ID: 1168324833

View in Genome Browser
Species Human (GRCh38)
Location 19:55533007-55533029
Sequence CTCACAAGGCCGTGTGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 52}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168324826_1168324833 -4 Left 1168324826 19:55532988-55533010 CCAGGGTGCAACCTTCCCCCTCA 0: 1
1: 0
2: 2
3: 16
4: 189
Right 1168324833 19:55533007-55533029 CTCACAAGGCCGTGTGTAACTGG 0: 1
1: 0
2: 1
3: 7
4: 52
1168324825_1168324833 6 Left 1168324825 19:55532978-55533000 CCATCAGCTGCCAGGGTGCAACC 0: 1
1: 0
2: 1
3: 10
4: 204
Right 1168324833 19:55533007-55533029 CTCACAAGGCCGTGTGTAACTGG 0: 1
1: 0
2: 1
3: 7
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168324833 Original CRISPR CTCACAAGGCCGTGTGTAAC TGG Intronic
900729015 1:4239588-4239610 CTCACGTGGCCGTGTGTATGGGG + Intergenic
901488017 1:9578824-9578846 GTCACAAGGCCGTGAGACACAGG - Intronic
905485882 1:38296241-38296263 CTCACAAAGCCCTGCGGAACAGG + Intergenic
910095795 1:83520102-83520124 CACACAAGGGCATGTGTACCAGG + Intergenic
918373472 1:183884493-183884515 TTGACAAGGCAGTGTGGAACAGG + Intronic
922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG + Intronic
1063934766 10:11066107-11066129 CTGACAAGGCCCTGTGTGGCTGG - Intronic
1066376159 10:34859331-34859353 CTTCCAAGGCCCTGTGTATCTGG - Intergenic
1070280195 10:75043193-75043215 CTCACGAGGCTGAGTGTAACTGG + Intronic
1075556058 10:123433609-123433631 CACACGAGGCCGTCTTTAACAGG + Intergenic
1075668729 10:124248665-124248687 CTCACAAGGACGTGTGTCACTGG - Intergenic
1081199516 11:40199415-40199437 CCCACAAGGCCTTATGTAATTGG - Intronic
1085362630 11:75904732-75904754 CTCACAAACCCCTGTGAAACAGG - Intronic
1087712936 11:101575127-101575149 CTCACATGACAGTGTGAAACTGG - Intronic
1095989921 12:48027528-48027550 CTAACAAAGCCATGTGTCACTGG - Intergenic
1096185745 12:49579491-49579513 CCTACAAGGCCTTGTGTGACCGG + Intronic
1097232662 12:57522131-57522153 GTCACAAGGCCGGTTGTGACTGG + Intronic
1098281279 12:68865314-68865336 CTCACAGGGCTATGTCTAACTGG - Intronic
1100502298 12:95185505-95185527 CACTCATGGCTGTGTGTAACTGG + Intronic
1103279190 12:119741022-119741044 CACCAAAGGCCTTGTGTAACGGG + Intronic
1109210462 13:59529488-59529510 CTCACAGGGCCATGTGTGAAAGG + Intergenic
1123789999 15:23710711-23710733 GTCAGGAGGCCCTGTGTAACTGG - Intergenic
1139514028 16:67442920-67442942 GGCACAAGGCTGTGTGGAACAGG - Intronic
1142912765 17:3110068-3110090 CTCACAAGGCCTTGAGGAGCAGG + Intergenic
1150145110 17:62762265-62762287 CTCACAATCCCGTAGGTAACAGG - Intronic
1152255054 17:79234149-79234171 CACAGTGGGCCGTGTGTAACAGG - Intronic
1168324833 19:55533007-55533029 CTCACAAGGCCGTGTGTAACTGG + Intronic
926630249 2:15129244-15129266 CCGACAAGGCCATGTGCAACAGG - Intergenic
937929560 2:127193535-127193557 CTCCCCAGGCCGTGTGGAAGTGG - Intronic
946611453 2:221462827-221462849 CTCAAAATGCTGTCTGTAACAGG - Intronic
1182921240 22:34081497-34081519 CTCACAATGCCCTGTGCAAATGG + Intergenic
1183725021 22:39583770-39583792 CTCACAAGGCCTTTTGTATCTGG + Intronic
951369868 3:21832580-21832602 CAGACAATGCCCTGTGTAACCGG + Intronic
953415142 3:42711514-42711536 CTCTCAAGGCCCTGTGTGATTGG + Intronic
953686660 3:45083247-45083269 CTCACAAGGCCAAGGGTCACTGG + Exonic
954127328 3:48539210-48539232 GTCAGAAGGTCGTGTGTGACAGG - Intronic
963773041 3:149408899-149408921 CCTACAAGGCCTTGTTTAACAGG - Intergenic
967129428 3:186457094-186457116 CTCACATGGCTGTGGGAAACAGG - Intergenic
967839806 3:193996209-193996231 CTCACCAGGCTGTTAGTAACCGG + Intergenic
974788156 4:66649429-66649451 CTCTGAAGGCTGTGTCTAACAGG - Intergenic
976471858 4:85437887-85437909 TTCACAAAGCCATTTGTAACAGG + Intergenic
979352510 4:119661362-119661384 CTCACAAGTACGTCTGTAAATGG + Intergenic
980995877 4:139779155-139779177 CTCAAAAGGCCTTGGCTAACTGG - Intronic
990342116 5:54833774-54833796 CACACAAAGCCATGTGTCACTGG - Intergenic
998546350 5:143031211-143031233 CTCACAAAGCTGTGTGTGACGGG - Intronic
1002330435 5:178437001-178437023 ATCACAAGGCTGTGTAGAACAGG + Intronic
1006147421 6:31967944-31967966 GTCACAAGGCCCTGTGAAAAGGG - Exonic
1010635032 6:78248609-78248631 TTCACCAGGCCCTGTGTACCTGG + Intergenic
1011529309 6:88302658-88302680 CACACAAGGCTGGGTGCAACAGG + Intergenic
1016408683 6:143759200-143759222 CTCACAAGGTTTTGTGTAACCGG - Intronic
1019144825 6:169969886-169969908 CTGACGAGGCCGTGTGGGACTGG - Intergenic
1023119025 7:36890821-36890843 CCAACAAGGCCTTGTGTAATGGG + Intronic
1029559738 7:101294718-101294740 CTCACAAGGCCATATCTAAACGG - Intergenic
1031079839 7:117247613-117247635 CTCACAAGGACATTTGTCACTGG + Intergenic
1031165117 7:118218544-118218566 ATTTCAAGGCCGTGTGTTACAGG + Intronic
1033581560 7:142741785-142741807 ATCACAAGGCAGTGTGGAACAGG + Intergenic
1044752545 8:95430284-95430306 GTTACATGGCCATGTGTAACTGG + Intergenic
1052697017 9:31890884-31890906 CTTACAAGGCTGTGTGTCACAGG + Intergenic
1052900271 9:33787747-33787769 ATCACAAGGCAGTGTGGAACAGG + Intronic
1187829486 X:23366378-23366400 CTAACAAGGCCTTGTGTGATTGG + Intronic
1199639650 X:149847811-149847833 CTAGCAAGGCTGTATGTAACAGG + Intergenic