ID: 1168319983

View in Genome Browser
Species Human (GRCh38)
Location 19:55503454-55503476
Sequence GAGAGCACGCGGGAGACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168319983_1168319986 5 Left 1168319983 19:55503454-55503476 CCTGCAGTCTCCCGCGTGCTCTC 0: 1
1: 0
2: 1
3: 14
4: 140
Right 1168319986 19:55503482-55503504 TCTCCCCCTCGTTTCTCTCATGG 0: 1
1: 0
2: 0
3: 20
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168319983 Original CRISPR GAGAGCACGCGGGAGACTGC AGG (reversed) Intronic
900309410 1:2026169-2026191 GAAAGCAAGCGGGTGGCTGCTGG - Intronic
900990221 1:6095263-6095285 GTGAGCAGGCGGGAGGCTGCCGG - Intronic
902509535 1:16958673-16958695 GAGAGCAGGCGGGAGACCCTGGG + Exonic
902808942 1:18877496-18877518 GCGAGCACGCGGAACACTTCTGG + Exonic
902894800 1:19471988-19472010 GAGAGCACGTAGGAGAATCCTGG - Intronic
903168041 1:21534715-21534737 GAGGGCACGAGGGAGACAGGAGG + Intronic
903550783 1:24156360-24156382 GAGAGCACCCAGGACACAGCAGG + Exonic
904028364 1:27519203-27519225 GAGGGAACGCGGGAGACTAGAGG + Intergenic
904859131 1:33521571-33521593 GAGAGCAGGTGGGAGGCTGCTGG + Intronic
905533730 1:38702282-38702304 GGGAGCAGGAGGGAGACTGTGGG - Intergenic
906345237 1:45010674-45010696 CAGAGCACCTGGGCGACTGCGGG - Exonic
910473541 1:87580870-87580892 GAGAGCACAGGGGAAATTGCGGG - Intergenic
911842717 1:102704642-102704664 GAGAGCCCTCGGGAGGCTGCTGG + Intergenic
912560283 1:110546627-110546649 GTGAGCAAGGGGGAGAGTGCTGG - Intergenic
916033018 1:160894926-160894948 GAGCGGCCGCGGGAGACTGGGGG - Intergenic
919345649 1:196373947-196373969 GAGAGCACATGGGAAAGTGCAGG + Intronic
922597411 1:226824542-226824564 GGGAGCACGTGGGAGACGGATGG - Intergenic
922861662 1:228823135-228823157 GAGAGCCCCTGGGAGACTACTGG + Intergenic
924629528 1:245723968-245723990 GGGAGCAGGCTGGAGATTGCCGG + Intergenic
1066435932 10:35396782-35396804 GAGAGCACGAAGAGGACTGCAGG - Intronic
1067416547 10:46106956-46106978 GAGAGGACCTGGGAGAATGCGGG - Intergenic
1067728209 10:48789608-48789630 GTGAGCACGTGGGACACTGGTGG + Intronic
1069082573 10:64104077-64104099 AAGAGCACACGAGAGACAGCAGG - Intergenic
1069549423 10:69352437-69352459 GAGAGAACAAGGGAGAATGCTGG - Intronic
1075054431 10:119207267-119207289 GGGGGCAAGCGGGAGCCTGCGGG + Intergenic
1077196152 11:1281422-1281444 GAGTGCAAGCTGGAGACTGAGGG - Intronic
1077997958 11:7470068-7470090 GAGAGCAACCATGAGACTGCAGG - Intergenic
1078895165 11:15591391-15591413 GAGAGGACGGGGGAGGCTGGTGG + Intergenic
1080032895 11:27680628-27680650 GATAGCACACAGTAGACTGCTGG - Intronic
1080963767 11:37190437-37190459 GAGGTCCCCCGGGAGACTGCTGG + Intergenic
1081491816 11:43575297-43575319 GAGAGCAGGAGGGAGAGAGCGGG + Intronic
1082881712 11:58044471-58044493 GAGAGTGCTGGGGAGACTGCAGG + Intronic
1083207372 11:61160960-61160982 GAGGGCACGCGGGAGACGAGTGG - Intronic
1083440208 11:62671341-62671363 GAAAACGCGCGGGTGACTGCAGG + Exonic
1083941636 11:65899490-65899512 GGGGGCACCCGGGAGGCTGCAGG - Intronic
1084215652 11:67645619-67645641 GAGGGCAGGCGGGACAATGCTGG - Intronic
1085325435 11:75602743-75602765 GAGAGCCCCAGGAAGACTGCAGG + Intronic
1089433199 11:118438565-118438587 CAGAGCACGCAGGAAACGGCTGG - Intronic
1090422852 11:126587507-126587529 GAGAGCACAGTGAAGACTGCAGG - Intronic
1090452179 11:126816621-126816643 GTGAGCACGTGGGAGATTCCTGG - Intronic
1096735365 12:53649185-53649207 GAGAGCCCCCGGGAGGCCGCTGG + Intronic
1096766295 12:53893021-53893043 GAGAGTATGGGGGAGAGTGCAGG - Intergenic
1097104302 12:56612063-56612085 GAAACCACTAGGGAGACTGCTGG + Exonic
1097657135 12:62379457-62379479 GAGAGCACTCTGGATACTACTGG + Intronic
1101032993 12:100678200-100678222 GAGAGCAAGCGGGAGCCTGGAGG - Intergenic
1101526178 12:105533189-105533211 CAGAGAACTGGGGAGACTGCTGG + Intergenic
1106036945 13:26051840-26051862 GAGAGCCGGCCGGAGGCTGCCGG - Intergenic
1107885621 13:44872265-44872287 GAGAGCTAGAGGCAGACTGCTGG + Intergenic
1113791508 13:113031296-113031318 GAGAGCACGAGGGAGGCAGAGGG + Intronic
1115707178 14:36011320-36011342 GAGAGCATGCTGGAGAGTGGAGG - Intergenic
1119393211 14:74305381-74305403 GTGAGCAAGCGGGAGGCTACTGG + Intronic
1120881236 14:89416830-89416852 GAGCCCACGCGGGAGCCGGCAGG + Intronic
1125508753 15:40281933-40281955 GAGAGGCCGCGGGAGGCGGCGGG + Exonic
1133009853 16:2904979-2905001 GAGAGGACGCGGGCGGCTGCAGG + Intergenic
1136477344 16:30521733-30521755 GAGGGCACACGGCAGAATGCAGG - Exonic
1137632674 16:49957980-49958002 GAGAGCTCCCCGGAGACAGCGGG - Intergenic
1138528120 16:57620492-57620514 GAAAGCAGGCAGGAGACTTCAGG - Intronic
1138999363 16:62490472-62490494 GAGAGCCCCCAGGAGGCTGCTGG - Intergenic
1139144348 16:64306776-64306798 GAGAGCAAGCTGGAGAGTGAGGG + Intergenic
1147256916 17:39186957-39186979 AAGAGCAAGAGGGAAACTGCAGG + Intronic
1152013833 17:77736552-77736574 CAAAGCACGCGGCAGCCTGCTGG - Intergenic
1153988000 18:10369721-10369743 GTGAGCACTGGGGAGACTGCTGG + Intergenic
1158579671 18:58671059-58671081 GAGCGCTCGCCGGGGACTGCGGG + Intergenic
1164755608 19:30686642-30686664 GACAGCCCGCGGGAGCCGGCGGG - Intronic
1165143246 19:33715283-33715305 GAGATCATGCTGGAGACAGCAGG - Intronic
1168076456 19:53982946-53982968 GTGAGCGCGCTGGAGACTGCTGG + Exonic
1168319983 19:55503454-55503476 GAGAGCACGCGGGAGACTGCAGG - Intronic
1168353716 19:55689918-55689940 GAGAGCAAGAGGGAGACTGGGGG + Exonic
1168670621 19:58238518-58238540 GAGAGCACGCAGGAGGCGTCAGG + Intronic
926065800 2:9838841-9838863 GAGAGCACGTGGGACAGCGCAGG - Intergenic
926410675 2:12598987-12599009 GAGAGTACAGGGGAGACTCCAGG - Intergenic
927285831 2:21355958-21355980 GAGAGAACCCAGGAGACTACAGG + Intergenic
929690554 2:44068977-44068999 GAGAACAAGCTGGAAACTGCTGG + Intergenic
935160454 2:100525321-100525343 GACAGCAAGCGGGACTCTGCTGG + Intergenic
936969941 2:118167782-118167804 GAGAGCACGGAGGAGATTTCTGG + Intergenic
937941362 2:127288586-127288608 GAGAGAAAGCGGGAGGCAGCTGG + Intronic
1169224194 20:3846348-3846370 GGGAGCGGGCGGGGGACTGCTGG - Intergenic
1171543998 20:25987072-25987094 GAGAGCTCGAGGGCGCCTGCTGG - Intergenic
1172588973 20:36104487-36104509 GAGAGTAAGAGAGAGACTGCCGG + Intronic
1174296607 20:49549849-49549871 AAGAGCAAGAGGGAGACTGAAGG + Intronic
1175636858 20:60591662-60591684 GAGAGCAGGCTGGGGGCTGCAGG + Intergenic
1176113850 20:63422594-63422616 GAGGACACGCGGGAGCCTCCGGG - Intronic
1178096173 21:29218063-29218085 CAGAGCACTGGGGAGACTGGAGG - Intronic
1178832891 21:36071128-36071150 GAGAGGAAGCAGGAGCCTGCAGG - Intronic
1179501306 21:41810701-41810723 GGGCGCACGCGGCAGGCTGCCGG - Intronic
1179999419 21:44988319-44988341 GAGAGCACGGGCGAGACTGCGGG - Intergenic
1180102600 21:45596112-45596134 GAGGGCCTGCGGGAGCCTGCTGG - Intergenic
1180190418 21:46160204-46160226 CAGAGCTCGATGGAGACTGCTGG - Intergenic
1184429978 22:44437016-44437038 GAGAGCATGCTGGAGGCTACAGG + Intergenic
1184711247 22:46250636-46250658 GAGGGCAGGTGGGAGACTGGAGG - Exonic
1184893941 22:47396293-47396315 GAGTGCACGAGCGCGACTGCAGG - Intergenic
949750918 3:7351801-7351823 GAGAGCCCCTGGGAGTCTGCTGG - Intronic
950566184 3:13771028-13771050 GTGAGCAGGAGGGAGACTGGAGG - Intergenic
954713036 3:52514330-52514352 GAGAGAACCCAGGGGACTGCAGG - Intronic
955396829 3:58563539-58563561 GTGAGCAAGTGGGAGAGTGCAGG + Intergenic
955433264 3:58871894-58871916 GAGAGCATGGGGGATTCTGCTGG - Intronic
956326565 3:68059549-68059571 GAGAGCAAGAGGGGGAATGCTGG + Intronic
961317816 3:126052483-126052505 GAGAGCAGGAGGAAGGCTGCTGG - Intronic
961908120 3:130283914-130283936 AAAAGCAGGTGGGAGACTGCTGG + Intergenic
962202887 3:133415139-133415161 GAGAGGACGGGGGAGAGGGCAGG - Intronic
962733900 3:138306949-138306971 GAGAGCACGTGGCAGACAGCAGG - Intronic
965677383 3:171212235-171212257 GACAGCACACGAGAGACTGCAGG - Intronic
968489989 4:884791-884813 CAGAGCAGGCCGGAGGCTGCGGG + Intronic
969406935 4:6999700-6999722 GAGAGCACACAGGAGTTTGCTGG - Intronic
969494084 4:7515961-7515983 GAGAGCACCCTTGAGACTTCTGG - Intronic
969619686 4:8272845-8272867 GAGTGCAGGTGGGAGGCTGCTGG + Intronic
973274218 4:48291746-48291768 GAGAGCAAGAGGGAGACCGTGGG - Intergenic
979786573 4:124722348-124722370 GAGAGCAAGAGGAAGACTGAGGG - Intergenic
986152427 5:5140096-5140118 GAGGGAAGGCGGGAGACAGCGGG - Intergenic
987661966 5:20889309-20889331 GAGAGCCCGCAGAAAACTGCTGG + Intergenic
988761618 5:34316006-34316028 GAGAGCCCGCAGAAAACTGCTGG - Intergenic
988791895 5:34616115-34616137 GAGAGAGGGAGGGAGACTGCTGG + Intergenic
991009701 5:61870268-61870290 GAGAGGAGGAGGGAGGCTGCTGG - Intergenic
999696033 5:154189905-154189927 AAAAGCACGCGTGAGAATGCAGG + Intronic
1002581449 5:180211623-180211645 GAGAGGACGCAGGAGACCTCAGG - Intergenic
1002632228 5:180589982-180590004 GAGAGGCCGCGAGAGTCTGCAGG - Intergenic
1006789980 6:36693550-36693572 GGGAGCACGCGGGAGAGGGAAGG - Intergenic
1007406438 6:41638543-41638565 GCGAGCACCCGGGAGCCAGCGGG + Exonic
1007815870 6:44525291-44525313 GAGACCAGGGAGGAGACTGCAGG - Intergenic
1010597162 6:77778116-77778138 GAGAGCAGGCAAGAGAGTGCGGG + Intronic
1012170983 6:96016213-96016235 GTGAGTAGGCGGGAGAGTGCAGG + Intronic
1014342719 6:120229242-120229264 GAGAGCACAGGTGTGACTGCAGG + Intergenic
1015002223 6:128232038-128232060 TAGACCACGGTGGAGACTGCTGG - Intronic
1018188291 6:161286924-161286946 GGGAGCACCCAGGAGGCTGCGGG + Intergenic
1019127752 6:169852264-169852286 GAGAGCCGGCGGGAGGCAGCCGG - Intergenic
1019173672 6:170148931-170148953 AAGACCACGTGGGGGACTGCAGG - Intergenic
1020497592 7:8876005-8876027 GTGACCACGGGGCAGACTGCTGG + Intergenic
1022482081 7:30751023-30751045 CAGAGCAGGCAGGAAACTGCAGG - Intronic
1022532112 7:31073646-31073668 GAGAGGAGGTGGGAGCCTGCTGG + Intronic
1025295374 7:57772151-57772173 GAGAGCTCGAGGGTGCCTGCTGG - Intergenic
1026165313 7:67904078-67904100 GAGAGTCCCTGGGAGACTGCCGG + Intergenic
1026447136 7:70494659-70494681 GAGAACAGACTGGAGACTGCTGG + Intronic
1033291775 7:140091238-140091260 GAGAGCACCTGGAAGACTACGGG + Intronic
1035041520 7:155931619-155931641 GAGAGCTGGCAGGGGACTGCTGG - Intergenic
1035271002 7:157719770-157719792 GAAAGTACGCGGGCAACTGCGGG - Intronic
1036678126 8:10851738-10851760 CAGAACACGCGGGAGAAGGCAGG + Intergenic
1040301433 8:46189993-46190015 GAGAGAAGGCGCAAGACTGCAGG + Intergenic
1041749179 8:61240262-61240284 GAGAGCACGGGGGAGAACGGAGG - Intronic
1041783871 8:61609356-61609378 GAGACCACGCGGGAGGCAGCAGG - Intronic
1047744800 8:127836875-127836897 GAGAGCAGGTGGGGGACTCCCGG - Intergenic
1047904060 8:129453952-129453974 GAGAGTACAAGGGAGACTGATGG - Intergenic
1048016512 8:130501956-130501978 GAGAGCCCCCAGGAGACTGCTGG + Intergenic
1048968567 8:139631053-139631075 GCGGGCACTCGGGCGACTGCAGG + Intronic
1050959023 9:11703674-11703696 GAGAGCACGTGTGAGAGTGCAGG - Intergenic
1051982514 9:23039973-23039995 GAGAGCACTGGAGAGACTGCAGG + Intergenic
1058765604 9:108180102-108180124 GAGAGCCCCCAGGAGGCTGCTGG - Intergenic
1061659939 9:132122850-132122872 GAGGGCACCCTGAAGACTGCGGG - Intergenic
1062159099 9:135069864-135069886 GAGAGCACAGGAGAGACTTCTGG + Intergenic
1062712967 9:137986704-137986726 GAGGCCACGCTGGAGCCTGCAGG + Intronic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1198388021 X:136147324-136147346 GCGCGCGCGCGGGAGACGGCCGG - Intergenic
1200044659 X:153394971-153394993 GAGAGCACCCGGGCTCCTGCAGG + Intergenic
1200066549 X:153506795-153506817 GAGGGCACAGGGGAGAATGCAGG - Intronic
1200240494 X:154490636-154490658 CCGAGCTCGCGGGCGACTGCCGG - Exonic
1200792381 Y:7311163-7311185 GATATCACGTGGGAGACTGGAGG + Intergenic