ID: 1168329758

View in Genome Browser
Species Human (GRCh38)
Location 19:55560812-55560834
Sequence CCAGAGAAATGATGAGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168329758_1168329765 6 Left 1168329758 19:55560812-55560834 CCCATTTCTCATCATTTCTCTGG No data
Right 1168329765 19:55560841-55560863 AGGCTGGACCCAGCTCAGCCAGG No data
1168329758_1168329768 20 Left 1168329758 19:55560812-55560834 CCCATTTCTCATCATTTCTCTGG No data
Right 1168329768 19:55560855-55560877 TCAGCCAGGTCCTCTGTTTCAGG No data
1168329758_1168329764 -10 Left 1168329758 19:55560812-55560834 CCCATTTCTCATCATTTCTCTGG No data
Right 1168329764 19:55560825-55560847 ATTTCTCTGGGTTAGGAGGCTGG No data
1168329758_1168329769 21 Left 1168329758 19:55560812-55560834 CCCATTTCTCATCATTTCTCTGG No data
Right 1168329769 19:55560856-55560878 CAGCCAGGTCCTCTGTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168329758 Original CRISPR CCAGAGAAATGATGAGAAAT GGG (reversed) Intergenic
No off target data available for this crispr