ID: 1168331625

View in Genome Browser
Species Human (GRCh38)
Location 19:55573323-55573345
Sequence ATAAGGTGTCTGGCCATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168331619_1168331625 13 Left 1168331619 19:55573287-55573309 CCTCGTTTGATGGGTTTTGTCCA No data
Right 1168331625 19:55573323-55573345 ATAAGGTGTCTGGCCATGGTAGG No data
1168331618_1168331625 14 Left 1168331618 19:55573286-55573308 CCCTCGTTTGATGGGTTTTGTCC No data
Right 1168331625 19:55573323-55573345 ATAAGGTGTCTGGCCATGGTAGG No data
1168331622_1168331625 -7 Left 1168331622 19:55573307-55573329 CCATGACATTGTATGGATAAGGT No data
Right 1168331625 19:55573323-55573345 ATAAGGTGTCTGGCCATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168331625 Original CRISPR ATAAGGTGTCTGGCCATGGT AGG Intergenic
No off target data available for this crispr