ID: 1168326111

View in Genome Browser
Species Human (GRCh38)
Location 19:55539236-55539258
Sequence GCATCGCGATGCCGACACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168326111_1168326114 8 Left 1168326111 19:55539236-55539258 CCCTGGTGTCGGCATCGCGATGC No data
Right 1168326114 19:55539267-55539289 AGACATTTGTCAAAACTACGAGG No data
1168326111_1168326116 20 Left 1168326111 19:55539236-55539258 CCCTGGTGTCGGCATCGCGATGC No data
Right 1168326116 19:55539279-55539301 AAACTACGAGGCTCACAGTTGGG No data
1168326111_1168326115 19 Left 1168326111 19:55539236-55539258 CCCTGGTGTCGGCATCGCGATGC No data
Right 1168326115 19:55539278-55539300 AAAACTACGAGGCTCACAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168326111 Original CRISPR GCATCGCGATGCCGACACCA GGG (reversed) Intergenic
No off target data available for this crispr