ID: 1168327055

View in Genome Browser
Species Human (GRCh38)
Location 19:55543881-55543903
Sequence GCCTTTCCACGATTGTGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 95}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168327043_1168327055 10 Left 1168327043 19:55543848-55543870 CCAGTCCATCCTCAATCCCACCC 0: 1
1: 0
2: 1
3: 29
4: 461
Right 1168327055 19:55543881-55543903 GCCTTTCCACGATTGTGTTTGGG 0: 1
1: 0
2: 1
3: 11
4: 95
1168327046_1168327055 -6 Left 1168327046 19:55543864-55543886 CCCACCCCCAGCTCCCTGCCTTT 0: 1
1: 0
2: 11
3: 120
4: 1140
Right 1168327055 19:55543881-55543903 GCCTTTCCACGATTGTGTTTGGG 0: 1
1: 0
2: 1
3: 11
4: 95
1168327044_1168327055 5 Left 1168327044 19:55543853-55543875 CCATCCTCAATCCCACCCCCAGC 0: 1
1: 0
2: 9
3: 132
4: 1123
Right 1168327055 19:55543881-55543903 GCCTTTCCACGATTGTGTTTGGG 0: 1
1: 0
2: 1
3: 11
4: 95
1168327038_1168327055 28 Left 1168327038 19:55543830-55543852 CCACCCCCTTCATTGACTCCAGT 0: 1
1: 0
2: 0
3: 20
4: 367
Right 1168327055 19:55543881-55543903 GCCTTTCCACGATTGTGTTTGGG 0: 1
1: 0
2: 1
3: 11
4: 95
1168327048_1168327055 -10 Left 1168327048 19:55543868-55543890 CCCCCAGCTCCCTGCCTTTCCAC 0: 1
1: 0
2: 8
3: 103
4: 944
Right 1168327055 19:55543881-55543903 GCCTTTCCACGATTGTGTTTGGG 0: 1
1: 0
2: 1
3: 11
4: 95
1168327045_1168327055 1 Left 1168327045 19:55543857-55543879 CCTCAATCCCACCCCCAGCTCCC 0: 1
1: 3
2: 20
3: 169
4: 1525
Right 1168327055 19:55543881-55543903 GCCTTTCCACGATTGTGTTTGGG 0: 1
1: 0
2: 1
3: 11
4: 95
1168327041_1168327055 23 Left 1168327041 19:55543835-55543857 CCCTTCATTGACTCCAGTCCATC 0: 1
1: 0
2: 3
3: 45
4: 313
Right 1168327055 19:55543881-55543903 GCCTTTCCACGATTGTGTTTGGG 0: 1
1: 0
2: 1
3: 11
4: 95
1168327040_1168327055 24 Left 1168327040 19:55543834-55543856 CCCCTTCATTGACTCCAGTCCAT 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1168327055 19:55543881-55543903 GCCTTTCCACGATTGTGTTTGGG 0: 1
1: 0
2: 1
3: 11
4: 95
1168327036_1168327055 30 Left 1168327036 19:55543828-55543850 CCCCACCCCCTTCATTGACTCCA 0: 1
1: 0
2: 1
3: 36
4: 344
Right 1168327055 19:55543881-55543903 GCCTTTCCACGATTGTGTTTGGG 0: 1
1: 0
2: 1
3: 11
4: 95
1168327047_1168327055 -7 Left 1168327047 19:55543865-55543887 CCACCCCCAGCTCCCTGCCTTTC 0: 1
1: 2
2: 10
3: 175
4: 1473
Right 1168327055 19:55543881-55543903 GCCTTTCCACGATTGTGTTTGGG 0: 1
1: 0
2: 1
3: 11
4: 95
1168327039_1168327055 25 Left 1168327039 19:55543833-55543855 CCCCCTTCATTGACTCCAGTCCA 0: 1
1: 0
2: 2
3: 18
4: 208
Right 1168327055 19:55543881-55543903 GCCTTTCCACGATTGTGTTTGGG 0: 1
1: 0
2: 1
3: 11
4: 95
1168327042_1168327055 22 Left 1168327042 19:55543836-55543858 CCTTCATTGACTCCAGTCCATCC 0: 1
1: 0
2: 2
3: 16
4: 190
Right 1168327055 19:55543881-55543903 GCCTTTCCACGATTGTGTTTGGG 0: 1
1: 0
2: 1
3: 11
4: 95
1168327037_1168327055 29 Left 1168327037 19:55543829-55543851 CCCACCCCCTTCATTGACTCCAG 0: 1
1: 0
2: 0
3: 21
4: 366
Right 1168327055 19:55543881-55543903 GCCTTTCCACGATTGTGTTTGGG 0: 1
1: 0
2: 1
3: 11
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168327055 Original CRISPR GCCTTTCCACGATTGTGTTT GGG Intronic
902769493 1:18637400-18637422 GCCTCTCCGCGTATGTGTTTGGG - Intronic
904905916 1:33897056-33897078 ACCTTTCCACAATACTGTTTTGG - Intronic
905016850 1:34783700-34783722 GCCTGTCCACGTGTGTGTGTGGG - Intronic
908670110 1:66536792-66536814 TCCTTTCCAGAAATGTGTTTGGG - Intronic
912093252 1:106108088-106108110 GCCTTTCCACCATTGTATTTTGG + Intergenic
912834689 1:112985913-112985935 GCCTGTACACCATTGTATTTTGG - Intergenic
913593210 1:120349314-120349336 GGTTTTCCAGGATTATGTTTGGG - Intergenic
914094047 1:144529672-144529694 GGTTTTCCAGGATTATGTTTGGG + Intergenic
914199605 1:145473170-145473192 GGTTTTCCAGGATTATGTTTGGG + Intergenic
914304479 1:146404230-146404252 GGTTTTCCAGGATTATGTTTGGG - Intergenic
914312188 1:146476536-146476558 GGTTTTCCAGGATTATGTTTGGG + Intergenic
914478720 1:148046303-148046325 GGTTTTCCAGGATTATGTTTGGG + Intergenic
914502162 1:148256800-148256822 GGTTTTCCAGGATTATGTTTGGG - Intergenic
914597577 1:149168598-149168620 GGTTTTCCAGGATTATGTTTGGG + Intergenic
917319810 1:173768829-173768851 GTCTTTGCCCGTTTGTGTTTTGG - Intronic
917849991 1:179053641-179053663 GCTTTTCTAAGACTGTGTTTAGG + Intronic
919020956 1:192105228-192105250 GCCCTTCCAAGATTGTGTCTGGG + Intergenic
922629242 1:227087934-227087956 GCCCTTCCACATTTGTGGTTGGG + Intronic
924702141 1:246464618-246464640 TCCTCTCCACGATGGTGTCTAGG + Intronic
1063284900 10:4676221-4676243 TACGTTCCACCATTGTGTTTTGG + Intergenic
1070246275 10:74734860-74734882 TCCTTTTTAGGATTGTGTTTTGG - Intergenic
1073248640 10:102108342-102108364 CCCTTGCCCCGATTATGTTTGGG - Intronic
1080129004 11:28770926-28770948 GCTGTTCCACCATTGCGTTTTGG + Intergenic
1080337957 11:31221320-31221342 GCCTGTCCATTATTGTATTTTGG - Intronic
1081170082 11:39857446-39857468 ACCTTTCCAGGATTTTGATTGGG - Intergenic
1086555147 11:88101098-88101120 GCCTTTCCAGGTGTGTGTTGGGG - Intergenic
1088069474 11:105764009-105764031 GTCCTTTCAAGATTGTGTTTGGG - Intronic
1089455942 11:118625854-118625876 GCCTTTGCAAGACTGAGTTTGGG - Intronic
1089707098 11:120286305-120286327 GCCTTTACATGCATGTGTTTTGG + Intronic
1090216683 11:124973072-124973094 GCCTTTCCAAGATTGAGGCTTGG + Intronic
1094534175 12:31306283-31306305 GGTTTTCCAGGATTGTGTTTTGG + Intronic
1095929816 12:47614158-47614180 ACCATTCCACCATTGTATTTTGG - Intergenic
1097247406 12:57614065-57614087 GCCGTGACAGGATTGTGTTTGGG + Exonic
1105935180 13:25091796-25091818 GGCTTTCCAAGATTGAGCTTAGG - Intergenic
1106242082 13:27920512-27920534 GCCTTTCCACGCGTGAGCTTTGG - Exonic
1111283786 13:86062853-86062875 GTCTTTCTACCATTGTCTTTGGG - Intergenic
1111673351 13:91356903-91356925 GCCTTTCCACTTAAGTGTTTTGG + Intergenic
1114702563 14:24693810-24693832 GCCTTCCCACCCTTGTGTTAAGG + Intergenic
1114729042 14:24971451-24971473 GCCCTTCAACTATTGTGGTTTGG - Intronic
1125036917 15:35135749-35135771 GCCTTATTAAGATTGTGTTTTGG - Intergenic
1136054086 16:27675026-27675048 ACCTATCCACCATTGTATTTGGG - Intronic
1144110930 17:12031431-12031453 GTCTATCTACGCTTGTGTTTTGG - Intronic
1144243103 17:13333790-13333812 TCTTTTCCACACTTGTGTTTGGG - Intergenic
1148655608 17:49281026-49281048 GCCTGTCCACTATTGTATGTTGG - Intergenic
1149553151 17:57554984-57555006 TCCTTTCCTCCCTTGTGTTTGGG + Intronic
1157245698 18:46052451-46052473 GCCTTTACAGGGTTGTGGTTAGG - Intronic
1164106563 19:22111900-22111922 GCCTGGCCTCAATTGTGTTTTGG - Intergenic
1166760345 19:45220575-45220597 GCCTTTCGAAGTGTGTGTTTTGG + Intronic
1167776785 19:51563789-51563811 TCCTTTCCAAGGTTGTGATTAGG - Intergenic
1168327055 19:55543881-55543903 GCCTTTCCACGATTGTGTTTGGG + Intronic
925301916 2:2823021-2823043 GCCTTCCCATCATTGTATTTTGG - Intergenic
925402781 2:3587490-3587512 GCATCTCAACGATTGGGTTTTGG - Intergenic
926620741 2:15044920-15044942 GCCTTACCCCAATTATGTTTTGG - Intergenic
928438411 2:31271342-31271364 GCCTCTCCAGGAATGTGTGTGGG + Intergenic
932006661 2:67934038-67934060 GCCGTCCCACCATTGTATTTTGG + Intergenic
935373106 2:102367994-102368016 TGCTTTGCATGATTGTGTTTTGG + Exonic
938664552 2:133520978-133521000 ACCTTTCCATGATTGTTTTATGG - Intronic
939581670 2:143956979-143957001 GCCTTTATACGATTGTATGTGGG + Intronic
940657942 2:156511179-156511201 GCCTTTTAACAATTGTGTTTGGG + Intronic
943838303 2:192543644-192543666 GACTTTACACGGTTGTGTTTGGG + Intergenic
947206067 2:227662339-227662361 GCCTTTTCAGGATTTTTTTTTGG + Intergenic
947983997 2:234433812-234433834 GCATTTCCACCATTGTCTCTGGG - Intergenic
949021458 2:241743347-241743369 TCCTTTCCACGAGTGTGTGTGGG + Intronic
1171429716 20:25074740-25074762 GCTTATCCAGGATTGAGTTTGGG - Intronic
1172032696 20:31992971-31992993 GCATTTCCAGGATGTTGTTTGGG - Intronic
1185306080 22:50117484-50117506 CTCTTTCCATGATTGTATTTGGG + Intronic
950116539 3:10454078-10454100 TCCATTCAATGATTGTGTTTTGG + Intronic
950217132 3:11167746-11167768 GCCTGTGAATGATTGTGTTTGGG + Intronic
955586041 3:60479306-60479328 GCCTCTTGACCATTGTGTTTTGG - Intronic
959153948 3:102643154-102643176 TCATTTCCAAGATTCTGTTTAGG - Intergenic
962976506 3:140450658-140450680 GCCTCTCCACTATTATCTTTGGG + Intronic
963084217 3:141421992-141422014 GCTTTTTCAGGGTTGTGTTTTGG - Intronic
965984124 3:174731105-174731127 GCCTTTCCATGATAGTGTGTGGG - Intronic
967076844 3:186011112-186011134 GCCTGTCCATCATTGTATTTTGG + Intergenic
967601864 3:191399847-191399869 GCCCCTCCTCCATTGTGTTTGGG + Intergenic
973629737 4:52809152-52809174 GCCTTTCAACAAATGTGGTTTGG + Intergenic
975000225 4:69215997-69216019 ACCTTTCTACAAATGTGTTTTGG + Intergenic
975267507 4:72388281-72388303 GTCATACCACTATTGTGTTTTGG + Intronic
978820690 4:112961644-112961666 ACATTTCCCCCATTGTGTTTAGG + Intronic
979664118 4:123292363-123292385 GCATTTCAAAGATTTTGTTTTGG + Intronic
981687929 4:147475790-147475812 GCCTGTCCACCACTGTATTTTGG - Intergenic
984534756 4:180960544-180960566 GCCTTTCCAGGATCGTCTTGAGG - Intergenic
984596490 4:181674622-181674644 GCATTTCCAAGATTCTGTTCTGG - Intergenic
986470459 5:8068552-8068574 GCCTTCCCAAAATTGTGATTAGG + Intergenic
994449690 5:99926673-99926695 GCCTTTTCAAGAATGTGTCTTGG + Intergenic
994493917 5:100486131-100486153 GTCTTTCCACTTTTGAGTTTTGG - Intergenic
998867709 5:146521951-146521973 GCCTTTCCAACATTGCGTGTAGG - Intergenic
1000012061 5:157242449-157242471 CCCTATCAAGGATTGTGTTTTGG - Intronic
1004038952 6:11955697-11955719 TCCTTTCCATAATTGTGTTGTGG + Intergenic
1013077112 6:106781267-106781289 GCCTTTACCCTATTGTGTCTAGG + Intergenic
1013343225 6:109235916-109235938 GCCTTGGCACGATTGATTTTTGG + Intergenic
1015926473 6:138314629-138314651 GCCTTCCTACCATTGTATTTTGG - Intronic
1023338154 7:39191360-39191382 ACCTTTTCACCATTGTATTTAGG + Intronic
1024631262 7:51249253-51249275 CCCTTTCAAGGATTCTGTTTTGG - Intronic
1025867460 7:65398152-65398174 GCTTTTCCACAAATGTATTTTGG + Intronic
1026120425 7:67532075-67532097 CCCATTCCACCATTGTATTTTGG - Intergenic
1031522949 7:122788733-122788755 ACCTTTCCATGATTGAGTTTAGG + Intronic
1037097155 8:14999806-14999828 GCTGTTCCGCGATTGTCTTTAGG - Intronic
1040755249 8:50765387-50765409 GCCTCTCCACTATCTTGTTTGGG + Intronic
1043649670 8:82575641-82575663 GCCTGTCCACGATTGTAGTTTGG - Intergenic
1046732782 8:117743529-117743551 GCCTTGCTAAGATTGTGGTTAGG + Intergenic
1048421976 8:134285821-134285843 GCATCTCCACCATTATGTTTTGG - Intergenic
1050183810 9:2949945-2949967 GCATTTCCATGATTCTGTTTTGG + Intergenic
1051561989 9:18452617-18452639 GCCTGTCCACCATTGTATTTTGG - Intergenic
1056945330 9:90990309-90990331 TTCTTTCCACCATTGTGTGTTGG - Intergenic
1057331777 9:94121555-94121577 GCTGTTCCACCATTGTATTTTGG + Intergenic
1189254039 X:39623650-39623672 GCCTGTCCACCATTGTATTTTGG - Intergenic
1193972723 X:88076461-88076483 AGGTTTCCAGGATTGTGTTTGGG + Intergenic