ID: 1168318020

View in Genome Browser
Species Human (GRCh38)
Location 19:55492563-55492585
Sequence CCTCATCTGCAGACAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 373}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168318020_1168318026 -10 Left 1168318020 19:55492563-55492585 CCCTCCCCTGTCTGCAGATGAGG 0: 1
1: 0
2: 1
3: 50
4: 373
Right 1168318026 19:55492576-55492598 GCAGATGAGGAAAAGCAGACAGG 0: 1
1: 0
2: 3
3: 57
4: 469

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168318020 Original CRISPR CCTCATCTGCAGACAGGGGA GGG (reversed) Intronic
900485375 1:2920341-2920363 CCCCATCTGCAGTGAGCGGAGGG - Intergenic
901041699 1:6368160-6368182 CCTCACCTTCAAACTGGGGAGGG - Intronic
902407454 1:16192454-16192476 CCCCATCTGCAAAATGGGGACGG - Intergenic
902774717 1:18667331-18667353 CCGCATCTTCAGAGAGTGGAAGG + Intronic
902871099 1:19314042-19314064 CCTCACCTGCAGGGATGGGAAGG - Intronic
902923883 1:19683108-19683130 CCCCATCTGCAGCCATGGCATGG - Exonic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903755554 1:25658055-25658077 TCTCATCTTCAGACAGGTCAAGG - Intronic
904383627 1:30127690-30127712 CCACATCTCCTGCCAGGGGAGGG - Intergenic
904457596 1:30656990-30657012 CCTCATCTGTAAACTGGGGGTGG - Intergenic
904535079 1:31194103-31194125 CCTGATCTCCCGCCAGGGGAAGG + Intronic
904840268 1:33368011-33368033 CCTCATCTACGGAATGGGGAGGG - Intronic
904926081 1:34049221-34049243 CCTCATCTGTAGACAAGAGAGGG + Intronic
904944346 1:34188482-34188504 CTTCATCTGCAAAGTGGGGATGG - Intronic
905175587 1:36133561-36133583 CCTCATCTGCAGATAGTAGTAGG + Intergenic
905346952 1:37317879-37317901 CCTCATCTGTAAAGAGGTGATGG + Intergenic
905401743 1:37708681-37708703 CCTCAACTGCAGGCAGGGCAGGG - Exonic
905447586 1:38037091-38037113 CCTCACCTGTAGGCTGGGGATGG + Intergenic
905531035 1:38678842-38678864 CCTCATCTGCACTATGGGGATGG + Intergenic
905627436 1:39498205-39498227 CCCCATCAGCAGGCAGGGGGTGG - Intronic
905668989 1:39778903-39778925 CCCCATCAGCAGGCAGGGGGTGG + Intronic
905827090 1:41034074-41034096 CCTCATGTGCAAACTGGAGATGG - Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
905947921 1:41919316-41919338 CCTGATCTGCAGCCAGAGGCTGG - Intronic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906436440 1:45800892-45800914 CCTCATCTCCATTCATGGGAAGG + Intronic
906450873 1:45946322-45946344 CCTCATCTTGAGACTGGGGATGG + Intronic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
908679428 1:66643233-66643255 ACTCATCTACAGAGAGAGGAAGG - Intronic
909399032 1:75205432-75205454 ACACATTTGCACACAGGGGATGG + Exonic
910928398 1:92419150-92419172 TCTCATCTGTAAACTGGGGATGG + Intergenic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
912491005 1:110062857-110062879 CCTCATCCTCTGTCAGGGGAGGG - Intronic
914871302 1:151477042-151477064 CTTTATCTGCAAACAGGGGCAGG - Intergenic
914887493 1:151597372-151597394 CCTCATCTGCAAACTTCGGAGGG + Intergenic
915509287 1:156377801-156377823 CCTCATCTACAAACAGGGCCAGG + Intronic
916166129 1:161968845-161968867 CAACATCAGCAGCCAGGGGAAGG - Intergenic
919526730 1:198662909-198662931 CATCAACTGCAGAGAGGGAATGG - Intronic
919648884 1:200125553-200125575 CCTCATCTGCAGAGAAGCAACGG + Intronic
920092893 1:203466683-203466705 CCTCATCTGTAAAGTGGGGATGG + Intergenic
920461520 1:206144262-206144284 CCTAAACTGCATGCAGGGGAAGG + Intergenic
923966761 1:239150114-239150136 CCTTATCTGCAAAAAGTGGATGG - Intergenic
924673554 1:246152809-246152831 CCACATCTGCAAAATGGGGATGG + Intronic
1062902984 10:1159627-1159649 CCTCATCTGCATAAAGCGTAGGG - Intergenic
1063196312 10:3747111-3747133 CCACCTCTGTAGACAGGGGCTGG - Intergenic
1066011917 10:31202168-31202190 CCTCATCTGCAGACACGCCCTGG + Intergenic
1066196369 10:33104228-33104250 TCTCCTAGGCAGACAGGGGAAGG - Intergenic
1067511364 10:46897564-46897586 CCTCCCCTGCAGACAGAGGATGG + Intergenic
1067650883 10:48154298-48154320 CCTCCCCTGCAGACAGAGGATGG - Intergenic
1067941096 10:50658259-50658281 CCTCCTCTCCACACTGGGGATGG - Intergenic
1069892016 10:71657867-71657889 CTTTATCTGCAGCCTGGGGAGGG + Intronic
1070514757 10:77194166-77194188 CCTCATATTCATACAGGGGATGG + Intronic
1070626466 10:78054514-78054536 CCTCATCTGCAAAAGCGGGAAGG - Exonic
1070628543 10:78068145-78068167 CCTCAGCTCCAGAGATGGGAGGG - Intergenic
1071256588 10:83877261-83877283 CCTCATCTGCAGTGGAGGGATGG - Intergenic
1071549260 10:86553713-86553735 TCTCATCTGAAGACTGGGGATGG + Intergenic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1074424539 10:113339239-113339261 CCCCATCTGGAGAAAGGTGAAGG - Intergenic
1075406898 10:122201143-122201165 CCACATCTACAGTCAGAGGACGG + Intronic
1075715672 10:124553840-124553862 CTCCTTCTGCAGACAGAGGAGGG - Intronic
1076032726 10:127173236-127173258 TCTGTCCTGCAGACAGGGGATGG - Intronic
1076155237 10:128199497-128199519 CCTCATCAGCAGACAGGGCTAGG + Intergenic
1076346338 10:129781255-129781277 CCTCACCTGCAGAACAGGGATGG + Intergenic
1077223690 11:1428441-1428463 CCACATGTGCTGGCAGGGGATGG + Intronic
1078396591 11:10987141-10987163 CCTAGTCTGCAGCCAGGGGTTGG - Intergenic
1078845928 11:15118278-15118300 CCTCATCTGAATGCAGGGCAGGG + Intronic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079318132 11:19427220-19427242 CCTCCCCTGCAGAAAGAGGATGG + Intronic
1080765070 11:35288393-35288415 CCTCATTTGCATGCAGGGGATGG + Intronic
1080897948 11:36461778-36461800 CCTCATCTCCTGCCAGGTGAAGG - Intronic
1081658600 11:44874169-44874191 CCTCATCTGTAAAAAGGAGATGG + Intronic
1081809994 11:45909272-45909294 CCTCACCCACAGGCAGGGGAAGG - Intergenic
1083889262 11:65587843-65587865 CCTCATCTGTAAAGTGGGGAGGG + Intronic
1084174568 11:67416561-67416583 CCTCATCAGCCCCCAGGGGATGG + Intronic
1085267220 11:75244011-75244033 CCTCATCTTCAGGATGGGGATGG + Intergenic
1085457268 11:76672121-76672143 CCTGAGCTGCAGTGAGGGGATGG + Intergenic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1091589545 12:1835100-1835122 CCTCACCTGCATTGAGGGGACGG + Exonic
1091768418 12:3136824-3136846 CCTCAGCTGGAGGCAGGGGTGGG + Intronic
1093276327 12:17132648-17132670 TGTCATCTGCAGACAGGGATAGG - Intergenic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1097614543 12:61868232-61868254 CCTCATCTACAAAATGGGGATGG - Intronic
1097743958 12:63278629-63278651 CCTCATTTGGAGACAGTGAAAGG + Intergenic
1098133938 12:67381702-67381724 CCTCATCTGTAGACTGGAGATGG - Intergenic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1099817779 12:87670252-87670274 CGTCATCTGCATGCAGGGGTCGG - Intergenic
1100779269 12:98007122-98007144 GCTCATCTGGAGACAGGGATTGG + Intergenic
1101885477 12:108657557-108657579 CCTCATCTGGGGAAGGGGGATGG - Intronic
1102045581 12:109828206-109828228 CCTCATCTGGAGACCGGCAAGGG + Intronic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102741784 12:115213879-115213901 CCACATCTGCAGACTTGTGAGGG - Intergenic
1103335269 12:120184630-120184652 CCTTGTCTGCAGAATGGGGATGG - Intronic
1103526951 12:121575457-121575479 CCTGATCTGGAGCAAGGGGAAGG + Intronic
1103913722 12:124365421-124365443 GCTCATCTGCAGGAAGGAGATGG - Intronic
1104684305 12:130774694-130774716 TCCCATCTGCAGCCAGGAGATGG + Intergenic
1104831681 12:131756729-131756751 CCTCACCTGCAGGCTGGGGTGGG + Intronic
1106421211 13:29587805-29587827 CGTCAGCTCCAGACAGGGGCCGG + Intronic
1106944439 13:34811118-34811140 CATCTTCTTCAGACAGGGGGTGG - Intergenic
1107631654 13:42349212-42349234 CCTCATCAGCAAAATGGGGATGG - Intergenic
1107998820 13:45888157-45888179 CCTCATCTGCAAAAGAGGGATGG - Intergenic
1110065502 13:71100608-71100630 CCTACCCTGAAGACAGGGGAAGG - Intergenic
1112011736 13:95299288-95299310 CCTCAACTTCAGGCAGGGCAAGG - Intronic
1112740937 13:102472281-102472303 CCTCATCTTCAGGCCAGGGAGGG - Intergenic
1113138778 13:107123415-107123437 CCTAAGCTTCAGACAGGGCATGG - Intergenic
1114835316 14:26196985-26197007 CCTGATCTGCAGGCCAGGGATGG - Intergenic
1115415008 14:33122334-33122356 CCTCTTCTGGAGAAAGGTGATGG - Intronic
1115641642 14:35339082-35339104 CCTGAACTGCAGCCCGGGGATGG - Intergenic
1118037149 14:61880060-61880082 TTTCATCTGCAGACAGAGGTGGG - Intergenic
1118584188 14:67336695-67336717 CCTCATCTGCAAAGTGGAGATGG + Intronic
1119158147 14:72430457-72430479 TCTCTTCTGCAGACAGAGGAGGG + Intronic
1120483488 14:85082229-85082251 GCTAATGTGCAGACAGGGAAAGG + Intergenic
1120514331 14:85452400-85452422 CCTTATCTGCAGAATGGGGGTGG + Intergenic
1122059531 14:99127406-99127428 CCTCATCTGCAAAGCAGGGATGG - Intergenic
1122149256 14:99715970-99715992 CCCCCTCTGCGGACTGGGGAGGG + Intronic
1122781932 14:104147408-104147430 CCTCCTCTGCTGGGAGGGGAGGG - Intronic
1122839207 14:104446735-104446757 CCTCTGCTGTAGACAGGGGCAGG - Intergenic
1122910088 14:104823374-104823396 CCTCATCTGGAGGGAAGGGAGGG - Intergenic
1124356278 15:28997106-28997128 CCTCATCAGCAGAACAGGGATGG - Intronic
1124439039 15:29674107-29674129 CATCCTCTGCAGGCTGGGGAAGG - Intergenic
1124455108 15:29835021-29835043 CCTCATCTGCAGAATGGAGGAGG + Intronic
1124490048 15:30150042-30150064 CACCAGGTGCAGACAGGGGAGGG - Intergenic
1124753484 15:32388285-32388307 CACCAGGTGCAGACAGGGGAGGG + Intergenic
1124913600 15:33947020-33947042 TCTCATCTGTAGACAGGTTAGGG + Intronic
1124975226 15:34523988-34524010 CACCAGGTGCAGACAGGGGAGGG + Intergenic
1125238902 15:37550447-37550469 CCCCATCTTCAGGCAGAGGAGGG - Intergenic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1126901970 15:53323641-53323663 CCTCAACTGCAGGCAAAGGAAGG - Intergenic
1127310097 15:57744853-57744875 CCACATCTGCAGAATGGGGCTGG - Intronic
1128186227 15:65645418-65645440 TCTCATCTGCAGATAGGTCAGGG + Intronic
1128300522 15:66563995-66564017 CCTCCTGTGCAGACAGGGGTGGG + Exonic
1128678891 15:69632100-69632122 CCGCATCTGCAGAGAGGAAAAGG + Intergenic
1128765339 15:70247920-70247942 CCTCACCTGTAAACAGAGGAGGG - Intergenic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1129109329 15:73328604-73328626 CCTCATCTGCAGGGCGGGGGTGG - Intronic
1129114941 15:73360075-73360097 CTGCATCTTCAGAAAGGGGAAGG + Intronic
1129542934 15:76365787-76365809 CCTCATTTCCAGAGAGGAGAAGG - Intronic
1129952169 15:79601499-79601521 TCTCCTCTGCAGCCTGGGGAGGG - Intergenic
1131072429 15:89474660-89474682 CCTCAACTGCTGAAAGGGGTGGG + Intronic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132202597 15:99965111-99965133 CCTGACCTACAGACAGGGGTTGG + Intergenic
1132474315 16:125797-125819 CCTCAGCTACAGAAAGGAGAGGG + Intronic
1132851998 16:2028988-2029010 CTGGATCTGCAGAGAGGGGAAGG - Intronic
1132996705 16:2827254-2827276 CCACCTCTGCAGGCAGGAGAAGG + Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1135358808 16:21793504-21793526 CCTCATCTGCAGTCAGCTGTGGG + Intergenic
1135457364 16:22609940-22609962 CCTCATCTGCAGTCAGCTGTGGG + Intergenic
1136573792 16:31111587-31111609 CCTCAGCTGCTGACAGAGGCAGG - Intronic
1137282726 16:46992288-46992310 CCCCATCTTCAGACTAGGGAGGG - Intergenic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138157856 16:54722494-54722516 CCTCCTCTGCAGCCACAGGAGGG - Intergenic
1138242560 16:55439519-55439541 TCTCATCTGCAAACAGGCTATGG + Intronic
1138284136 16:55794916-55794938 TCTCACCTGCAGGCAGGAGACGG + Intergenic
1138284866 16:55802071-55802093 TCTCACCTGCAGGCAGGAGACGG - Intergenic
1138598220 16:58040772-58040794 CCTCATCTACAAAATGGGGATGG - Intronic
1139068130 16:63344884-63344906 CCTCTGCTGCAGACAGGGTGGGG - Intergenic
1140348991 16:74243584-74243606 CCTCAGCTGCAGACAAGTGCAGG + Intergenic
1140868015 16:79081105-79081127 TCTTATCTCCACACAGGGGATGG - Intronic
1141685904 16:85569893-85569915 CCTCATCTCCACACAGAGGTGGG - Intergenic
1141901980 16:86996877-86996899 CCTCATCTTTAGAGTGGGGATGG + Intergenic
1141996453 16:87639208-87639230 CCTCATCTGCAACGAGGGGAGGG - Intronic
1141998413 16:87649118-87649140 CCTCTGCTGCAGAGAGGGGCGGG + Intronic
1142286363 16:89173113-89173135 CCCCATCTGGAGACAGTGGTGGG + Intronic
1142682490 17:1558528-1558550 CCTCATCTACAGACACAGGCAGG + Exonic
1142691045 17:1606208-1606230 CCGCGTCTGCAGCCAGGAGAGGG - Intronic
1143400524 17:6639725-6639747 CCTCTCCTGCAGGCACGGGATGG + Intronic
1143867495 17:9934644-9934666 CCTCATCAGCAAACCAGGGAGGG - Intronic
1143906057 17:10210111-10210133 CCTCATCTGCAGGACAGGGATGG + Intergenic
1144495519 17:15742639-15742661 CCTCATGGGCAGACTGGGGCAGG + Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145052198 17:19671364-19671386 CCTCATTTCCAGAGAGGGAAAGG - Intronic
1145249315 17:21288681-21288703 CCTCATCTGCAGACTGAGAATGG + Intronic
1145255641 17:21320824-21320846 CCTCATCTGCAAATTGGGGCAGG + Intergenic
1145320973 17:21767124-21767146 CCTCATCTGCAAATTGGGGCAGG - Intergenic
1145780402 17:27559317-27559339 CAACATCTACAGACAGGGAAGGG - Intronic
1146431356 17:32798469-32798491 CCTTAACTGTGGACAGGGGAAGG - Intronic
1146668179 17:34718541-34718563 CCACATCTGTAAACACGGGAGGG + Intergenic
1147210799 17:38871353-38871375 CCTCCCCTCCAGACTGGGGAGGG - Intronic
1147421769 17:40325462-40325484 TCATATCTGCAGACAGGGGTTGG - Intronic
1148088438 17:45008283-45008305 CCTCACCTGCAGCTGGGGGACGG + Intergenic
1148739871 17:49886699-49886721 CTTCCTTTTCAGACAGGGGAAGG + Intergenic
1149573587 17:57695456-57695478 CCTCATCTTCAGAAAATGGAGGG - Intergenic
1149784708 17:59425174-59425196 CCTGACCTGCTGTCAGGGGAGGG + Intergenic
1151936199 17:77263208-77263230 CCCCTGCTGCAGCCAGGGGAGGG + Intergenic
1151964701 17:77425338-77425360 TCTCAGCTGCAGGCAGGAGAGGG - Intronic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1152380699 17:79941102-79941124 CCTCGCCTGCAGACAGAGGACGG + Exonic
1152436185 17:80277915-80277937 CCTCACCTGCAGTCATGGGGTGG + Intronic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1152877257 17:82793933-82793955 CCTCATCTGCAGAGTCGGCATGG + Intronic
1153015906 18:582541-582563 CCTGATCTGAGGGCAGGGGAAGG + Intergenic
1155210540 18:23596776-23596798 CATCATCTGCATAGAGGTGATGG - Intergenic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1157528255 18:48401571-48401593 CCCCATCTGCAGTATGGGGATGG + Intronic
1157740819 18:50091091-50091113 CCCCACCTGAAGACAGGGAAGGG + Intronic
1158144623 18:54298325-54298347 CCTGATGTCCAGACAGAGGAGGG - Intronic
1160464341 18:79063570-79063592 CCTCATCTGGGGAAAGGTGAAGG + Intergenic
1160966213 19:1748067-1748089 CAGAATCTGCAGACCGGGGATGG - Intergenic
1161267350 19:3370387-3370409 CCTCCGCCGCAGAGAGGGGAGGG - Intronic
1162721993 19:12668150-12668172 CCCCAGCAGCAGGCAGGGGAAGG + Exonic
1163234546 19:16023001-16023023 CCTCATGGGCAGACAGGGCCAGG + Intergenic
1163262614 19:16200235-16200257 CCTCATCTTTAGCCAGTGGAAGG + Intronic
1163391187 19:17030993-17031015 CCTCATCAGCACACGGGAGAAGG + Intergenic
1164413037 19:28021420-28021442 CCTCATCTGCACACAGCAGCAGG - Intergenic
1165065746 19:33226913-33226935 CCTCATCCACATGCAGGGGACGG - Intergenic
1165906195 19:39196352-39196374 CCCCCTCTGCAGAGTGGGGAGGG + Intergenic
1167528981 19:50003057-50003079 CTTCATCTGCAGAGGGGAGATGG - Intronic
1168297145 19:55383018-55383040 CCTCCACTGCAGAATGGGGATGG + Intronic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
1168410280 19:56135583-56135605 TGTCACCTGCAGACAGGGCAGGG + Intronic
924977051 2:187317-187339 CCTCATCTAAAGACTGAGGAAGG - Intergenic
925852736 2:8098731-8098753 GCTCATCTGCAAAGAGTGGATGG + Intergenic
925882410 2:8363806-8363828 CCTCATCAGCAGAGACAGGAAGG - Intergenic
926918182 2:17913640-17913662 CTTCATCTGCTGACAGGGGCTGG - Intronic
927693047 2:25221916-25221938 CCTCTTCTCTAGACAGTGGAGGG - Intergenic
929969843 2:46564627-46564649 CCTCATCTGGACATAGAGGAAGG + Intronic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
931128288 2:59302304-59302326 CCTCTTTTGCTAACAGGGGAAGG - Intergenic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931284238 2:60819174-60819196 CCTCATCTGCAGAACAGGGCTGG - Intergenic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
933820528 2:86107016-86107038 CCTCATCTGCAGACTAGAGTTGG + Intronic
935457988 2:103292802-103292824 TCTAATTTCCAGACAGGGGATGG + Intergenic
938064428 2:128273401-128273423 TCACATCTGCAGAAAGGGGCAGG - Intronic
938076223 2:128340022-128340044 CTTCATATGGAGACACGGGAGGG + Intergenic
938233422 2:129681107-129681129 CCCCTTCTGGAGACATGGGATGG + Intergenic
943635377 2:190301233-190301255 CTTTATCTGCAGGGAGGGGAAGG + Intronic
945967251 2:216201707-216201729 TCTCTTCTGCAGAAAGGGGTAGG - Intronic
947666896 2:231911594-231911616 CCTAAGCTGCATACAGGGGAGGG - Intergenic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
948639852 2:239368727-239368749 CCTCACCTGCAGAACAGGGAGGG - Intronic
948794928 2:240397628-240397650 CCTCGTCTGTAGAAAGGGGTTGG - Intergenic
1168904440 20:1392377-1392399 CCTCATCTCCAGTGAAGGGAGGG + Intronic
1169304820 20:4480290-4480312 CCTCATCTGGAGACATAGGGAGG + Intergenic
1169942370 20:10951016-10951038 CCTCTTCTACACACTGGGGATGG - Intergenic
1173147847 20:40540589-40540611 CCACAGCTGCAGACAGGGAAGGG + Intergenic
1173646120 20:44634128-44634150 CATCAGCTGCAGCCAGGGGCTGG - Intronic
1174197187 20:48781729-48781751 CCTCTTCTGAAAACAGGGAAGGG + Intronic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1175374568 20:58515331-58515353 CCTCATTTACAGACAGAGGCCGG - Intergenic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1176051145 20:63120381-63120403 TCTACTCTGCAGCCAGGGGAAGG - Intergenic
1176201792 20:63864265-63864287 CCTCATCTGTGGAGTGGGGAGGG + Intergenic
1177650106 21:23949362-23949384 TCTCATCTGCAGAATGGGCATGG + Intergenic
1179428833 21:41304552-41304574 ACTCATCCCCAGACAGGGGATGG + Intronic
1180145131 21:45914573-45914595 CCAGATCTGCAGACTGGGTATGG - Intronic
1182068722 22:27448266-27448288 CCTCATCTGCAGACTGAGCAGGG + Intergenic
1182461286 22:30485735-30485757 CCTCATCTGTAGGCTGCGGATGG + Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1183093820 22:35540720-35540742 CCTCATCTGGGGACAGGAGGAGG + Intergenic
1183396556 22:37574779-37574801 CCTCCTCTGCAGAGAGGAGGCGG - Intronic
1183548682 22:38468766-38468788 CCACACATGCAGGCAGGGGAGGG - Intronic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184094463 22:42309128-42309150 CCTCATTTGCAGAGTGGGCATGG - Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184424744 22:44402886-44402908 TCTCATCTGCACAGTGGGGATGG + Intergenic
1184568775 22:45309600-45309622 CCTCATTTGCAGAAAGGGGGCGG - Exonic
1184669825 22:46006795-46006817 CCCCATCTGCAGACAGGAGGCGG - Intergenic
1184844510 22:47072893-47072915 GCCCAGCTGCAGACAAGGGAGGG + Intronic
1185067697 22:48640336-48640358 CCTCATCGGCATGCAGGGGGCGG - Intronic
1185224855 22:49646637-49646659 CCTCATCTGTGCACACGGGACGG - Intronic
949415911 3:3814005-3814027 CTAGATGTGCAGACAGGGGAGGG - Intronic
949435028 3:4019862-4019884 CCTCATTTGCTGAAAGGGAAAGG + Intronic
949919106 3:8987526-8987548 AGCCACCTGCAGACAGGGGAGGG - Intronic
950038795 3:9906300-9906322 CCACATCTCCAGGCAGGGGAGGG + Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950869039 3:16213024-16213046 CCTCACCTGGGGCCAGGGGAGGG + Intronic
952140765 3:30476477-30476499 CCTCATTTGCAGATAAGGAATGG - Intergenic
953337115 3:42102847-42102869 CTTCCTAGGCAGACAGGGGAGGG - Intronic
953605634 3:44411449-44411471 CCTCTGCTCCAGCCAGGGGACGG + Intergenic
953861749 3:46550216-46550238 CCTCATCTGCAAATTAGGGATGG + Intronic
953993668 3:47503142-47503164 CCTCATTTGAAGGCAGGGGCTGG - Intronic
954391785 3:50271344-50271366 CCTCCCCTGCAGACAGAGCAAGG - Exonic
954447620 3:50555182-50555204 TCAAATCTGCAGACAGGGGAGGG - Intergenic
954678840 3:52330684-52330706 CCTCATCTGAGAACAGGGCACGG - Intronic
954891808 3:53937417-53937439 CCAGATCTCCAGGCAGGGGAAGG + Intergenic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
955429426 3:58827334-58827356 CCTGATCTGAACACAGGGCATGG + Intronic
957038091 3:75313385-75313407 CATCATCTCCAGACATGGAAGGG - Intergenic
958758094 3:98274425-98274447 ATTCATAGGCAGACAGGGGAAGG + Intergenic
961360634 3:126365066-126365088 CCTCCTCTGCAGGCAGAGGTGGG - Intergenic
961380723 3:126494961-126494983 CCTCATCTGCAAAGCGGAGACGG - Intronic
962117419 3:132525768-132525790 CCTCATTTTCAGACAAGGCATGG - Exonic
963233031 3:142928005-142928027 CCTTATCTGTAAACTGGGGATGG + Intergenic
963487474 3:145953454-145953476 CGTCATCTGCAGAGAGGGTTGGG - Intergenic
964809984 3:160653030-160653052 CCTCAACTTCAGACAGCAGAGGG - Intergenic
964889479 3:161518816-161518838 CCTAATATGCAGGGAGGGGAAGG - Intergenic
965309901 3:167115655-167115677 CCTCATCTTCAGACCAGGGAGGG - Intergenic
967814465 3:193787435-193787457 CCTGCTCTGCAGACAGAGGGAGG + Intergenic
967921215 3:194615843-194615865 GCTCATCTGAAGACAGGGCTAGG + Intronic
968087185 3:195879042-195879064 CCTCAACGGCAGTCAGGTGAGGG - Exonic
969046348 4:4339344-4339366 CCTCACCTCCACCCAGGGGACGG + Intergenic
969472737 4:7399248-7399270 CCTCAAATGCAGACAGAGGGTGG - Intronic
969570753 4:8006785-8006807 CCTCATCTGCAGGCAGGGCAAGG - Intronic
969639248 4:8387253-8387275 CCTCATCTGCAGCACGGGGACGG - Intronic
970511292 4:16784347-16784369 CCTCATCTGTAGACTGGGGCTGG + Intronic
974084425 4:57244332-57244354 CCTCATCTACAGAAAGAGAAGGG - Intergenic
975743373 4:77452342-77452364 GCTCCTCTGCAGAGAGGGGGAGG + Intergenic
976824559 4:89246467-89246489 TCTCTTCTGGAGACACGGGAGGG + Exonic
977574754 4:98663891-98663913 CATCCTCTGCAGAAAGAGGAAGG + Intergenic
977996300 4:103500568-103500590 CCTTATCTACAGCCATGGGAAGG - Intergenic
979145351 4:117239899-117239921 CCCCATCTTCAGACCAGGGAGGG + Intergenic
982128136 4:152202075-152202097 CATCATATGCAAACAAGGGAAGG - Intergenic
982462698 4:155690753-155690775 CCTCTGCTGCAAAAAGGGGAGGG - Intronic
983346921 4:166538646-166538668 CCTTATCTTCAGAAAGGGGATGG + Intergenic
985552804 5:541827-541849 CCTCAGCTGCAGGCAAGGGACGG + Intergenic
985999755 5:3621089-3621111 TCTCTGCTGCAGAAAGGGGAGGG - Intergenic
986230372 5:5859094-5859116 TCTCATCTGCAGACATGGACAGG - Intergenic
986683410 5:10253636-10253658 CCCCATCTGCAGACAAGGAGGGG - Intronic
987769660 5:22284398-22284420 TCTCATCTGAAGACTGAGGATGG + Intronic
989000740 5:36757624-36757646 TCTCATCTGCACTCAAGGGAAGG - Intergenic
989062275 5:37421080-37421102 CCTCACCTGTCGAAAGGGGATGG - Intronic
990391613 5:55327339-55327361 GCTCATATGCTGACAGGGAATGG - Intronic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
991127206 5:63082889-63082911 GCTCCTCTGCAGAGAGGGGGAGG - Intergenic
992712613 5:79475186-79475208 CCTCATCTTCAAAAGGGGGATGG - Intronic
997684514 5:135779315-135779337 CCTAATATGCAGGGAGGGGAAGG + Intergenic
997955564 5:138275935-138275957 CCTCCTCTCCAGAAAGGTGAGGG + Intergenic
998004848 5:138649964-138649986 CCCCATCTGCAGACAGCAGCTGG - Intronic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
998906461 5:146910548-146910570 CCTCATCTGCAAAAGGGTGATGG + Intronic
999378885 5:151106154-151106176 CATTATCTGCAGCCAGGGTAGGG - Intronic
999563447 5:152830571-152830593 CCTCAACTGCAGAATGGTGATGG - Intergenic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1000104671 5:158048080-158048102 CCTCATCTGCAAAATGGAGACGG + Intergenic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001287645 5:170435471-170435493 CCTCATCTGGAGAGCGGGGCTGG + Intronic
1001401761 5:171450460-171450482 CCTCATCTGTGGAATGGGGATGG - Intronic
1001492469 5:172165287-172165309 CCTCATCTGCAGAGTTGGGTTGG - Intronic
1001544837 5:172564632-172564654 CCTCATCTGTACAGCGGGGATGG - Intergenic
1003017293 6:2478393-2478415 CCTCCCCTGCACACAAGGGAAGG + Intergenic
1006444875 6:34074526-34074548 CCTCCTCTCCTGGCAGGGGACGG - Intronic
1006444890 6:34074591-34074613 CCTCCTCTCCTGGCAGGGGACGG - Intronic
1006449665 6:34098854-34098876 CCTTAGCTGCAGAGAGGGGGTGG + Intronic
1007732210 6:43954179-43954201 CTGCATCTGCAGACAGGGGCTGG + Intergenic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1008062492 6:47013355-47013377 CCTCATCTGTAAACTGGGGAAGG - Intronic
1008471970 6:51894395-51894417 CCTCAGCTGCAGGCTGGGCAGGG + Intronic
1010191413 6:73201028-73201050 CCTGAGCTGCAGCAAGGGGAGGG - Intergenic
1011459716 6:87590278-87590300 CCTCCTCTCCAGCCAGGGAAGGG - Intronic
1011797749 6:90975967-90975989 CCTCATCTGTCGACAGATGAGGG + Intergenic
1012634134 6:101514412-101514434 CCCCATATGGAGACAGGGAAGGG + Intronic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1015413708 6:132924042-132924064 CCTCATCTGTAGACACTGCAAGG - Intergenic
1016190769 6:141261496-141261518 GCTCCTCTGCAGAAAGGGGAGGG + Intergenic
1017233411 6:152096047-152096069 CCTCATCTGCAGGGAAGAGATGG + Intronic
1017972894 6:159328560-159328582 TTCCATCTGCAGTCAGGGGAAGG - Intergenic
1019275101 7:172108-172130 CTGCACGTGCAGACAGGGGAGGG + Intergenic
1019513130 7:1428280-1428302 CCTCATCTGCACACAGGCGGTGG - Intergenic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1020203930 7:6101203-6101225 CCACAGCAGCAGACAAGGGATGG + Intergenic
1021510785 7:21429670-21429692 CCACAACTTCAGACAGTGGAAGG + Exonic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022469006 7:30670535-30670557 GCTCATCTGCAGGCAGGGCTGGG - Intronic
1025839387 7:65130379-65130401 GCTCATCGGCAAACAGGTGAAGG - Intergenic
1025883681 7:65565586-65565608 GCTCATCGGCAAACAGGTGAAGG + Intergenic
1025889765 7:65637020-65637042 GCTCATCGGCAAACAGGTGAAGG - Intergenic
1026015714 7:66669308-66669330 CCTCCTCTGGTGACTGGGGAGGG - Intronic
1029176793 7:98670252-98670274 CCTCATCTGTAGAATGGAGAAGG + Intergenic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1032518857 7:132527409-132527431 CCTCATCTGCTCAATGGGGATGG - Intronic
1034738982 7:153455979-153456001 CCTCACCTTCTCACAGGGGATGG - Intergenic
1034851312 7:154496634-154496656 CCTCTTCAACAGAAAGGGGAAGG + Intronic
1035309371 7:157955422-157955444 TCTCATCAGCAGCCAGGGGAGGG + Intronic
1036659380 8:10698090-10698112 CCTCAGTGGCACACAGGGGAGGG + Intronic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1036978097 8:13437715-13437737 CATCATCTGCAGCCAGGTCATGG - Intronic
1037662342 8:20938850-20938872 CCTCAGCTGCAGACCAGGGCGGG - Intergenic
1037988534 8:23304580-23304602 CCTCTTCGGCAAAGAGGGGAGGG + Intronic
1044391759 8:91660669-91660691 CCTCATCTGCAGACTGAGCCAGG + Intergenic
1044703398 8:94985047-94985069 CCTCCTTTGCAGCTAGGGGATGG + Intronic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1045383025 8:101645608-101645630 CCTCATCTGTAAAAAGGAGATGG + Intronic
1046604182 8:116352362-116352384 CTTCCTCTGCTGAGAGGGGACGG - Intergenic
1046999756 8:120562267-120562289 CCTCATCTGAACAAAGGGGGCGG - Intronic
1048317661 8:133374316-133374338 CCTGCTCTGCAGGCAGGGGTGGG + Intergenic
1048809468 8:138272954-138272976 CCTCATCTGTGAACTGGGGATGG + Intronic
1048974816 8:139665285-139665307 CCTGCTTTGAAGACAGGGGAAGG - Intronic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1049385019 8:142338806-142338828 CCACGGCTGCAGACAGGGCATGG + Intronic
1049855072 8:144856629-144856651 CTTCACCTGCAGACAGTGGGTGG - Intergenic
1050018582 9:1260974-1260996 TCTTTTCTGCGGACAGGGGATGG + Intergenic
1050176974 9:2878394-2878416 CCTTATCTGGAGACAGGGTTGGG - Intergenic
1050359807 9:4819151-4819173 CCTCAACCCCAGACAGGGCAGGG + Intronic
1051411320 9:16792565-16792587 CCCCTTCTGCAGACTGGGAATGG - Intronic
1051766390 9:20528922-20528944 CCCCAACTGTAGACAGGGTAGGG + Intronic
1052495081 9:29214245-29214267 GCTCAGCTGGAGAAAGGGGAGGG + Intergenic
1053381260 9:37651083-37651105 CCTCCTCTGCAGGTAAGGGAGGG + Intronic
1054146196 9:61562792-61562814 CATCTTCTGCAGATAAGGGAGGG + Intergenic
1056820555 9:89838796-89838818 CCTCGTCTGTAGATTGGGGATGG + Intergenic
1057895240 9:98903886-98903908 CATAATCTGCGGACAGGAGACGG + Intergenic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1059543977 9:115157994-115158016 CCTCATCTGTAAAAAGGAGATGG + Intronic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1060085447 9:120695884-120695906 CCTCCCCTGCAGCCAGGGCATGG + Intronic
1060526006 9:124321721-124321743 CCTCAGCTGCAGTCTGGTGAGGG + Intronic
1060556833 9:124512350-124512372 CCTCAGCTGCAGTGTGGGGAGGG + Intergenic
1061507092 9:131037489-131037511 CCTTAGCTGCAGTTAGGGGAGGG - Intronic
1061628169 9:131854578-131854600 CCAAGTCTGCAGAAAGGGGAAGG - Intergenic
1061847824 9:133397805-133397827 CCTCATCTGTAAAGTGGGGATGG + Intronic
1062051614 9:134450209-134450231 CCTCAGCAGCAAGCAGGGGAAGG - Intergenic
1062564826 9:137159508-137159530 CCTGCTCTGCAGACAGGGTGGGG + Intronic
1186487630 X:9945955-9945977 CCTCACCTGGAGAAAGGGGAAGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186886957 X:13923292-13923314 CATCATCAGCAGACAGGGAATGG + Intronic
1187034280 X:15521631-15521653 CTGGTTCTGCAGACAGGGGAAGG - Intronic
1187370268 X:18699667-18699689 CTTCATCAGCAGAAAGGGAAAGG - Intronic
1189308116 X:40002600-40002622 CCTCTTCTACAGCCAGGAGATGG + Intergenic
1190326912 X:49212187-49212209 ACTCCTCTGCTGGCAGGGGATGG - Intronic
1190850770 X:54239005-54239027 ATTCATCTGCAGACAGGAGGTGG - Exonic
1190874945 X:54453130-54453152 CATCATCTGCAGAGAGGAAAGGG - Intronic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192554961 X:72082028-72082050 CTTCACCTAGAGACAGGGGAAGG - Intergenic
1196558155 X:117115972-117115994 CCTCTTTTGGAGACAGGGGATGG - Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1197873664 X:131083071-131083093 CCTGATCTGCAGCAGGGGGAGGG - Intronic
1199722850 X:150555015-150555037 CCTCATCTGCAAAAGAGGGATGG + Intergenic
1200392250 X:155956100-155956122 CCTCCTCTGCACTCAGGGCATGG - Intergenic
1202180210 Y:22133335-22133357 CCTCATCTGCACCCAAGAGAGGG - Intergenic
1202211150 Y:22453064-22453086 CCTCATCTGCACCCAAGAGAGGG + Intergenic