ID: 1168319414

View in Genome Browser
Species Human (GRCh38)
Location 19:55500303-55500325
Sequence GAGTATCCCTCAGGCCTCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 205}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168319407_1168319414 10 Left 1168319407 19:55500270-55500292 CCCCCAAGAAATGACCTCTGAGT 0: 1
1: 0
2: 1
3: 18
4: 235
Right 1168319414 19:55500303-55500325 GAGTATCCCTCAGGCCTCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 205
1168319406_1168319414 20 Left 1168319406 19:55500260-55500282 CCACTCAAGGCCCCCAAGAAATG 0: 1
1: 0
2: 1
3: 14
4: 137
Right 1168319414 19:55500303-55500325 GAGTATCCCTCAGGCCTCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 205
1168319409_1168319414 8 Left 1168319409 19:55500272-55500294 CCCAAGAAATGACCTCTGAGTCC 0: 1
1: 0
2: 2
3: 24
4: 188
Right 1168319414 19:55500303-55500325 GAGTATCCCTCAGGCCTCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 205
1168319408_1168319414 9 Left 1168319408 19:55500271-55500293 CCCCAAGAAATGACCTCTGAGTC 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1168319414 19:55500303-55500325 GAGTATCCCTCAGGCCTCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 205
1168319411_1168319414 -4 Left 1168319411 19:55500284-55500306 CCTCTGAGTCCACTATCAAGAGT 0: 1
1: 0
2: 1
3: 9
4: 89
Right 1168319414 19:55500303-55500325 GAGTATCCCTCAGGCCTCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 205
1168319410_1168319414 7 Left 1168319410 19:55500273-55500295 CCAAGAAATGACCTCTGAGTCCA 0: 1
1: 0
2: 1
3: 8
4: 221
Right 1168319414 19:55500303-55500325 GAGTATCCCTCAGGCCTCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168319414 Original CRISPR GAGTATCCCTCAGGCCTCCC TGG Exonic
900074405 1:801415-801437 GAGTGACCCTGAGCCCTCCCAGG - Intergenic
901037105 1:6343044-6343066 GAGGAGCCCTCAGGCTTCCCAGG + Intronic
901298867 1:8183766-8183788 GAGTTTCCCTCTTGTCTCCCAGG + Intergenic
901857215 1:12052319-12052341 CAGTAACCCTCGGGCCCCCCTGG + Intergenic
901896646 1:12319186-12319208 GAATATCTCCTAGGCCTCCCAGG + Intronic
902287787 1:15417730-15417752 CAGGAGCCCTCAGGCCCCCCTGG - Intronic
902634653 1:17727153-17727175 GGGTACCCCTCAGCACTCCCAGG - Intergenic
903355767 1:22746480-22746502 GAGGAGCCCACAGGCCTCCCTGG - Intronic
903984748 1:27218540-27218562 GAGTTTCACTCATGTCTCCCAGG + Intergenic
904613106 1:31735953-31735975 CACCATCCCTCAGTCCTCCCAGG + Intronic
905488850 1:38327910-38327932 GGGGAGCCTTCAGGCCTCCCAGG - Intergenic
906925991 1:50117377-50117399 GAGTCTGCCTCTGGCCTCCGAGG + Intronic
907192764 1:52662668-52662690 GAGTACCCCTTAGGGCTCCAAGG + Intronic
908519244 1:64925368-64925390 GAGTTTCCCTCTTGTCTCCCAGG - Intronic
910503141 1:87917847-87917869 TAATATCATTCAGGCCTCCCCGG - Intergenic
912250945 1:108011965-108011987 GAGCAGCTCTCAGGTCTCCCTGG + Intergenic
912454185 1:109786893-109786915 TTGTATCCCCCAGGGCTCCCAGG - Intergenic
919182429 1:194103571-194103593 GAGTTGCCCTCAGGCCCCCAGGG + Intergenic
919797494 1:201330091-201330113 GAGAAGCCCTCAGGCCTCGCTGG + Exonic
921197132 1:212768951-212768973 GAGGATCCCTTGAGCCTCCCAGG + Intronic
922270252 1:224026319-224026341 GAGTGACCCTGAGCCCTCCCAGG - Intergenic
922828950 1:228541014-228541036 TAGAATGCCTGAGGCCTCCCAGG + Intergenic
923630394 1:235645769-235645791 GAGTTTCCCTCTTGTCTCCCAGG - Intronic
1063215519 10:3921994-3922016 GAGTTTCACTCTGGTCTCCCAGG - Intergenic
1065507146 10:26439903-26439925 GATTTTCCCTCTGGCCTCACTGG + Intronic
1067129268 10:43546905-43546927 GAGGATCGCTCAGGCCTGGCAGG - Intergenic
1067295020 10:44970766-44970788 GAGGCTCCTTGAGGCCTCCCTGG - Intronic
1069540483 10:69290459-69290481 GTGCATCCCTCCTGCCTCCCAGG + Intronic
1069961344 10:72081064-72081086 GGGTCTTCCTCAGACCTCCCTGG - Intronic
1072741222 10:97911140-97911162 GAGAATCCCTCAGCCCTGCCCGG + Intronic
1072890221 10:99316809-99316831 GAGTATCCCTCTACCCGCCCAGG + Intergenic
1074210428 10:111327955-111327977 GAGTCTCACTCTGGTCTCCCAGG - Intergenic
1076910070 10:133383157-133383179 GAGTTTCGCTCTGGTCTCCCAGG - Intronic
1077498101 11:2896464-2896486 GAGAGTCCCTCTGGCCTCCAAGG + Intronic
1079398743 11:20088201-20088223 GAGTTTCGCTCTTGCCTCCCAGG + Intronic
1080677097 11:34438629-34438651 CAGCATCCTTCAGGCCGCCCTGG - Intergenic
1081550121 11:44103463-44103485 AAGTATGCTTCAGGCATCCCAGG - Intronic
1081585654 11:44382067-44382089 GAGTGTCCCTCAGAGCTCCTGGG - Intergenic
1082116561 11:48335930-48335952 GAGAAAAACTCAGGCCTCCCAGG + Intergenic
1082559263 11:54599687-54599709 GTGTATACCTCAGAGCTCCCGGG - Intergenic
1084065268 11:66700555-66700577 GAGCATCCCGCAGGAATCCCTGG + Exonic
1084539392 11:69776524-69776546 GAAGAGCCCTCAAGCCTCCCAGG - Intergenic
1084903339 11:72326930-72326952 AAGCACCCCTCAGCCCTCCCTGG - Intronic
1088294069 11:108273365-108273387 GAGTTTCGCTCATGTCTCCCAGG + Intronic
1088533135 11:110832099-110832121 GGGGATGCCTCAGGCCTGCCAGG + Intergenic
1088571403 11:111227406-111227428 GAGTTCTCCTCAGGGCTCCCAGG + Intergenic
1089093304 11:115896796-115896818 GTGCATCCCTCAGGCCTCTGCGG - Intergenic
1089614515 11:119687673-119687695 GAGAATTCCCCAGGCTTCCCCGG + Intronic
1089951687 11:122534230-122534252 GAGAATCCCACAGTCCTCACAGG + Intergenic
1098550309 12:71754961-71754983 GACTTTCCCTCAGCCCTTCCAGG + Exonic
1103206966 12:119137446-119137468 GAGTCTCTCTCAGCCCTCCAGGG - Intronic
1103394546 12:120597651-120597673 AAGCATCCCTCAGACCTGCCGGG + Intergenic
1103693576 12:122795840-122795862 GTGTCTGCCTCAGGTCTCCCAGG + Intronic
1104967387 12:132514362-132514384 CAGGATCTCTCTGGCCTCCCTGG + Intronic
1107173814 13:37377003-37377025 GATTATCCCTCAAGCCGACCTGG - Intergenic
1107823267 13:44305284-44305306 GAGTCTCCCTCAGGCTTGGCTGG - Intergenic
1112005181 13:95247468-95247490 GAGTTTCCCCCAGGCCACCATGG + Intronic
1113821992 13:113221265-113221287 GAGTATCCCAGAGTCCTCACAGG + Intronic
1114274065 14:21125789-21125811 GAGTTTCCCTCTTGCCACCCAGG - Intergenic
1114549624 14:23525478-23525500 GAGTTTCCCACAGGCCCCACAGG + Exonic
1117135370 14:52730194-52730216 CCGTACCCCTCAGGCCGCCCAGG - Exonic
1118204365 14:63708280-63708302 GAGTTTCCCTCTTGTCTCCCAGG + Intronic
1122152017 14:99730579-99730601 GGGCATCCCCCGGGCCTCCCCGG - Intergenic
1122299797 14:100725183-100725205 GAGTTTCCCTCCAGCCTCCTTGG + Intergenic
1122799526 14:104222745-104222767 GCCTGTCCCTCAGGCCTGCCTGG + Intergenic
1124389199 15:29238706-29238728 GAAGCTCCCTGAGGCCTCCCCGG - Intronic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1126694654 15:51315681-51315703 GACTATTCCTCATGCTTCCCTGG + Intronic
1129177363 15:73849611-73849633 GGGTGTCCCACAGGCCCCCCTGG + Intergenic
1131623593 15:94094147-94094169 TAGTATCACTCAGTCTTCCCAGG + Intergenic
1132337502 15:101057881-101057903 CAGAATCCCTCATTCCTCCCTGG + Intronic
1133191981 16:4140561-4140583 GAGGTTTCCTAAGGCCTCCCTGG + Intergenic
1133232792 16:4374367-4374389 GAGGCTCCCTCAGGCCACCTCGG + Intronic
1133920328 16:10147016-10147038 GCTTTTCCCTCAGGCCACCCAGG + Intronic
1134812013 16:17175750-17175772 GAATGTCCCTCTGGCCTGCCAGG + Intronic
1136104353 16:28018830-28018852 GAGCATCCCTCAAGCCTCTATGG - Intronic
1139896649 16:70293052-70293074 GAGTTTCCCTCTTGTCTCCCAGG - Intronic
1141192919 16:81837506-81837528 GAGCATCCCTTACTCCTCCCAGG - Intronic
1142420749 16:89967990-89968012 GGGCATCCCTCAGGCCAGCCTGG - Exonic
1142740190 17:1927370-1927392 GAGCATCCCTCTGGCCTCACAGG - Intergenic
1143015106 17:3887510-3887532 GAGTATCAGGGAGGCCTCCCTGG + Intronic
1144709278 17:17389809-17389831 GAGTATTCCCCAGCCCTTCCTGG - Intergenic
1147059100 17:37859931-37859953 GAGTCTCACTCTGGCCACCCAGG + Intergenic
1147927104 17:43952935-43952957 GAGGACCCCTGAGGCCTCCTGGG - Exonic
1149498918 17:57136547-57136569 TGGTATTCCTCAGGCCGCCCTGG - Intergenic
1150189674 17:63224757-63224779 GAGTGTCCATTAGGCCTCCAGGG + Intronic
1152238710 17:79151209-79151231 GTGTTCCCCTCAGCCCTCCCAGG - Intronic
1152243160 17:79170584-79170606 GTGTGTCCGTTAGGCCTCCCAGG + Intronic
1152551351 17:81031977-81031999 GAGGATCCCCCAGCCCGCCCAGG + Intergenic
1154173617 18:12067807-12067829 CAGCCTCCCGCAGGCCTCCCCGG - Intergenic
1156723437 18:40098610-40098632 GATTATACTTCAGGACTCCCTGG + Intergenic
1157506815 18:48232115-48232137 GAGTTTTGCTCAGGCCTCCTGGG - Intronic
1158204369 18:54975380-54975402 CAGTATCCCCAAGTCCTCCCTGG + Intergenic
1159552541 18:69910482-69910504 TAGTATTCCTCAGGCCTCACAGG + Intronic
1160789400 19:916662-916684 GAGTTTCGCTCAGGTCGCCCAGG - Intergenic
1161462710 19:4408216-4408238 GAGTTTCGCTCAGGTCGCCCAGG + Intronic
1162404824 19:10467451-10467473 GAGCATGCCCCGGGCCTCCCGGG + Exonic
1163634481 19:18431790-18431812 CAGCCTCCCGCAGGCCTCCCTGG + Exonic
1163714928 19:18868024-18868046 GAGCGTCCCTCAGGCCGCCGCGG - Exonic
1165114030 19:33518279-33518301 GAGTATCCCTGTGCCTTCCCTGG - Intronic
1168319414 19:55500303-55500325 GAGTATCCCTCAGGCCTCCCTGG + Exonic
925196301 2:1928902-1928924 GCAGATCCCTCAGGCTTCCCAGG - Intronic
925246492 2:2388276-2388298 GAAGATTCCTGAGGCCTCCCTGG - Intergenic
925475215 2:4205961-4205983 GAGGATCACTCAGGGCTCTCAGG - Intergenic
925615644 2:5742305-5742327 GAGTCCCTCTCAGGCTTCCCTGG - Intergenic
925861328 2:8179169-8179191 GAGTTTCACTCCGGTCTCCCAGG - Intergenic
926037137 2:9644719-9644741 GAGTATCCAGCAGGCCTTGCAGG + Intergenic
926631119 2:15137047-15137069 GAGTGTCCCTCAGGCCTCTTTGG - Intergenic
927079345 2:19612354-19612376 GATTCTACCTCAGGCCTACCTGG - Intergenic
927928563 2:27029408-27029430 GAGTCTAACTCAGGTCTCCCTGG - Intergenic
929881743 2:45842823-45842845 GGGTATGCATCAGTCCTCCCAGG + Intronic
934579676 2:95427949-95427971 GAGAAACACTCAGGCTTCCCAGG + Intergenic
934599770 2:95648776-95648798 GAGAAACACTCAGGCTTCCCAGG - Intergenic
934747734 2:96770576-96770598 GGGTGTGGCTCAGGCCTCCCGGG + Intronic
934751161 2:96795099-96795121 GAGTATCCCTTATTCCTCACTGG - Intronic
934970569 2:98760599-98760621 GAGTTTCCCTCTTGTCTCCCAGG + Intergenic
935219854 2:101002811-101002833 GAGTATCCCTCTAGCCGCCCTGG + Intronic
935363061 2:102264000-102264022 GAGTATCAGTGGGGCCTCCCAGG - Intergenic
936533114 2:113290781-113290803 GAGAAACACTCAGGCTTCCCAGG - Intergenic
942350617 2:175049359-175049381 GAGAGTCCCTCAGTCCTCACAGG - Intergenic
942763908 2:179431528-179431550 GAGCATCCCTCAGGCTGCTCTGG + Intergenic
943640459 2:190352507-190352529 CAGTTTCCCTCTGGCCTCACAGG + Intronic
947612825 2:231534146-231534168 GTGTGTCCCTCATGCCACCCTGG + Intergenic
948100740 2:235370808-235370830 GATTAGCCCTCATGCCTCCCAGG - Intergenic
948337134 2:237218237-237218259 GCCTATCCACCAGGCCTCCCTGG - Intergenic
948449462 2:238060488-238060510 GGGTCTCCCGCAGGCCACCCTGG - Intronic
1171878007 20:30596379-30596401 GACTAACCCTCAGGCCACCATGG + Intergenic
1173521754 20:43705151-43705173 GAGTATCCCTGAGACCTCAGGGG - Intronic
1176296206 21:5074878-5074900 CAGTTGCCCTCAGGCCACCCAGG - Intergenic
1177262560 21:18749847-18749869 GAGTGGCCCTCAGCCCTCCTTGG - Intergenic
1178014571 21:28329141-28329163 CAGTCTCCCACAGGTCTCCCAGG - Intergenic
1178473486 21:32916462-32916484 GAGTCTCACTCAGGCATCTCTGG - Intergenic
1179860843 21:44187243-44187265 CAGTTGCCCTCAGGCCACCCAGG + Intergenic
1179910647 21:44445975-44445997 GAGTTTCCCTCTTGTCTCCCAGG - Intergenic
1180740316 22:18049002-18049024 GAGGCCCCCTCAGGCCTCCTTGG - Intergenic
1181099708 22:20531117-20531139 CAGCTTGCCTCAGGCCTCCCTGG + Intronic
1181382683 22:22519405-22519427 GAGTTTCACTCTGGCCGCCCAGG - Intronic
1183345390 22:37304576-37304598 GAGTATACCTCCTGCCTCCAAGG + Intronic
1183478041 22:38046680-38046702 GAGGCTCCCCCAGGCCTCCGAGG - Intergenic
1185292165 22:50032588-50032610 GCGTGACTCTCAGGCCTCCCTGG + Intronic
950240712 3:11367563-11367585 AAGTAATCCTCAGGCCTCCTAGG - Intronic
950678587 3:14569444-14569466 CTGTATCCCCTAGGCCTCCCTGG - Intergenic
952533241 3:34283885-34283907 GCATATCCCTCAGGCGTCACTGG + Intergenic
954142637 3:48617177-48617199 AAGTATCCCTCAGGAAGCCCAGG - Intergenic
954224269 3:49172401-49172423 GAGAATCCTTCATGCCTCCATGG + Intronic
954323534 3:49848357-49848379 GAGTACCCATCAGGCCTTGCGGG - Intronic
955503408 3:59607232-59607254 CTGCATCTCTCAGGCCTCCCAGG + Intergenic
956584981 3:70854676-70854698 TTGCATCCCTCAGCCCTCCCAGG + Intergenic
960270070 3:115663832-115663854 GATTTTTCCTCAAGCCTCCCAGG - Exonic
960753658 3:120983631-120983653 AAGAGTCCCTCAGTCCTCCCAGG - Intronic
961041154 3:123679407-123679429 GGGTATCTCTCAGGCCCCCAGGG + Intronic
961694984 3:128698379-128698401 GGGTCTCCCACAGGCCTCCCGGG + Intergenic
962901446 3:139765454-139765476 GACTACCCCATAGGCCTCCCTGG + Intergenic
964396516 3:156251538-156251560 GAGTAACTGTCAGGGCTCCCAGG + Intronic
966808284 3:183823082-183823104 GAGGATCCCTCAAGCCTGCGAGG - Intronic
968085725 3:195873107-195873129 GAGGCTCCCGCAGGCCTTCCGGG - Intronic
968423485 4:504902-504924 GACTATCCCAGTGGCCTCCCTGG + Intronic
970164209 4:13219246-13219268 GAGTATGCCACAGGCATCTCAGG - Intergenic
971055822 4:22911085-22911107 GTTTTCCCCTCAGGCCTCCCTGG - Intergenic
971948844 4:33316692-33316714 GAGCTTCACTCAGGCCTGCCAGG + Intergenic
972109593 4:35541342-35541364 GCCAATCCCCCAGGCCTCCCTGG + Intergenic
972664133 4:41147514-41147536 GAGTTTCCCTCTTGTCTCCCAGG + Intronic
976428660 4:84936682-84936704 GAGTCCTCCTAAGGCCTCCCAGG + Intronic
977388787 4:96381673-96381695 CAGTCTCCCACAGGGCTCCCAGG - Intergenic
979277846 4:118833119-118833141 GAGTAACTCTCAGGGCTCACTGG - Intronic
980231981 4:130057172-130057194 CAGTATCCCATAGCCCTCCCAGG + Intergenic
980363163 4:131764610-131764632 GAGTCTCCCGCAGGCCCCTCTGG + Intergenic
981031498 4:140129937-140129959 GAGTTTCGCTCAGGTCACCCAGG - Intronic
985675976 5:1231532-1231554 GAGCAGCCCTCAAGCCGCCCTGG + Intronic
986541002 5:8843629-8843651 GAGAACCCCTTTGGCCTCCCTGG + Intergenic
986684043 5:10260137-10260159 CTGTCTCCATCAGGCCTCCCAGG - Intronic
993201892 5:84827683-84827705 GAACATACCTCAGGCCTCCTTGG + Intergenic
999174703 5:149623902-149623924 GAGTATCACTCAGAACTCCTTGG + Intronic
999224392 5:150008705-150008727 GAGTATCATTCAGGCCTTCCAGG + Intronic
999363940 5:151009086-151009108 GAGTATCTGTCATGCCTGCCAGG - Intergenic
999369585 5:151045812-151045834 GAGGATCCCTCTTACCTCCCGGG - Intronic
1000250221 5:159487411-159487433 GGGTATCTCTCAGACCTCCTGGG + Intergenic
1007398274 6:41589594-41589616 GAGCATTGCTGAGGCCTCCCTGG + Intronic
1013165391 6:107585850-107585872 GAGTGTCACTCAGAGCTCCCTGG - Intronic
1016735318 6:147472322-147472344 GAGTTTCACTCTTGCCTCCCAGG + Intergenic
1018609466 6:165633651-165633673 GAGTCTCACTCAGGTCACCCAGG + Intronic
1018899462 6:168043933-168043955 GTGGCTCCCTCAGGCCCCCCTGG - Intronic
1019893901 7:3968029-3968051 GAGAGTGCCTCAGGCCTCCTCGG + Intronic
1020262735 7:6539732-6539754 GAGTGGCCCGCAGGCCTCTCGGG + Exonic
1020265254 7:6556269-6556291 AAGTATTCCCCAGGCCTCCTGGG - Intergenic
1020786514 7:12579886-12579908 GAGTTTCACTCATGTCTCCCAGG - Intronic
1021958717 7:25852322-25852344 GAGCAGCCTTCAGGCCGCCCCGG + Intergenic
1023733861 7:43217976-43217998 GTGGACCCCACAGGCCTCCCTGG - Intronic
1023734675 7:43224398-43224420 GAGTGTCCCCCTGGGCTCCCAGG - Intronic
1026346835 7:69481920-69481942 GAGTTTCGCTCTTGCCTCCCAGG + Intergenic
1029381913 7:100220423-100220445 GAGGCTCCCACAGGCCTCCCAGG - Exonic
1029402077 7:100352873-100352895 GAGGCTCCCACAGGCCTCCCAGG - Exonic
1032391197 7:131556446-131556468 GAGCCACCCACAGGCCTCCCCGG - Exonic
1032439649 7:131932669-131932691 GAGTGTCCCTCAGGCCCTCTTGG + Intergenic
1032741419 7:134743069-134743091 GGAAATCCCTAAGGCCTCCCAGG - Intergenic
1033817806 7:145096447-145096469 CAGTATCCCTGAGGCCCCTCTGG - Intergenic
1035094854 7:156345932-156345954 GAGGAGCCTGCAGGCCTCCCTGG + Intergenic
1035541237 8:440064-440086 GAGTGACCCTGAGCCCTCCCAGG + Intronic
1041075943 8:54169865-54169887 GAGTCTCACTCATGTCTCCCAGG - Intergenic
1041778412 8:61550615-61550637 GTGTGTCTCTCAGGCCTCACTGG - Intronic
1047889692 8:129293981-129294003 GAGTCTCGCTCTGTCCTCCCAGG - Intergenic
1048926776 8:139278441-139278463 GAATATCCCCCAGGCCTTCAAGG - Intergenic
1049454599 8:142680609-142680631 AGGTATCCCTCTGGCCTCCCCGG - Intronic
1049749093 8:144275124-144275146 GTGTCTCCCCCAGGCCCCCCGGG + Intronic
1053559567 9:39175754-39175776 GAGTCTCCCTCTTGTCTCCCAGG - Intronic
1054137548 9:61443189-61443211 GAGTCTCCCTCTTGTCTCCCAGG + Intergenic
1055635650 9:78275577-78275599 GAGTTTCCCTCTTGTCTCCCAGG - Intronic
1056506198 9:87260334-87260356 GAGGACCCATCAGGCCTCCAAGG + Intergenic
1056800458 9:89687187-89687209 CAGTTTTCCACAGGCCTCCCTGG - Intergenic
1058482171 9:105407118-105407140 GGGTATCCCACAGGTCTCCTAGG - Intronic
1058561512 9:106233612-106233634 CAGTATCCTTCAGCCCTCCATGG - Intergenic
1058660160 9:107258992-107259014 GAGTCTCCCTCTTGTCTCCCAGG + Intergenic
1060150670 9:121286239-121286261 GACTTTCCCTCGGGTCTCCCTGG - Intronic
1060846716 9:126843077-126843099 GAGTCTCCCTCTGTCCCCCCAGG + Intergenic
1061447556 9:130649365-130649387 GAGTCTCGCTCAGTCCACCCAGG - Intergenic
1062452143 9:136620293-136620315 GACCCTCCCTCAGGACTCCCGGG + Intergenic
1186125204 X:6405827-6405849 GAGTCTCCCTCATGTCGCCCAGG - Intergenic
1189518490 X:41740906-41740928 GAGTTTCCCTCTTGTCTCCCAGG + Intronic
1190153964 X:47972843-47972865 AAAGCTCCCTCAGGCCTCCCTGG - Intronic
1191246008 X:58228817-58228839 TAGAATGCCTGAGGCCTCCCAGG - Intergenic