ID: 1168331796

View in Genome Browser
Species Human (GRCh38)
Location 19:55574576-55574598
Sequence CCCTTTCTTGCTGTTTCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168331793_1168331796 0 Left 1168331793 19:55574553-55574575 CCTGGAAAAGGGGGAGGCTCTGC No data
Right 1168331796 19:55574576-55574598 CCCTTTCTTGCTGTTTCTTGTGG No data
1168331785_1168331796 25 Left 1168331785 19:55574528-55574550 CCCTCTCAGAGCTTCAGTTTGTT No data
Right 1168331796 19:55574576-55574598 CCCTTTCTTGCTGTTTCTTGTGG No data
1168331786_1168331796 24 Left 1168331786 19:55574529-55574551 CCTCTCAGAGCTTCAGTTTGTTG No data
Right 1168331796 19:55574576-55574598 CCCTTTCTTGCTGTTTCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168331796 Original CRISPR CCCTTTCTTGCTGTTTCTTG TGG Intergenic
No off target data available for this crispr