGCCCTGG - Intergenic
973775012 4:54234002-54234024 CATTTCCGCCCCCTCGGGGCAGG - Intronic
980602791 4:135046506-135046528 CATTCAGGCCAAATCAGCGCTGG + Intergenic
985549109 5:524320-524342 CATTGCCGCCTGCTCAGCGCAGG + Exonic
1001042676 5:168348225-168348247 CAGTCACGTCCCCTGAGCTCAGG - Intronic
1015903845 6:138095973-138095995 CATTCAGGTCCCCTCAGCAGGGG + Intronic
1018573712 6:165236571-165236593 CATTCCAGCCCCCTCAGCCATGG + Intergenic
1019517039 7:1444680-1444702 CAAGCAGGCCCTCTCAGCGCTGG - Exonic
1029374608 7:100170250-100170272 CATTCTCTCCCTCTCAGCCCTGG - Exonic
1029461953 7:100699846-100699868 TATTCATGTCCCCTCAGCACAGG + Intergenic
1034271135 7:149803880-149803902 CACTATCGCCCCCTCAGGGCTGG - Intergenic
1034468865 7:151245424-151245446 CCTGCACGCCCCCTCCTCGCCGG + Intronic
1035977216 8:4325724-4325746 CATTCACGCCTTCTCAGTGTTGG - Intronic
1036454264 8:8893599-8893621 CAATCGCGCCCTCCCAGCGCCGG - Exonic
1037371516 8:18184181-18184203 AATTCATGCCTCCTCAGCTCTGG + Intronic
1037815668 8:22110335-22110357 CCTTCACCCCACCTCAGCACTGG + Intergenic
1047739504 8:127795134-127795156 CTCTCACACCCCCTCAGGGCTGG + Intergenic
1048292729 8:133192827-133192849 CCTTCACTCCTCCTCAGCACCGG - Intronic
1049180076 8:141217761-141217783 CATTCACGACTGCTCACCGCGGG + Intronic
1053841184 9:42189640-42189662 CAGTCAGTCCCCCTCAGCACTGG + Exonic
1054098242 9:60920406-60920428 CAGTCAGTCCCCCTCAGCACTGG + Intergenic
1054119643 9:61196036-61196058 CAGTCAGTCCCCCTCAGCACTGG + Exonic
1054588111 9:66986526-66986548 CAGTCAGTCCCCCTCAGCACTGG - Intergenic
1056585205 9:87923413-87923435 CAGTCAGTCCCCCTCAGCACCGG + Intergenic
1056611675 9:88129527-88129549 CAGTCAGTCCCCCTCAGCACCGG - Intergenic
1057276390 9:93677957-93677979 CCTTCAGGCCCCCTGAGCGTGGG + Exonic
1061072881 9:128322568-128322590 CAACCACGCTCACTCAGCGCCGG - Exonic
1190116347 X:47628180-47628202 CATTCCAGCCCACACAGCGCCGG + Exonic
1199565266 X:149208997-149209019 CCTTCACACCCCCTCAGCCCAGG - Intergenic