ID: 1168323091

View in Genome Browser
Species Human (GRCh38)
Location 19:55521845-55521867
Sequence CAGAGCTGGCAGAAGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168323091_1168323100 26 Left 1168323091 19:55521845-55521867 CCTGCCACCTTCTGCCAGCTCTG No data
Right 1168323100 19:55521894-55521916 CACTCTATCCCTGCTTGGCCAGG No data
1168323091_1168323099 21 Left 1168323091 19:55521845-55521867 CCTGCCACCTTCTGCCAGCTCTG No data
Right 1168323099 19:55521889-55521911 CCAGTCACTCTATCCCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168323091 Original CRISPR CAGAGCTGGCAGAAGGTGGC AGG (reversed) Intergenic
No off target data available for this crispr