ID: 1168325378

View in Genome Browser
Species Human (GRCh38)
Location 19:55536269-55536291
Sequence CCCGGCAAACAGTCTGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168325378_1168325387 22 Left 1168325378 19:55536269-55536291 CCTTCCTCAGACTGTTTGCCGGG 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1168325387 19:55536314-55536336 GGTGCCCAGGCTCAGGTCCCAGG 0: 1
1: 0
2: 1
3: 28
4: 388
1168325378_1168325390 29 Left 1168325378 19:55536269-55536291 CCTTCCTCAGACTGTTTGCCGGG 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1168325390 19:55536321-55536343 AGGCTCAGGTCCCAGGCCCAAGG 0: 1
1: 1
2: 4
3: 43
4: 447
1168325378_1168325383 0 Left 1168325378 19:55536269-55536291 CCTTCCTCAGACTGTTTGCCGGG 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1168325383 19:55536292-55536314 CATCTCTGCGAGAACAGAGAGGG 0: 1
1: 0
2: 3
3: 17
4: 192
1168325378_1168325385 9 Left 1168325378 19:55536269-55536291 CCTTCCTCAGACTGTTTGCCGGG 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1168325385 19:55536301-55536323 GAGAACAGAGAGGGGTGCCCAGG 0: 1
1: 0
2: 3
3: 42
4: 404
1168325378_1168325384 1 Left 1168325378 19:55536269-55536291 CCTTCCTCAGACTGTTTGCCGGG 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1168325384 19:55536293-55536315 ATCTCTGCGAGAACAGAGAGGGG 0: 1
1: 0
2: 1
3: 11
4: 155
1168325378_1168325386 15 Left 1168325378 19:55536269-55536291 CCTTCCTCAGACTGTTTGCCGGG 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1168325386 19:55536307-55536329 AGAGAGGGGTGCCCAGGCTCAGG 0: 1
1: 0
2: 6
3: 34
4: 381
1168325378_1168325391 30 Left 1168325378 19:55536269-55536291 CCTTCCTCAGACTGTTTGCCGGG 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1168325391 19:55536322-55536344 GGCTCAGGTCCCAGGCCCAAGGG 0: 1
1: 0
2: 3
3: 28
4: 272
1168325378_1168325382 -1 Left 1168325378 19:55536269-55536291 CCTTCCTCAGACTGTTTGCCGGG 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1168325382 19:55536291-55536313 GCATCTCTGCGAGAACAGAGAGG 0: 1
1: 0
2: 1
3: 13
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168325378 Original CRISPR CCCGGCAAACAGTCTGAGGA AGG (reversed) Exonic
901466763 1:9426695-9426717 CCCGGGTTACTGTCTGAGGAGGG - Intergenic
903331310 1:22598433-22598455 CCCTGCACACAGGCTGAGGGGGG + Intronic
906205301 1:43983407-43983429 CCCGGCAGTCAGTGTCAGGAAGG + Intronic
907831013 1:58064338-58064360 CCAGCCCAGCAGTCTGAGGAAGG - Intronic
910121313 1:83793352-83793374 CCCACCAAAAAGTCTGGGGAGGG + Intergenic
916014230 1:160734348-160734370 CTTGGCAAACAGAATGAGGATGG - Intergenic
920576343 1:207063580-207063602 ACAGGCTAACAGTCTGAGAAAGG - Intronic
923745989 1:236700720-236700742 CCCGGAATACAGCCAGAGGAAGG + Intronic
1062929670 10:1344633-1344655 CCTGGGAAACAGTCTGTGAAAGG - Intronic
1065732368 10:28721331-28721353 CCAGGGGAACAGTCTGAGGTAGG + Intergenic
1066587027 10:36946924-36946946 CTTAGCAAACAGTCTGGGGAAGG - Intergenic
1067789316 10:49275858-49275880 GCTGTCAAACAGTCTGAAGAAGG - Intergenic
1070672794 10:78389857-78389879 CCCGGCACAGAGTCAGAGGTAGG + Intergenic
1085901233 11:80702192-80702214 CTTAGCAAACAGTCTGGGGATGG + Intergenic
1087671726 11:101114793-101114815 CAAGGAAAACAGTCTGGGGATGG - Intronic
1090265479 11:125350731-125350753 TCCGTCTCACAGTCTGAGGACGG + Intronic
1091338862 11:134795033-134795055 CCCAGGAAACAGTCAGAGAAAGG - Intergenic
1095996337 12:48088933-48088955 CCAAGAAAACTGTCTGAGGAAGG + Exonic
1098972145 12:76868021-76868043 CCCGGAAGACAGTCTAGGGAAGG - Intronic
1100722513 12:97373860-97373882 CCGGGCAAAGAGACTGAGGAGGG + Intergenic
1104463887 12:128975150-128975172 CCCGGCAAAGGGTCTGAGCACGG + Intronic
1106515477 13:30449623-30449645 CCAGGGAAAAAGTCTAAGGAAGG - Intergenic
1106517331 13:30466102-30466124 CCGGGCAAAGAGGCTGAGGCGGG + Intronic
1117471942 14:56055242-56055264 ACAGGCGAACAGTGTGAGGACGG - Intergenic
1119424672 14:74527783-74527805 CCAGGGGAACAGTTTGAGGAAGG + Intronic
1122941213 14:104982213-104982235 CCCGGCACCCAGCCTCAGGAAGG - Intergenic
1129949204 15:79571280-79571302 CCCGGCTAGGAGTCTAAGGAAGG - Intergenic
1135499510 16:22981498-22981520 CCAGGAAAACAGTCTGGGCAGGG - Intergenic
1136267473 16:29130104-29130126 CCCGGTAGACACTCTGGGGAGGG - Intergenic
1141291627 16:82723115-82723137 CCTGGGGAACAGTCTGGGGAAGG + Intronic
1141551642 16:84810377-84810399 CCTGGCACACAGTGTTAGGAAGG + Intergenic
1141622684 16:85245337-85245359 CCCGGCAGAAAGTCTCGGGAGGG - Intergenic
1142070764 16:88090427-88090449 CCCGGGAGACACTCTGGGGAGGG - Intronic
1142138856 16:88463676-88463698 CCCGGCAAATATTTTGAGGAGGG + Intronic
1142282456 16:89155583-89155605 CCCCGGGAACAGTCAGAGGAAGG + Exonic
1143376612 17:6471091-6471113 CCCAGCAAACACCCAGAGGAAGG + Intronic
1150828142 17:68494708-68494730 CCCGGCAAACGGTCTCAGCTGGG + Intergenic
1154301428 18:13196001-13196023 CCCGGCAAAAAGGCCAAGGAAGG - Intergenic
1155554343 18:27001641-27001663 CCCAGCAAACAGAATCAGGAGGG - Intronic
1158439326 18:57460171-57460193 CCCAGCACACAGGCTGAGGTGGG - Intronic
1160486843 18:79300682-79300704 CCCAGCAAACATACTGAGCAAGG + Intronic
1160835110 19:1121226-1121248 CCAGGAAAGCAGTCTGAGGAAGG + Intronic
1163660409 19:18573694-18573716 GCCGGCAAACAGCTGGAGGATGG + Exonic
1165116570 19:33532675-33532697 CACGGTAAACTGTCTGGGGAGGG + Intergenic
1166864058 19:45825636-45825658 CCTGGCAGACAGTGTGAGGCAGG - Intronic
1167586412 19:50378049-50378071 CCAGGCAAAGAGCCAGAGGATGG - Intronic
1168325378 19:55536269-55536291 CCCGGCAAACAGTCTGAGGAAGG - Exonic
926781343 2:16475211-16475233 CCCTGAAAACAGGCAGAGGAAGG - Intergenic
931092319 2:58899398-58899420 CTCAGCAAACAGTATGTGGAGGG - Intergenic
935187047 2:100743962-100743984 CCCAGCCAACGATCTGAGGAAGG - Intergenic
936006657 2:108894924-108894946 CGCTGAAAACATTCTGAGGAGGG + Exonic
936522718 2:113221357-113221379 CCCTCCAAAGAGTCTGGGGAAGG - Intronic
941975809 2:171403956-171403978 CCCTGCAGACAGGATGAGGAGGG - Intronic
946401882 2:219472549-219472571 CCAGGCACCCACTCTGAGGATGG - Intronic
1169247681 20:4036600-4036622 GCAGGCAAAGAGTCTGAGGCAGG + Intergenic
1170808327 20:19653709-19653731 GCTGGCACGCAGTCTGAGGAAGG - Intronic
1175374394 20:58514616-58514638 CCCGGCAAACTGGCTGAGCTCGG - Intronic
1175833874 20:61981542-61981564 AACTGCAAACAGTCTGAGGGAGG + Intronic
1176373604 21:6076724-6076746 CCCAGCAAACAGCCAGAGGCAGG + Intergenic
1179749873 21:43461519-43461541 CCCAGCAAACAGCCAGAGGCAGG - Intergenic
1180171733 21:46062814-46062836 GCCAGAAAACAGCCTGAGGAAGG - Intergenic
1180198073 21:46209147-46209169 TGCTGCAAACAGTCTCAGGAGGG + Intronic
1181315409 22:21967915-21967937 CCAGGCAGCCAGTCTCAGGAAGG + Intronic
1182431523 22:30301757-30301779 CCAGGCAAACAGGCTGAGGGTGG + Intronic
1182525482 22:30914909-30914931 CCTGACAAACAGTATGAGAATGG + Intergenic
1183368016 22:37417455-37417477 CCCGGCAGAGAGGCTGAGGCAGG - Intronic
950638886 3:14335242-14335264 CCCGGCCAACTTTCTGAAGATGG - Intergenic
953754553 3:45635308-45635330 GGCCTCAAACAGTCTGAGGAAGG + Intronic
960058739 3:113297139-113297161 GCCTGTTAACAGTCTGAGGAGGG - Intronic
961966846 3:130913952-130913974 CTCGGAAAACAATCTGAAGAGGG - Intronic
968506818 4:974552-974574 CCGGGGACCCAGTCTGAGGAGGG + Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
978291057 4:107141192-107141214 CCCAGCAGGCAGTCTGAGGCTGG - Intronic
983682938 4:170374023-170374045 CCAGGCAGGCAGTCTTAGGAAGG - Intergenic
990746449 5:58963912-58963934 CCCTGGAAACAGTCTGAGGGAGG + Intergenic
990866523 5:60386508-60386530 GCCTGCAAAGAGTCTTAGGAGGG - Intronic
992174620 5:74137445-74137467 CCCAACTAACAGTTTGAGGACGG + Intergenic
998407086 5:141880061-141880083 CCCAGCAAGCAGACTGGGGAGGG - Intergenic
1001404884 5:171469226-171469248 ACCTCCAGACAGTCTGAGGAGGG + Intergenic
1004162679 6:13228930-13228952 GCAGGCAACAAGTCTGAGGATGG - Intronic
1005340789 6:24841916-24841938 CCAGGAAAACAGTCTTAGAAAGG + Intronic
1009334746 6:62473204-62473226 CCCTACAAACAATCTGAGGCAGG - Intergenic
1012258999 6:97065870-97065892 CCAGGGAGACAGTGTGAGGAAGG + Intronic
1014126851 6:117786162-117786184 CCCGGCAATGAATCTTAGGAAGG + Intergenic
1015863365 6:137703234-137703256 CCATGCAAAGAGCCTGAGGAAGG - Intergenic
1017134768 6:151138756-151138778 CCCAGCTAACAGGCTGAGGTGGG + Intergenic
1017996243 6:159534036-159534058 CTCAGCAAACAGAGTGAGGATGG + Intergenic
1020715756 7:11673578-11673600 CCAGGCAGGCAGTCTTAGGAGGG - Intronic
1021845947 7:24762805-24762827 CTCGGTAAACAGTCTGACTAAGG + Intergenic
1021930832 7:25579746-25579768 TCGGGGAATCAGTCTGAGGATGG - Intergenic
1026513471 7:71046864-71046886 CTCAGCAAACTGGCTGAGGAAGG + Intergenic
1028324217 7:89502256-89502278 CCCGAAACCCAGTCTGAGGAGGG - Intergenic
1029203011 7:98851601-98851623 GCCAGCACACAGTCAGAGGAGGG + Exonic
1029629212 7:101739916-101739938 CTGTGCAAACAGACTGAGGAAGG - Intergenic
1034226887 7:149491185-149491207 CCCTGCCAACAGGCTCAGGATGG + Intronic
1034238611 7:149592186-149592208 CCCTGCCAACAGGCTCAGGATGG + Intergenic
1034242029 7:149617944-149617966 CCCTGCCAACAGGCTCAGGATGG + Intergenic
1038627465 8:29207912-29207934 CACGGCAGACAGTCTGGGGCAGG + Intronic
1040894332 8:52350053-52350075 CCCGGCCTGAAGTCTGAGGAGGG + Intronic
1042560360 8:70069319-70069341 CCCAGCAAGCAGTCAGAGGATGG - Exonic
1045393000 8:101733757-101733779 CCTGGCTAGCAATCTGAGGAGGG - Intronic
1048217924 8:132513735-132513757 CCCTTCAAAGAGTCTGAAGAAGG - Intergenic
1052508301 9:29382427-29382449 ACCGGCCCTCAGTCTGAGGAAGG - Intergenic
1053463379 9:38287871-38287893 CCCCCCAACCAGTCTGAGGAGGG - Intergenic
1056496843 9:87164491-87164513 CCAGGCAAAGAGTTGGAGGAGGG - Intergenic
1062721613 9:138047151-138047173 CCAGGCACACAGACAGAGGAAGG - Intronic
1186179931 X:6963465-6963487 CCAGGCAGACAGTGTCAGGATGG + Intergenic
1189623377 X:42868432-42868454 CCAGGAAAATTGTCTGAGGATGG + Intergenic
1192791281 X:74383924-74383946 CCCTGCAAACACTCTGAGTCAGG - Intergenic
1202085128 Y:21128764-21128786 CCAGGCAAACAGTGTCTGGAGGG - Intergenic