ID: 1168332984

View in Genome Browser
Species Human (GRCh38)
Location 19:55580491-55580513
Sequence GGTCCCGGTGGAGGAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 868
Summary {0: 1, 1: 1, 2: 10, 3: 74, 4: 782}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168332984 Original CRISPR GGTCCCGGTGGAGGAGGGGC TGG Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900245590 1:1634713-1634735 GCTCTCGGTGGACCAGGGGCTGG - Intronic
900256819 1:1701870-1701892 GCTCTCGGTGGACCAGGGGCTGG - Intronic
900531292 1:3154690-3154712 GGTCGCGGTGGAGGAAGGCATGG + Intronic
900534611 1:3170690-3170712 GGGCCCGGGGGAGCAGGGGAAGG + Intronic
900599502 1:3497031-3497053 GGTCCCGGTGGCAGGGTGGCAGG + Exonic
900721548 1:4179181-4179203 GAGCACTGTGGAGGAGGGGCAGG - Intergenic
900739329 1:4321151-4321173 GGTCCCTGAGAAGGTGGGGCTGG + Intergenic
900762485 1:4482474-4482496 GGTCACTCTTGAGGAGGGGCAGG - Intergenic
900982727 1:6055705-6055727 GGTCAGGGTGAAGGTGGGGCGGG + Intronic
901066569 1:6497283-6497305 GGACCCGGCGGACGCGGGGCGGG - Intronic
901109939 1:6785887-6785909 GGTCCGGGTGGGGGAGGCGCCGG - Intronic
901185312 1:7369077-7369099 GGTGGGGGAGGAGGAGGGGCAGG - Intronic
901449077 1:9325235-9325257 TGCACCGGTGGAGGCGGGGCGGG - Intronic
901567541 1:10131053-10131075 GGGCCAGCTGGAGGAGGAGCCGG - Intronic
901758026 1:11453256-11453278 GGCGACGGTGGAGCAGGGGCAGG - Intergenic
901839413 1:11944701-11944723 GGTGCTGGGGGAGGAGGGGGTGG - Intronic
902402838 1:16167501-16167523 GGGCCACGTGGAGGAGAGGCAGG + Intergenic
903063829 1:20687433-20687455 GGCCACGGTGGAGGAGAGTCTGG + Exonic
903178621 1:21594652-21594674 CGGCCCTGTGGAGGTGGGGCAGG + Intergenic
903266272 1:22159945-22159967 GGTCACCGTGGAGGGGGGCCAGG - Intergenic
903446228 1:23424428-23424450 GGACCCGAGGGAGGAGCGGCTGG - Intronic
903575090 1:24334739-24334761 GCTCCAGGTGGAGGTGGGGAAGG - Intronic
903666443 1:25010537-25010559 AGTTCTGGTGGTGGAGGGGCTGG - Intergenic
904002270 1:27345499-27345521 GCGCCAGCTGGAGGAGGGGCGGG + Exonic
904014574 1:27409826-27409848 GGCCCCGGAGGAGGAGGAGGAGG + Exonic
904267443 1:29325885-29325907 GGACCCTATGGAGGTGGGGCTGG - Intronic
904447543 1:30587237-30587259 GGGCCTAGTGGAGGAGGGGGAGG - Intergenic
905617107 1:39408923-39408945 GGGCCCGGCGGGGGCGGGGCCGG - Intronic
905870240 1:41399388-41399410 TGTCTCTGTGGGGGAGGGGCCGG + Intergenic
906032453 1:42732528-42732550 GGTGCCAGTGGAGCAGGGGTGGG - Intergenic
906115269 1:43352460-43352482 GATCCTGTGGGAGGAGGGGCTGG - Intronic
906154363 1:43605456-43605478 GGTATCGGGGGAGGCGGGGCAGG + Intronic
906518986 1:46456300-46456322 GGGCCCCGGGGAGGAGGGGGAGG + Intergenic
908534647 1:65066745-65066767 GGTGCCGGAGGAGGAGGAGGAGG - Intergenic
909001420 1:70221688-70221710 GGGCCCGGTGGCGGAGGTGGTGG + Exonic
912845987 1:113074919-113074941 GGTCGGGGAGGAAGAGGGGCCGG + Intronic
912993437 1:114510935-114510957 GGTGCTGGTGGAGGAGGAGGAGG - Exonic
915532491 1:156510801-156510823 AGGCACTGTGGAGGAGGGGCTGG - Intergenic
915835655 1:159172949-159172971 GGTCCCTGAGGAGGGAGGGCAGG + Intronic
916528044 1:165630450-165630472 AGGCCGGGTGGAGGAGGGGTGGG - Intergenic
919944613 1:202310178-202310200 GATCCTGGTGGGGGAGAGGCAGG - Exonic
920274777 1:204796016-204796038 GATCTCAGTGGAGGAGGAGCAGG - Intergenic
920518287 1:206602835-206602857 GCTTCCGGGGGAGGAGGGGAAGG - Intronic
920655006 1:207868517-207868539 GGTCCGTGTGGAGGAGGAGGCGG - Intergenic
921334982 1:214076815-214076837 GGTGGTGGAGGAGGAGGGGCAGG - Intergenic
922101942 1:222484190-222484212 ACTCCAGGAGGAGGAGGGGCTGG + Intergenic
922132641 1:222795043-222795065 TGTGGGGGTGGAGGAGGGGCAGG - Intergenic
922263022 1:223959312-223959334 ACTCCAGGAGGAGGAGGGGCTGG + Intergenic
922724936 1:227918313-227918335 GGACCCTGGGGAGGAGGGCCTGG - Intergenic
922804274 1:228377561-228377583 GGTCCAGGTGCAGGATGTGCTGG - Exonic
923082696 1:230673745-230673767 GGTGGGGGTGGAGGAGGGCCAGG - Intronic
923772367 1:236948704-236948726 AGTCCCTGTGGAGCAGGTGCTGG - Intergenic
924344860 1:243064313-243064335 ACTCCAGGAGGAGGAGGGGCTGG + Intergenic
924527320 1:244863932-244863954 GGGCCCGATGGAGGAGGAGGAGG - Exonic
1063139335 10:3242793-3242815 GATCGAGGAGGAGGAGGGGCTGG + Intergenic
1065099768 10:22321408-22321430 GGCCCCGGAGGAGGAGGCGTTGG + Exonic
1065838574 10:29681077-29681099 GTTCCCTGTGGAGGTGGGGCAGG + Intronic
1066177964 10:32929291-32929313 TGACCTGGTTGAGGAGGGGCCGG + Intronic
1067146185 10:43695470-43695492 GGTCCGGGTGGGCGAGGGGGAGG + Intergenic
1067343110 10:45419843-45419865 GGTGCCTGTGGAGGAAGGGAGGG + Intronic
1069371334 10:67750720-67750742 GGAGCTGGTGGATGAGGGGCTGG + Intergenic
1069707396 10:70467394-70467416 GGTCCCAGTGGTGGAGGTGGGGG + Intergenic
1069896982 10:71686008-71686030 GCTCCAGGAGGAGGAGGGGCCGG + Intronic
1070129450 10:73646836-73646858 GGAGCCTCTGGAGGAGGGGCTGG + Exonic
1070681408 10:78451808-78451830 GCTCACGGAGGAGGAGTGGCAGG - Intergenic
1070722393 10:78765585-78765607 GGTCCCTGAGGGTGAGGGGCTGG + Intergenic
1070761193 10:79025359-79025381 GGTCCTGCTGCAGGAAGGGCTGG + Intergenic
1071191754 10:83109159-83109181 GGTGCTGGTGGGGGTGGGGCTGG - Intergenic
1071525283 10:86354716-86354738 GGTCCCGGGGAGGCAGGGGCAGG + Intronic
1071882165 10:89911206-89911228 GGTGCTGGTGGAGGTAGGGCTGG + Intergenic
1073214701 10:101829812-101829834 GCTCCTGGTGGGGGCGGGGCGGG - Intronic
1074317209 10:112370652-112370674 GGGCGCAGTGGAGCAGGGGCCGG - Intergenic
1074865479 10:117542297-117542319 GGTGCTGGTGGAGGAGGAGGCGG + Intergenic
1075272251 10:121062451-121062473 GGTCCCTTTGGAGGAAGGTCTGG - Intergenic
1075307668 10:121382446-121382468 GGGCACGGTGGAGCAGGGGGCGG - Intergenic
1076294708 10:129375475-129375497 GGTGCCCTTGGAGCAGGGGCTGG + Intergenic
1076516673 10:131049251-131049273 GGTGCAGTGGGAGGAGGGGCTGG - Intergenic
1076655606 10:132021649-132021671 GGTCCAGGTGCGGGAGAGGCAGG + Intergenic
1076675415 10:132145169-132145191 GGCCCTGGCGGAGCAGGGGCAGG + Exonic
1076852569 10:133100197-133100219 GGCCCCGGCGGAGGAGTCGCTGG + Intronic
1076853669 10:133104998-133105020 TTTCCTGGTGGAGGAGGGGGAGG - Intronic
1076903342 10:133350543-133350565 GACCCAGGTGGAGGAGGGCCCGG + Intronic
1077130230 11:968366-968388 GGTCCCGCGGGAGCAGAGGCTGG + Intronic
1077146827 11:1050201-1050223 GACCCTGGTGCAGGAGGGGCTGG + Intergenic
1077172635 11:1174767-1174789 GGACCCGGCCGAGGAGGGGAGGG + Intronic
1077326564 11:1966601-1966623 GGCACCGGGGGAGGAGGGGCTGG - Intronic
1077407249 11:2388246-2388268 GGTCCCGGAGGAGGGGAGACAGG + Intronic
1077470830 11:2759811-2759833 GCCCAGGGTGGAGGAGGGGCTGG - Intronic
1077495119 11:2883246-2883268 GAACCCGGCGGACGAGGGGCCGG + Exonic
1077533632 11:3108543-3108565 GGCAGCGGTGGAGCAGGGGCTGG + Intronic
1077537315 11:3130578-3130600 GGGCCAGGTGAGGGAGGGGCTGG - Intronic
1079689819 11:23405331-23405353 GGTCTCGGTGGAGGAATGGGAGG - Intergenic
1080304758 11:30824319-30824341 TGCCCTGGAGGAGGAGGGGCAGG - Intergenic
1081582002 11:44359038-44359060 TTTCCCAGTGGAGGCGGGGCTGG - Intergenic
1081812997 11:45923565-45923587 GGTGTCCGTGGAGGAGGGTCAGG + Intronic
1081873378 11:46392977-46392999 GGCGGCGGTGGAGGAGAGGCAGG + Intergenic
1083303233 11:61749691-61749713 ACCCCGGGTGGAGGAGGGGCAGG + Intergenic
1083405593 11:62454832-62454854 GGAGCCGTTTGAGGAGGGGCTGG - Intronic
1083681086 11:64352183-64352205 GGTGCTGGAGGAGGAGGTGCGGG + Exonic
1083713815 11:64564516-64564538 GGTGCTGGTGGAGGTGGTGCTGG - Intronic
1084032917 11:66491661-66491683 GGCAGAGGTGGAGGAGGGGCAGG - Intronic
1084607336 11:70180116-70180138 GGGCCCTGTGGAGAAGGAGCTGG + Intronic
1084800892 11:71543187-71543209 GCTGCAGGTGGAGGAGGGCCAGG + Intronic
1084953961 11:72681513-72681535 GGACAGGGTGGAGGAGGAGCAGG + Intergenic
1085274898 11:75292083-75292105 GCTCCCAGGGGAGGTGGGGCGGG - Intronic
1085452497 11:76643443-76643465 GGGGCCTGTGGAGGAGGGGTAGG - Intergenic
1086064940 11:82733928-82733950 CGTCCCGGTGGTAGAGGGGAGGG + Intergenic
1088229696 11:107661205-107661227 GGTAAGGGTAGAGGAGGGGCTGG - Intronic
1088481667 11:110300970-110300992 GGTGCCGGTGGAGCAGGGGGCGG + Intergenic
1089286720 11:117412195-117412217 GGTCTGGGTGGAGGAGAGGCTGG - Exonic
1090286596 11:125505066-125505088 GGTCCCCGGGGAGGGGAGGCTGG + Intergenic
1090415110 11:126535167-126535189 AGTCCCGATGGAGGAGGGTGGGG - Intronic
1090474110 11:127004074-127004096 GGTCCCGGTGCAGGAGTGAGGGG + Intergenic
1091259516 11:134223761-134223783 GGTGCCGGTGGGGGCGGGGTGGG - Intronic
1091335348 11:134762254-134762276 AGTCCCGGTAGAGGAGGCGCCGG + Intergenic
1202809545 11_KI270721v1_random:21780-21802 GGCACCGGGGGAGGAGGGGCTGG - Intergenic
1091396669 12:157469-157491 GGGCCCGGGGGAGGGTGGGCGGG + Intronic
1091562449 12:1625479-1625501 GGGGCAGGTGGAGGAGGAGCAGG - Intronic
1091616424 12:2053817-2053839 GGGCCCGGAGGGGGAGGGGCGGG - Intronic
1092238044 12:6821975-6821997 GGTGGCTGGGGAGGAGGGGCCGG - Intronic
1094041512 12:26125117-26125139 GGGGGCGGGGGAGGAGGGGCCGG + Exonic
1095085384 12:38053899-38053921 AGTCCCGGTGGAGGTTGGGGAGG + Intergenic
1095946819 12:47758515-47758537 GGTCAGGGTTGAGGAGGAGCAGG - Intronic
1096256123 12:50063388-50063410 GGTCTCAGCGGAGGAGGGGGTGG - Intronic
1096502544 12:52073677-52073699 GGTGTCGGTGGAGGGGCGGCAGG + Exonic
1096634491 12:52949679-52949701 CCTCCCGGTGGAGTAGGGGTTGG - Intronic
1096982441 12:55736211-55736233 GATCCTGGTGGGGGTGGGGCTGG - Intergenic
1097080219 12:56424841-56424863 GGTGCCAGTGGAGGAGCAGCGGG - Exonic
1097191143 12:57220243-57220265 GGTGGAGGTGGAGGAGGGGCAGG - Intronic
1097212980 12:57386596-57386618 GGGCGCGGTGGAGCAGGGGGCGG - Intronic
1097237018 12:57547093-57547115 GGCCTCGGTGGAGCCGGGGCCGG + Exonic
1097256052 12:57675289-57675311 GGCCACGATGGAGGAAGGGCAGG - Intergenic
1097822530 12:64142625-64142647 GGACCCTGGGGAGGTGGGGCAGG - Exonic
1098590722 12:72208317-72208339 GGGTTCGGAGGAGGAGGGGCAGG + Intronic
1100611491 12:96194787-96194809 GGGCGCGGTGGGGGTGGGGCGGG + Intronic
1100844512 12:98645003-98645025 GGGACCCGAGGAGGAGGGGCAGG + Exonic
1102124379 12:110468711-110468733 AGTTACGGTGGGGGAGGGGCAGG - Exonic
1103209537 12:119156527-119156549 GCTGCCGGATGAGGAGGGGCTGG - Exonic
1103410800 12:120710385-120710407 GGGCCCGGCGGGGAAGGGGCGGG - Intergenic
1103586993 12:121963439-121963461 GGTCCCGGGAGAGGCTGGGCTGG + Intronic
1103795222 12:123498690-123498712 GGTCACGGTGGTGGAGGCCCAGG - Exonic
1103915148 12:124372305-124372327 GCCCCCAGTGGAGGAGGGGGAGG - Exonic
1104001729 12:124864270-124864292 GGTCCCGATAGAGGAGGAGAGGG - Intronic
1104737246 12:131143205-131143227 GCTCGCTGTGGAGGAGGGGCCGG - Intergenic
1104927310 12:132320641-132320663 GGACACGGTGGAGGAGGTGGAGG + Intronic
1104957744 12:132474667-132474689 GGTCACCGCGGAGGAGGGGGCGG - Intergenic
1104957754 12:132474690-132474712 GGTCACCGCGGAGGAGGGGGCGG - Intergenic
1104957782 12:132474759-132474781 GGTCACCGCGGAGGAGGGGGCGG - Intergenic
1104957793 12:132474783-132474805 GGTCACCGCGGAGGAGGGGGCGG - Intergenic
1104957812 12:132474829-132474851 GGTCACCGCGGAGGAGGGGGCGG - Intergenic
1104957823 12:132474853-132474875 GGTCACCGCGGAGGAGGGGGCGG - Intergenic
1104957842 12:132474899-132474921 GGTCACCGCGGAGGAGGGGGCGG - Intergenic
1104957908 12:132475056-132475078 GGTCACCGCGGAGGGGGGGCGGG - Intergenic
1104957929 12:132475102-132475124 GGTCACCGCGGAGGAGGGGGCGG - Intergenic
1104957947 12:132475147-132475169 GGTCACCGCGGAGGGGGGGCGGG - Intergenic
1104957968 12:132475193-132475215 GGTCACCGCGGAGGAGGGGGCGG - Intergenic
1106901413 13:34357983-34358005 GCTCGAGGTGGAGGAGGGGATGG - Intergenic
1107184333 13:37499876-37499898 GGACCTGGAGGATGAGGGGCTGG - Intergenic
1107528965 13:41263618-41263640 GGTAGTGGCGGAGGAGGGGCCGG - Intergenic
1108618263 13:52157214-52157236 TGGACCAGTGGAGGAGGGGCAGG + Intronic
1109141099 13:58714410-58714432 GGGCGCCGTGGAGCAGGGGCTGG - Intergenic
1109506193 13:63306059-63306081 GGGCGCGGTGGAGCAGGGGGCGG - Intergenic
1110483358 13:76009692-76009714 GGTGGCAGTGGAGGAAGGGCAGG - Intergenic
1112012008 13:95300944-95300966 GGGCTCGGGGGAGGAGGAGCAGG - Intronic
1112280213 13:98056267-98056289 GGGCCTGGAGGAAGAGGGGCTGG + Intergenic
1113711332 13:112467274-112467296 GCTCCTGGGGGAGGAGGTGCGGG - Intergenic
1113968319 13:114167304-114167326 GGTGTCAGTGGAGAAGGGGCCGG + Intergenic
1114008021 14:18333993-18334015 GGAGCAGGTGGAGGAGTGGCGGG + Intergenic
1114660222 14:24339059-24339081 GGTCCCGGTGCAGGAGCACCGGG + Exonic
1116416970 14:44689816-44689838 GGGGCAGGAGGAGGAGGGGCAGG + Intergenic
1116416976 14:44689831-44689853 GGGGCAGGAGGAGGAGGGGCAGG + Intergenic
1116572458 14:46535024-46535046 GGTTCCGTTGGAGGGGGGGTGGG + Intergenic
1117677529 14:58170136-58170158 GGTGGAGGTGGAGGTGGGGCTGG - Intronic
1118359537 14:65044409-65044431 GTGCGCGGTGGAGCAGGGGCAGG - Exonic
1119434185 14:74587134-74587156 GGTCCTGGTGGGGGAGGGGCCGG - Intronic
1120213665 14:81659268-81659290 GGTGCGGGTGGAGGAAGGGGAGG - Intergenic
1121080261 14:91102472-91102494 GGGGCCGGAGGAGGAGGGGGTGG - Intronic
1122066218 14:99175857-99175879 GGTCCAGGTGGTGGCGCGGCGGG + Exonic
1122135033 14:99627910-99627932 GGCCCCCGAGGAGGAAGGGCTGG + Intergenic
1122543291 14:102509471-102509493 TGTGCCGGAGGAGGAGGGGGCGG + Intronic
1122593387 14:102871411-102871433 CTTCCCGGTGGAGGAGGGGCTGG + Intronic
1122632370 14:103112793-103112815 GGTGCCGGTGGGGGTGGGGCTGG + Intergenic
1122636001 14:103129983-103130005 TGGCCTGGAGGAGGAGGGGCAGG - Exonic
1122652121 14:103231760-103231782 GGTGCCAGTGCAGGAGGGGTGGG + Intergenic
1122769913 14:104093308-104093330 GCTCCAGGTGGAAGGGGGGCCGG + Intronic
1122771012 14:104097648-104097670 GGTGCACGTGGAGGCGGGGCAGG + Intronic
1122813410 14:104300221-104300243 GGCCCCGGTGGAGGAGGGCAGGG + Intergenic
1202852341 14_GL000225v1_random:29771-29793 GGTGATGGTGGAGGTGGGGCCGG - Intergenic
1123468174 15:20531239-20531261 GGTGCTGAGGGAGGAGGGGCAGG + Intergenic
1123649941 15:22469825-22469847 GGTGCTGAGGGAGGAGGGGCAGG - Intergenic
1123682013 15:22770210-22770232 GGTGCGGGAGCAGGAGGGGCAGG - Intergenic
1123682020 15:22770231-22770253 GGTGCGGGAGCAGGAGGGGCAGG - Intergenic
1123682027 15:22770252-22770274 GGTGCGGGAGCAGGAGGGGCAGG - Intergenic
1123682034 15:22770273-22770295 GGTGCGGGAGCAGGAGGGGCAGG - Intergenic
1123682041 15:22770294-22770316 GGTGCGGGAGCAGGAGGGGCAGG - Intergenic
1123682048 15:22770315-22770337 GGTGCGGGAGCAGGAGGGGCAGG - Intergenic
1123682055 15:22770336-22770358 GGTGCGGGAGCAGGAGGGGCAGG - Intergenic
1123682062 15:22770357-22770379 GGTGCGGGAGCAGGAGGGGCAGG - Intergenic
1123682069 15:22770378-22770400 GGTGCGGGAGCAGGAGGGGCAGG - Intergenic
1123682076 15:22770399-22770421 GGTGCGGGAGCAGGAGGGGCAGG - Intergenic
1123682083 15:22770420-22770442 GGTGCGGGAGCAGGAGGGGCAGG - Intergenic
1123682090 15:22770441-22770463 GGTGCGGGAGCAGGAGGGGCAGG - Intergenic
1123682097 15:22770462-22770484 GGTGCGGGAGCAGGAGGGGCAGG - Intergenic
1123682104 15:22770483-22770505 GGTGCGGGAGCAGGAGGGGCAGG - Intergenic
1123682111 15:22770504-22770526 GGTGCGGGAGCAGGAGGGGCAGG - Intergenic
1123682118 15:22770525-22770547 GGTGCGGGAGCAGGAGGGGCAGG - Intergenic
1123682125 15:22770546-22770568 GGTGCGGGAGCAGGAGGGGCAGG - Intergenic
1123682132 15:22770567-22770589 GGTGCGGGAGCAGGAGGGGCAGG - Intergenic
1123682139 15:22770588-22770610 GGTGCGGGAGCAGGAGGGGCAGG - Intergenic
1123682146 15:22770609-22770631 GGTGCGGGAGCAGGAGGGGCAGG - Intergenic
1123682153 15:22770630-22770652 GGTGCGGGAGCAGGAGGGGCAGG - Intergenic
1123682160 15:22770651-22770673 GGTGCGGGAGCAGGAGGGGCAGG - Intergenic
1123682167 15:22770672-22770694 GGTGCGGGAGCAGGAGGGGCAGG - Intergenic
1123682174 15:22770693-22770715 GGTGCGGGAGCAGGAGGGGCAGG - Intergenic
1123728490 15:23126449-23126471 GGTGCTGAGGGAGGAGGGGCAGG + Intergenic
1123740344 15:23278644-23278666 GGTGCTGAGGGAGGAGGGGCAGG - Intergenic
1123746654 15:23323914-23323936 GGTGCTGAGGGAGGAGGGGCAGG + Intergenic
1124278922 15:28347230-28347252 GGTGCTGAGGGAGGAGGGGCAGG + Intergenic
1124303777 15:28564378-28564400 GGTGCTGAGGGAGGAGGGGCAGG - Intergenic
1124813907 15:32968966-32968988 GGTGGCGGTGGAGGAGGCGGAGG + Exonic
1124952599 15:34337643-34337665 GGTCCCAGTAGAGGAGGAGACGG + Exonic
1125956196 15:43792665-43792687 GGTCTCCGTGGGGGATGGGCTGG - Intronic
1126049449 15:44673177-44673199 GGTGCTGGCTGAGGAGGGGCGGG - Intronic
1128061463 15:64738362-64738384 GGTCTGAGTGGAGGAGGAGCCGG - Intergenic
1128263879 15:66252137-66252159 GTTCCCGGAGTCGGAGGGGCCGG - Intronic
1128495851 15:68198105-68198127 AGGGCCCGTGGAGGAGGGGCTGG - Intronic
1129051228 15:72783543-72783565 GGTCCCGGGGGCGCAGGCGCGGG + Exonic
1129691387 15:77715675-77715697 GGCCCCAGCGCAGGAGGGGCTGG - Intronic
1129859217 15:78847201-78847223 GGGCGCGGTGGAGCAGGGGGCGG - Intronic
1130914028 15:88290827-88290849 GGGCCCAGTGCTGGAGGGGCTGG - Intergenic
1130960927 15:88658178-88658200 GGGGCCGGGGCAGGAGGGGCAGG + Intergenic
1131032475 15:89197731-89197753 GGCCCCTGTGGAGGACAGGCAGG + Exonic
1131125970 15:89857151-89857173 GGGCACGGTGGAGGAGAGACAGG + Intronic
1132036544 15:98489892-98489914 GGTCTCTAGGGAGGAGGGGCTGG - Intronic
1132105404 15:99059329-99059351 GGGCCCGCGGGAGGAGGGGGAGG - Intergenic
1132406083 15:101542599-101542621 TGTCCGGCAGGAGGAGGGGCAGG - Intergenic
1132594760 16:743658-743680 GCTCCGGGTGGAGCTGGGGCGGG + Intronic
1132885843 16:2181629-2181651 GGACCAGGAGGCGGAGGGGCAGG + Intronic
1132925947 16:2429246-2429268 GGTCCCGGAGCAGGCGGGGAGGG + Intergenic
1133018540 16:2955824-2955846 GGGGCCCGTGGAGGAGGGGGTGG + Intergenic
1133332270 16:4982123-4982145 GGCCCTGGTGGAGGACAGGCAGG + Intronic
1133357602 16:5148143-5148165 GGTCCTGGTGGGGAAGGGCCTGG + Intergenic
1134256295 16:12614596-12614618 CGGCGCGGTGGGGGAGGGGCGGG - Intergenic
1134554649 16:15154822-15154844 GGGCGCGGTGGGGGCGGGGCGGG + Intergenic
1134620541 16:15685763-15685785 GTTCTAGGTGGAGGAGGAGCTGG + Intronic
1135507460 16:23051337-23051359 GGTACAGGTGGATGAGAGGCTGG - Intergenic
1136222135 16:28835630-28835652 GGTCCCGGTGGCAGAGAGGGCGG - Exonic
1136358955 16:29765426-29765448 GGTCCCTGAAGTGGAGGGGCAGG - Intergenic
1136419504 16:30123119-30123141 GGTCCCGGGGGAGGTGGAGATGG - Exonic
1136539542 16:30921801-30921823 GGACCCCGATGAGGAGGGGCGGG + Intergenic
1137687307 16:50395163-50395185 GGACCAGGTGGTGAAGGGGCAGG + Intergenic
1137697009 16:50468288-50468310 GGCCCGGGTGGGGGTGGGGCGGG + Intergenic
1137731451 16:50693523-50693545 GGTCCCGGCAGAGCAGGGGCGGG + Intergenic
1138420036 16:56892963-56892985 GGCCCTGGTGAAGGAGGAGCAGG + Exonic
1138460047 16:57142691-57142713 TGTCCCAGTGGAGGGGGAGCTGG + Intronic
1138889844 16:61128838-61128860 GGAGCCGGTGGGGGAGGGGCGGG + Intergenic
1139280127 16:65763563-65763585 GGGCCCCTTGGAAGAGGGGCAGG + Intergenic
1140696406 16:77538664-77538686 TGCCCTGGTGGAAGAGGGGCAGG + Intergenic
1140859508 16:79006674-79006696 GATCCAGGTGTAGGTGGGGCTGG + Intronic
1141478767 16:84292349-84292371 GGTGCGGGTGGAGGAGGCCCAGG + Intergenic
1141612174 16:85187941-85187963 GGTCCAGGTGGGGGAAGGGAAGG - Intergenic
1141755459 16:85987804-85987826 GGTCCCAGAGGAGGATGGGGAGG - Intergenic
1141766127 16:86061003-86061025 GGTCCCTCGGGAGAAGGGGCAGG + Intergenic
1142006002 16:87689872-87689894 GGTGTCGGTGGACGAGGAGCGGG + Exonic
1142142901 16:88480446-88480468 GGTGCTGGTGGGGGAGGAGCGGG + Intronic
1142237079 16:88927441-88927463 TGCCGGGGTGGAGGAGGGGCTGG + Intronic
1142281888 16:89153214-89153236 GGCCCAGGCGCAGGAGGGGCTGG - Intronic
1142290795 16:89192878-89192900 GGTTACGGAGGAGGAGGAGCTGG - Intronic
1142378819 16:89720748-89720770 GGCCCCGGGTGAGGCGGGGCGGG - Exonic
1142380195 16:89727576-89727598 GGTGGCGGGAGAGGAGGGGCTGG + Intronic
1142412515 16:89923732-89923754 AGGCCCGGTGGAGGGGGTGCAGG - Intronic
1142416596 16:89946734-89946756 GGCCCCGGTGGGGGTGGGCCTGG + Intergenic
1142648531 17:1330810-1330832 GGTACCTGTGCAGGAGGTGCAGG + Intergenic
1142763979 17:2055833-2055855 AGTTCCGGGGGAGAAGGGGCCGG + Intronic
1142810165 17:2392345-2392367 GGGCCCGGTGAAGTAGGAGCCGG - Intronic
1143025196 17:3937483-3937505 GGCTGCGGTGGAGGAGGGCCGGG - Exonic
1143474830 17:7196628-7196650 GGTCCAGGTGGAGCAGGGAGTGG + Intronic
1143608240 17:8003122-8003144 GGGCCCGGGGGAGGCGGGGCAGG - Exonic
1144779153 17:17799248-17799270 GGTGCCCATGGAGGAGGGGTCGG + Intronic
1144786935 17:17837136-17837158 GGGCGCTCTGGAGGAGGGGCCGG - Intergenic
1144950938 17:18993042-18993064 GGTGCCTGGGGAGGAGGGGTGGG + Intronic
1145041259 17:19579820-19579842 GGTCCGGGACGGGGAGGGGCGGG + Intergenic
1146000430 17:29127443-29127465 GGTCCCAGGGGATGAGTGGCTGG + Intronic
1146714044 17:35068782-35068804 GGACCCGATGGAGGAGGAGGAGG + Intronic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1147123941 17:38352665-38352687 GGTCGCGGAGGAGGAGGGGGCGG + Exonic
1147182601 17:38696028-38696050 ATTCCAGGTGGAAGAGGGGCTGG + Intergenic
1147314694 17:39614039-39614061 CTTCCCGGAGGAGGAGGGCCTGG - Intergenic
1147364919 17:39953159-39953181 GGGCTGGGTGGAGGCGGGGCTGG + Intergenic
1147459006 17:40556785-40556807 GGTCAAGGTTGAGGAGGGCCTGG + Intronic
1147657370 17:42098494-42098516 GGGCCCGGCGGGGCAGGGGCGGG + Intergenic
1148054632 17:44786828-44786850 GGTTCAGGTGGCGGAGGGCCAGG - Intergenic
1148118194 17:45190401-45190423 GGTACCTGTCGGGGAGGGGCTGG + Intergenic
1148239152 17:45988510-45988532 TGTCCCTATGGAGGCGGGGCTGG - Intronic
1148502198 17:48100687-48100709 GGACACGGAGGGGGAGGGGCAGG - Intronic
1148738777 17:49880392-49880414 GGTCCCGGCTGAGGGGTGGCAGG - Intergenic
1148740467 17:49889887-49889909 GGTTCCAGTGGGGGTGGGGCAGG + Intergenic
1148773271 17:50079078-50079100 GGGCCCAATGGGGGAGGGGCTGG + Exonic
1148970154 17:51472851-51472873 GGGGCTGGTGGAGGTGGGGCAGG + Intergenic
1150819095 17:68420611-68420633 GGTCGGCGTGGAGGAGGGACAGG - Exonic
1151518855 17:74614361-74614383 GTTCCAGGAGGAGGAGGGGAAGG + Intronic
1151535566 17:74737170-74737192 GGTCCCGGTCGAGGGAGGGGAGG + Intronic
1151732095 17:75917686-75917708 GGCCCCGTGGCAGGAGGGGCAGG + Intronic
1151803060 17:76388986-76389008 TGTCCCTGTGGAGGAGTGCCAGG + Intergenic
1151888900 17:76940567-76940589 GGTCCCCGATCAGGAGGGGCCGG + Intronic
1152208657 17:78990978-78991000 GGACCCGGAGGAGGCGGGGAAGG + Intergenic
1152424208 17:80210231-80210253 GCCCCTGGTGGTGGAGGGGCTGG + Exonic
1152456792 17:80421513-80421535 GGTCCCGGTGGGGGCGGGGTGGG + Intronic
1152584175 17:81181765-81181787 GGACCCGGTGGGGGAAGGCCGGG - Intergenic
1152610540 17:81313136-81313158 GGCCCCGGTGGGGCTGGGGCTGG + Exonic
1152652006 17:81499219-81499241 TGTCCCGGGCGAGGCGGGGCCGG - Intergenic
1152739907 17:82014312-82014334 GGTCCAGGTGGGGTAGGGCCTGG - Intronic
1152861219 17:82698020-82698042 GGCCGCGGGGCAGGAGGGGCGGG - Intronic
1153794380 18:8609420-8609442 CATCCCGGACGAGGAGGGGCAGG - Intergenic
1154475299 18:14748737-14748759 GGAGCAGGTGGAGGAGTGGCGGG + Intronic
1154529431 18:15329947-15329969 GGAGCAGGTGGAGGAGTGGCGGG - Intergenic
1156337370 18:36183632-36183654 GGTCCTGGAGGAGGAGGTGGGGG - Intergenic
1156591232 18:38490952-38490974 GGTGCTGGTGGAACAGGGGCAGG - Intergenic
1157484239 18:48075656-48075678 TTTCTGGGTGGAGGAGGGGCAGG + Intronic
1157565398 18:48676020-48676042 GGTCCTGGGGGAGGGGGTGCCGG - Intronic
1157604645 18:48918264-48918286 GGTAGCGGCGGAGGAGGGGCAGG - Intergenic
1158884689 18:61815998-61816020 GGAGGCGGTGGAGGAGGAGCAGG - Exonic
1160176568 18:76600163-76600185 GGGCCCCGTGGAGCAGGGGGTGG + Intergenic
1160559491 18:79747272-79747294 GTTACAGGTGGAAGAGGGGCAGG - Intronic
1160562864 18:79770549-79770571 GGTCCAGAGGGAGGAGGTGCGGG + Intergenic
1160693379 19:470652-470674 GGGGCGGCTGGAGGAGGGGCAGG - Intronic
1160703288 19:518195-518217 GGCCCAGGTTGAGTAGGGGCTGG + Intronic
1160703356 19:518360-518382 GGCCCAGGTTGAGTAGGGGCTGG + Intronic
1160752374 19:740501-740523 GGCCCAGGTGGAGGGAGGGCAGG - Intronic
1160847835 19:1174129-1174151 GGTCGCGGTGGAGCCGGGGCGGG + Intronic
1160881664 19:1323555-1323577 GGTCTCGGTGCAGGAGGTGGAGG + Intergenic
1161029006 19:2049443-2049465 CGTCTTGGTGGAGGAGGGCCTGG - Intronic
1161056022 19:2190944-2190966 GGTCTTGGTGGTGGAGGGGCTGG + Intronic
1161079410 19:2303131-2303153 GGTCCGGGCTGGGGAGGGGCTGG - Intronic
1161224550 19:3136986-3137008 CGTCCTGGTGAAGGAGAGGCTGG - Intronic
1161543802 19:4867786-4867808 GGGCCTAGTGGAGGCGGGGCAGG - Intergenic
1162109212 19:8390946-8390968 GGGCCCGGGAGAGGCGGGGCAGG + Intronic
1162159088 19:8698474-8698496 GGCCACGGTGTAGGTGGGGCTGG + Exonic
1162315490 19:9936153-9936175 GGTCGCAGCGGGGGAGGGGCCGG - Intronic
1162333767 19:10047262-10047284 GGCTCCGTTGGGGGAGGGGCTGG - Intergenic
1162500502 19:11050805-11050827 GGTGCAGGTGGAGGGTGGGCAGG + Intronic
1162742703 19:12782707-12782729 GGTCCCGGCCGGGGCGGGGCTGG - Intronic
1162861153 19:13506470-13506492 GACCCCGGAGAAGGAGGGGCGGG + Intronic
1163034780 19:14564337-14564359 GGGCTCGGTGGGGGCGGGGCGGG - Intronic
1163487290 19:17595675-17595697 GCTCCTGGTGGAGGAGGTTCTGG - Intergenic
1163521196 19:17793025-17793047 GTACCTGGTGGAGGAGGGGATGG + Intergenic
1163551180 19:17967171-17967193 GGGCCCGGGGGCGGCGGGGCCGG - Intronic
1163580769 19:18137371-18137393 GATCCCCCTGGAGGGGGGGCGGG + Intronic
1163610926 19:18301199-18301221 GGTTCCAGTGGAGGCGGGGCAGG + Intergenic
1163731808 19:18953955-18953977 AGTCCTGTGGGAGGAGGGGCTGG + Intergenic
1163807081 19:19405926-19405948 GGGCCGGGCGGCGGAGGGGCCGG - Intronic
1163861848 19:19747021-19747043 TGGCCCAGGGGAGGAGGGGCAGG - Intergenic
1164155628 19:22595551-22595573 GGTGCGGGAGGAGGAGGAGCTGG + Intergenic
1164525263 19:29008806-29008828 GGGCCTGGTGCAGGAGGGGCAGG + Intergenic
1165062501 19:33211706-33211728 TGTCCAGGTGGGGGTGGGGCAGG - Intronic
1165064590 19:33221585-33221607 GGGCCCCGGTGAGGAGGGGCTGG + Intronic
1165253618 19:34559349-34559371 GGTCCCGGGGGAGGGGGTGCCGG + Intergenic
1165392154 19:35545080-35545102 CGTACCTGTGGAGGAGGGGTCGG - Exonic
1165432522 19:35780841-35780863 GGGCCTGGTGGGGTAGGGGCTGG - Intronic
1165453885 19:35900029-35900051 GGTCTCGGTGGGGAAGGGTCCGG - Intronic
1165489674 19:36115804-36115826 GGACCCGGTCGCGGCGGGGCGGG + Intronic
1165745159 19:38226300-38226322 GGTCCGGGTGGAAGAGGGGAAGG - Intronic
1165745623 19:38228518-38228540 GGGCCTGGTGGAGGAGGCGGAGG - Intronic
1165938458 19:39403350-39403372 GGTTCCGAGGGAGGAGGGGCTGG + Intergenic
1165958435 19:39515958-39515980 GTTCTCGCTGGAGGAGGGGAAGG - Exonic
1166306854 19:41940246-41940268 GAGCCCGGGGGCGGAGGGGCGGG + Intergenic
1166360443 19:42250875-42250897 GCTGCCAGTGGGGGAGGGGCAGG + Intronic
1166373648 19:42315538-42315560 GGTCCTGGGGGAGGAGGGGCTGG + Intronic
1166373678 19:42315613-42315635 GGTCCTGGGGGAGAAGGGGCTGG + Intronic
1166373689 19:42315643-42315665 GTTCCTGGGGGAGGATGGGCTGG + Intronic
1166373708 19:42315681-42315703 GTTCCTGGGGGAGGAGGGGGTGG + Intronic
1166373806 19:42316151-42316173 GGTCCTGGAGGAGGAGGGTCTGG + Intronic
1166532709 19:43552471-43552493 GGGCCTGAGGGAGGAGGGGCTGG - Intronic
1166545880 19:43634828-43634850 GAACCTGATGGAGGAGGGGCTGG - Intronic
1166546215 19:43636045-43636067 GGATCTGATGGAGGAGGGGCTGG - Intronic
1166682669 19:44778338-44778360 GGGTCTGGGGGAGGAGGGGCTGG - Intronic
1166694657 19:44845958-44845980 GGGGCTGGTGGAGGCGGGGCTGG + Intergenic
1166734308 19:45075521-45075543 GGTGGCGGTGGAGGGGGGGCGGG - Intronic
1166820767 19:45578402-45578424 GGTGGCGGTGGGGGAGGGGGAGG - Intronic
1166982595 19:46639792-46639814 GGCCGCGGTGGAGGAGCGGGAGG - Intergenic
1167019158 19:46861267-46861289 GGTCCAGGGGGAGGCGGGGACGG + Intergenic
1167211347 19:48135934-48135956 GGGCCCGCTGGGGAAGGGGCGGG + Intronic
1167264899 19:48478609-48478631 GGGCCTGATGGAGGAGGGGCTGG + Intronic
1167264913 19:48478645-48478667 GGGTCTGATGGAGGAGGGGCAGG + Intronic
1167264926 19:48478681-48478703 GGGTCTGATGGAGGAGGGGCTGG + Intronic
1167298297 19:48664429-48664451 GGGCCTGAGGGAGGAGGGGCTGG - Intronic
1167322994 19:48807679-48807701 GGGTCTGGCGGAGGAGGGGCTGG - Intronic
1167328197 19:48837647-48837669 GGGTCTGATGGAGGAGGGGCTGG - Intronic
1167338363 19:48900440-48900462 GGTCCCGGAGGAGGATGCACTGG + Intronic
1167425441 19:49427672-49427694 GGGTCCGAGGGAGGAGGGGCTGG + Intronic
1167425472 19:49427746-49427768 GGGTCCGAGGGAGGAGGGGCTGG + Intronic
1167425842 19:49429190-49429212 GGGTCCGGGAGAGGAGGGGCTGG + Intergenic
1167425857 19:49429226-49429248 GGGTCCGGGAGAGGAGGGGCTGG + Intergenic
1167471322 19:49677724-49677746 GGTCCCCGGGGAGGAGGGCTGGG - Intronic
1167495902 19:49818635-49818657 GGGCCTGAGGGAGGAGGGGCCGG + Intronic
1167549255 19:50148192-50148214 GGACCCGGCGGAGGAAGGGAAGG - Intergenic
1167593168 19:50415180-50415202 GTTCCCAGAGGAGGAGGGGCTGG - Intronic
1167596912 19:50432719-50432741 GGTCCCCAGGGAGGAGGGGCTGG - Intergenic
1167666852 19:50827321-50827343 GGTCCTTGAGGAGCAGGGGCTGG - Intronic
1167678853 19:50906839-50906861 GGGCCTGAGGGAGGAGGGGCTGG + Exonic
1167689146 19:50974961-50974983 GGGCCTGAGGGAGGAGGGGCTGG + Intergenic
1167690089 19:50980002-50980024 GGTTCCGAGGGAGGAGGGTCTGG + Intronic
1167738303 19:51310680-51310702 GGGCCTGAGGGAGGAGGGGCTGG + Intergenic
1167793065 19:51692568-51692590 GTTCCTTGGGGAGGAGGGGCCGG + Intergenic
1167990729 19:53358396-53358418 GGGCCCGGGCGAGGAAGGGCGGG - Intergenic
1168057089 19:53869866-53869888 GGGTCCGAGGGAGGAGGGGCTGG + Intronic
1168057106 19:53869903-53869925 GGGTCCGAGGGAGGAGGGGCTGG + Intronic
1168057144 19:53869985-53870007 GGGTCCGAGGGAGGAGGGGCTGG + Intronic
1168057161 19:53870022-53870044 GGGTCCGAGGGAGGAGGGGCTGG + Intronic
1168057177 19:53870059-53870081 GGGTCCGAGGGAGGAGGGGCTGG + Intronic
1168057220 19:53870168-53870190 GGGTCCGAGGGAGGAGGGGCTGG + Intronic
1168057234 19:53870204-53870226 GGGTCCGAGGGAGGAGGGGCTGG + Intronic
1168057248 19:53870240-53870262 GGGTCCGAGGGAGGAGGGGCTGG + Intronic
1168057265 19:53870277-53870299 GGGTCCGAGGGAGGAGGGGCTGG + Intronic
1168057282 19:53870314-53870336 GGGTCCGAGGGAGGAGGGGCTGG + Intronic
1168057296 19:53870350-53870372 GGGTCCGAGGGAGGAGGGGCTGG + Intronic
1168106518 19:54168729-54168751 AGTCCAGGGGTAGGAGGGGCTGG - Intronic
1168107242 19:54172606-54172628 GGGCCTGAGGGAGGAGGGGCTGG - Intronic
1168238170 19:55076297-55076319 GGGCCTGAGGGAGGAGGGGCTGG + Intronic
1168238502 19:55078197-55078219 GGTCTTGGAGGAGGAGGGGCTGG + Intronic
1168238770 19:55078937-55078959 GGGTCTGATGGAGGAGGGGCTGG + Intronic
1168246184 19:55114114-55114136 GGGTCCGAGGGAGGAGGGGCTGG - Intronic
1168246213 19:55114187-55114209 GGGTCCGAGGGAGGAGGGGCTGG - Intronic
1168266154 19:55225006-55225028 GGGTCTGGGGGAGGAGGGGCTGG - Intergenic
1168280375 19:55302420-55302442 GGATCCGAGGGAGGAGGGGCTGG + Intronic
1168325512 19:55536793-55536815 GGGCCTGGCGGAGGAGGGGCTGG - Intronic
1168327889 19:55547180-55547202 AGTCCTGCAGGAGGAGGGGCTGG - Intergenic
1168332984 19:55580491-55580513 GGTCCCGGTGGAGGAGGGGCTGG + Intronic
1168340740 19:55621789-55621811 GGACCCTGCGGAGGAGGGGCGGG - Exonic
1168347143 19:55655402-55655424 GGTCCTGGCGGAGGTGGCGCGGG + Intronic
925165073 2:1710878-1710900 GGTGCTGGTGGAGCAGGTGCTGG - Intronic
926103429 2:10135475-10135497 GGCCCTGGTGGGGGAGGGGAGGG + Intergenic
926125178 2:10267606-10267628 TGTCCGGGTGAGGGAGGGGCTGG + Intergenic
926224322 2:10956351-10956373 GGTCTGGGGAGAGGAGGGGCTGG - Intergenic
926742736 2:16125936-16125958 GGTCCCTGTGGTGGAGGCACAGG - Intergenic
927053377 2:19350404-19350426 GTTCCCGGAGGAGGTGGGGATGG + Intergenic
927478668 2:23433410-23433432 GGTGTTGGGGGAGGAGGGGCAGG + Intronic
927990436 2:27443220-27443242 GGTACCACTGGATGAGGGGCCGG + Exonic
928490542 2:31778453-31778475 GGTGCTGGTGGAGGTGGGGCTGG - Intergenic
930022172 2:47008077-47008099 GGGCCGGGAGGAGGTGGGGCTGG + Intronic
931495491 2:62802285-62802307 TGTCTTGCTGGAGGAGGGGCAGG + Intronic
931671635 2:64653550-64653572 GCTCCGGGTGGATGGGGGGCCGG - Intronic
932429781 2:71667404-71667426 GGGCCCAGTGGAGGAGCGTCTGG + Exonic
932592541 2:73075910-73075932 GGTCCTGGTGAGGGTGGGGCAGG - Intronic
934141262 2:89050166-89050188 GATCCCGGGGGAGGAGGTCCTGG - Intergenic
934561436 2:95315521-95315543 GGTCAGGGAGGTGGAGGGGCAGG - Intronic
934953832 2:98599937-98599959 AGTCCCTGTGGAAGAGGGGATGG - Exonic
936388788 2:112054575-112054597 GGGCCGCGTGGAGGCGGGGCCGG - Intergenic
936388825 2:112054691-112054713 GGGCCGTGTGGAGGCGGGGCGGG - Intergenic
936388869 2:112054823-112054845 GGGCCGTGTGGAGGCGGGGCGGG - Intergenic
937333168 2:121044649-121044671 GGCCCCGGTGAAGGAGGCACTGG + Intergenic
938364670 2:130725669-130725691 GGGCCCGGGGGCGGGGGGGCTGG + Intergenic
938528529 2:132161369-132161391 GGAGCAGGTGGAGGAGTGGCGGG - Intronic
938786464 2:134634455-134634477 GGTGAGGGTGGAGGAGGAGCTGG - Intronic
940517574 2:154699488-154699510 TCTCCCGGTGGGGAAGGGGCGGG - Intronic
943501294 2:188693021-188693043 GGTGCTGGTGGGGGTGGGGCTGG + Intergenic
944199911 2:197095519-197095541 GGTCCTGGTGGCTGAGGTGCAGG - Intronic
944849804 2:203706648-203706670 GTTCCTCGGGGAGGAGGGGCTGG + Exonic
946202427 2:218078396-218078418 GGCCCTGATGGAGGACGGGCAGG + Intronic
946395554 2:219442165-219442187 GGGCCCGGTGGAGGGGGCGCTGG + Intronic
947628110 2:231633979-231634001 GGCCCCAGGGGAGGAGGGCCAGG + Intergenic
947958994 2:234218797-234218819 GGGCTGGGAGGAGGAGGGGCTGG + Intergenic
948212978 2:236208614-236208636 TGACCCGGTGGGGGAGGGGCGGG - Intronic
948455801 2:238104119-238104141 GGGCCCGGAGGTGGAGGGTCTGG + Intronic
948826555 2:240575882-240575904 GGGCCTGGTGCAGGAAGGGCGGG + Intronic
948983128 2:241505189-241505211 GGGCCTGCTGGAGGAGGAGCAGG - Intronic
1168800878 20:642566-642588 GGTCCCGGCGGCGGACGCGCGGG + Intergenic
1168811318 20:706503-706525 GGTCCTGGTGAACGGGGGGCAGG - Intergenic
1169004878 20:2198471-2198493 ATTCCCAGTGGAGGAGAGGCAGG + Intergenic
1169065517 20:2692704-2692726 GGGCCCGGGGGAGGCGGGGGCGG - Intergenic
1169244597 20:4015583-4015605 GGGCCCGCCGGGGGAGGGGCGGG + Intergenic
1169352572 20:4881026-4881048 TGTTCCGGAGGAGGAAGGGCAGG + Intronic
1170026151 20:11891225-11891247 GGTGCCGGGGGCGGAGGGGCAGG + Intronic
1170574379 20:17651648-17651670 CTTCCCGGGGGTGGAGGGGCGGG - Intronic
1170890133 20:20369008-20369030 GGGCCCGGTGGAGGCGCCGCGGG + Exonic
1171346348 20:24469306-24469328 GGCCCCGGGGGAGGAGGGCAGGG - Exonic
1171406801 20:24917228-24917250 GTGCCCGGTGCAGGAGGGGCCGG - Intergenic
1171940487 20:31324075-31324097 AGTCCCAGTTGAGGAGGGGTAGG - Intergenic
1172118110 20:32583683-32583705 GGTCCCGGCGGGGGAGCCGCGGG + Intronic
1172266822 20:33623120-33623142 GTTCCCGCTGCAGCAGGGGCAGG - Exonic
1172591403 20:36120670-36120692 GGACCCAGTGGAGGAGCAGCTGG - Intronic
1172662064 20:36574492-36574514 GGGCCCGGAGGGGGAGGGGAGGG - Intronic
1172882989 20:38213641-38213663 GGTAGCGGTGGAGGCGGCGCTGG + Exonic
1173551419 20:43935423-43935445 GGTACCAGTGGAGTTGGGGCGGG + Intronic
1173664450 20:44754617-44754639 GGGGGCGGAGGAGGAGGGGCTGG + Intronic
1173789136 20:45816280-45816302 GGAGGAGGTGGAGGAGGGGCTGG - Intronic
1173792042 20:45834122-45834144 GGCGCAGGAGGAGGAGGGGCGGG - Intronic
1173865111 20:46308220-46308242 GGTGCCGCGGGAGGAGCGGCCGG - Intronic
1173936733 20:46872840-46872862 GTTTCCGGGGGTGGAGGGGCGGG - Intergenic
1173979315 20:47210969-47210991 GTTTCCTGTGCAGGAGGGGCAGG - Intronic
1175251128 20:57610810-57610832 GGTCTCGGGGGTGGAGGGGGCGG - Intronic
1175284586 20:57829559-57829581 GGCCTGGGTGGAGGAGGGACGGG - Intergenic
1175501298 20:59452957-59452979 GGTGCAGCTGGAGGAGGTGCAGG + Intergenic
1175515669 20:59568389-59568411 TGCCCAGGTGGAGGAGGGTCAGG + Intergenic
1175844105 20:62049648-62049670 GTGCACGGTGGATGAGGGGCAGG - Intronic
1175903416 20:62368693-62368715 GCTCCAAGTGGGGGAGGGGCTGG + Intergenic
1175910165 20:62401466-62401488 GGTGCCTCTGGAGGATGGGCTGG + Intronic
1175921184 20:62451267-62451289 CCCCCAGGTGGAGGAGGGGCTGG - Intergenic
1175926085 20:62472292-62472314 GGTCCCAGTGGAGCAGGTGGTGG - Intronic
1175960681 20:62634821-62634843 TGGTCAGGTGGAGGAGGGGCGGG + Intergenic
1176034108 20:63028081-63028103 GGGGCCGGTGGAGAGGGGGCCGG + Intergenic
1176081008 20:63273008-63273030 GGTCCGGGTGGAGGAGGCTGCGG - Intronic
1176128563 20:63486844-63486866 GGTCAGGGTGGAGGATGGGCAGG - Intergenic
1176128607 20:63486973-63486995 GGTCTGGGTGGAGGGTGGGCAGG - Intergenic
1176180488 20:63747367-63747389 GGGCCTGGTGGAGGTGGGGGGGG + Intronic
1176180518 20:63747443-63747465 GGGCCTGGTGGAGGTGGGGGGGG + Intronic
1176180535 20:63747484-63747506 GGGCCCGGTGGAGGTTGGGAGGG + Intronic
1176194373 20:63830754-63830776 GGTGCCGGGGGCCGAGGGGCCGG + Intronic
1176304699 21:5117294-5117316 GGTGAGGGTGGGGGAGGGGCCGG - Intronic
1176381573 21:6116550-6116572 GGTCCCGGTGGACGATGTGATGG - Exonic
1176414641 21:6467632-6467654 GGGTGGGGTGGAGGAGGGGCTGG - Intergenic
1178701030 21:34834363-34834385 GGCCCAGGTGCAGGAGAGGCGGG + Intronic
1179015282 21:37590474-37590496 GCTCCCGGGGGAGGAGGTTCTGG + Intergenic
1179106396 21:38404466-38404488 GGGCCCGGGGGAGAAGGAGCAGG + Intronic
1179270276 21:39845327-39845349 GGTGGCGATGGAGGAGGGGGAGG + Intergenic
1179406195 21:41127829-41127851 GGACCCGGGGAAGGAGGGGTGGG - Intergenic
1179493484 21:41756569-41756591 GGTCCAGGTGCAGGAGTGGCGGG + Exonic
1179627900 21:42658894-42658916 GGTGGCGGTGGTGGAGGGACAGG + Intronic
1179690141 21:43075954-43075976 GGGTGGGGTGGAGGAGGGGCTGG - Intronic
1179741899 21:43421689-43421711 GGTCCCGGTGGACGATGTGATGG + Exonic
1179852355 21:44144736-44144758 GGTGAGGGTGGGGGAGGGGCCGG + Intronic
1179862431 21:44197337-44197359 GGGCCTGGTGGAGGAGGTCCTGG + Intergenic
1179881955 21:44296663-44296685 GCTCCCGCAGGGGGAGGGGCCGG - Intronic
1180048968 21:45322796-45322818 GGAGCAGGGGGAGGAGGGGCGGG - Intergenic
1180163611 21:46009072-46009094 TGTCCTGGTGCAGGAGGAGCTGG + Intergenic
1180201879 21:46229153-46229175 GGTGCGGGTGGGGGCGGGGCTGG + Intergenic
1180228966 21:46414822-46414844 TGTCCAGGAGGAGGAGGAGCAGG - Intronic
1180432528 22:15264803-15264825 GGAGCAGGTGGAGGAGTGGCGGG + Intergenic
1180647042 22:17347835-17347857 GGTCCCAGTGGACGTGGTGCGGG - Intergenic
1180707240 22:17817357-17817379 GGCCCCGCTGGAGGGGGTGCTGG + Exonic
1180868208 22:19131786-19131808 GGTCCCGGTGGACGATGTCCAGG - Exonic
1180950098 22:19717069-19717091 GGCACCTGGGGAGGAGGGGCAGG - Intronic
1180953565 22:19731432-19731454 GGGCCCCGTGGAGGAGGTCCTGG + Intergenic
1181450499 22:23017085-23017107 GGGCGCGGTGGAGCAGGGGGCGG + Intergenic
1181480159 22:23193785-23193807 GGTCCCTGTGGAGGAGTGACAGG + Intronic
1182082203 22:27537584-27537606 TGTTACGGTGGAGGAGGGGTTGG - Intergenic
1182143795 22:27984441-27984463 GGGGCCTGTGGAGGAGGGGGTGG - Intronic
1183107161 22:35622797-35622819 GGTGACTGTGGAGGCGGGGCTGG - Intronic
1183393664 22:37560195-37560217 GGAACCGGTGGAAGAGGGGTTGG + Intergenic
1183441186 22:37823967-37823989 GTTCACAGTGGAGGAGGGGAAGG - Intronic
1183540622 22:38427409-38427431 GGTCCCGCTGGTCCAGGGGCAGG + Exonic
1183619462 22:38964340-38964362 GGTTCTGGGGGACGAGGGGCAGG - Intronic
1184111760 22:42399640-42399662 GGTCACAGTGGAGGCTGGGCCGG + Intronic
1184412050 22:44331374-44331396 GCTCCTGGCGGAGGAGGGTCTGG - Intergenic
1184412710 22:44333989-44334011 GGTGCTGGTGGTGGCGGGGCTGG + Intergenic
1184667788 22:45997715-45997737 GGTTCCAGTGGTGGAGGGGGTGG - Intergenic
1184688597 22:46107465-46107487 GGCCCAGGCGGGGGAGGGGCCGG - Intronic
1184715928 22:46281829-46281851 GGTGCAGGTGGAGGAGGAGAGGG - Intronic
1184863266 22:47188918-47188940 GGAGCCTGAGGAGGAGGGGCTGG + Intergenic
1185005922 22:48277007-48277029 GGCCCTGGAGGAGGATGGGCTGG - Intergenic
1185044680 22:48523051-48523073 GGTCACGGTGGAGGATGGCCAGG + Intronic
1185072113 22:48662124-48662146 GCTCCAGGTGGACGTGGGGCTGG + Intronic
1185166445 22:49265384-49265406 CTTCCCGGTGGAGGAGAGGAGGG + Intergenic
1185166456 22:49265417-49265439 CTTCCCGGTGGAGGAGAGGAGGG + Intergenic
1185166535 22:49265648-49265670 CTTCCCGGTGGAGGAGAGGGGGG + Intergenic
1185166546 22:49265681-49265703 CTTCCCGGTGGAGGAGAGGAGGG + Intergenic
1185166568 22:49265747-49265769 CTTCCCGGTGGAGGAGAGGAGGG + Intergenic
1185166603 22:49265846-49265868 CTTCCCGGTGGAGGAGAGGGGGG + Intergenic
1185166627 22:49265912-49265934 CTTCCCGGTGGAGGAGAGGGGGG + Intergenic
1185166640 22:49265945-49265967 CTTCCCGGTGGAGGAGAGGGGGG + Intergenic
1185166673 22:49266044-49266066 CTTCCCGGTGGAGGAGAGGAGGG + Intergenic
1185166686 22:49266077-49266099 CTTCCCGGTGGAGGAGAGGGGGG + Intergenic
1185166710 22:49266143-49266165 CTTCCCGGTGGAGGAGAGGGGGG + Intergenic
1185166734 22:49266209-49266231 CTTCCCGGTGGAGGAGAGGGGGG + Intergenic
1185166758 22:49266275-49266297 CTTCCCGGTGGAGGAGAGGGGGG + Intergenic
1185166782 22:49266341-49266363 CTTCCCGGTGGAGGAGAGGGGGG + Intergenic
1185166806 22:49266407-49266429 CTTCCCGGTGGAGGAGAGGGGGG + Intergenic
1185210323 22:49567025-49567047 GCTCACGGTGGAGTAGGAGCCGG + Intronic
1185247443 22:49780653-49780675 GGTCCAGGTGGAGGCTGGGAGGG - Intronic
1185272510 22:49935644-49935666 GGTCCGGGAGGAGCAGGGGCGGG + Intergenic
1185272581 22:49935811-49935833 GGTCCAGGAGGAGCAGGGGTAGG + Intergenic
1185284354 22:49993771-49993793 GGCCACCGTGGAGGTGGGGCTGG - Intergenic
1185333169 22:50260689-50260711 CGACCCGGTGGTGGAGGGGGAGG - Intronic
1185360451 22:50403661-50403683 GGGCCCGATGGAGTAGGGTCAGG - Intronic
1185409602 22:50674820-50674842 GGTCCCGGCGGAGGCGGCGGGGG - Intergenic
949770046 3:7568920-7568942 GGCACCGGTGGAGCAGGGGGCGG - Intronic
950205463 3:11076849-11076871 GGGCGAGGTGGAGGAGGAGCAGG - Intergenic
950409414 3:12825588-12825610 TCTCCTGGTAGAGGAGGGGCAGG - Exonic
950634907 3:14307823-14307845 TGTGCTGGAGGAGGAGGGGCTGG - Intergenic
950670086 3:14520728-14520750 GATAGCAGTGGAGGAGGGGCAGG + Intronic
950680223 3:14580109-14580131 GGTCCCTGTGGGGCAGGGGCTGG + Intergenic
951485223 3:23202995-23203017 CGCGCCGGAGGAGGAGGGGCGGG + Intergenic
951823144 3:26836544-26836566 GGTGCTGGTGGTGGAGGTGCTGG + Intergenic
952241208 3:31532906-31532928 GGACCCGGAGGAGGAGGAGGAGG - Exonic
953173087 3:40525118-40525140 GGTCCGGGTGAAGGAGGGGCGGG - Exonic
953889764 3:46743194-46743216 GGGGCCGGTGAAGGAGGGGAGGG - Intronic
954106112 3:48410618-48410640 TGTCCCTGTGGAGGAGGAGATGG - Intronic
954378028 3:50205172-50205194 CGGCCCGCGGGAGGAGGGGCTGG - Intergenic
954801667 3:53190569-53190591 ATTCCAGGTGGAAGAGGGGCTGG + Intronic
954861593 3:53695168-53695190 GGTCCCCGTGGAGGAGGTGCTGG + Intronic
954873806 3:53787558-53787580 GGCCCAGGTGGAGGAGGGAGAGG - Intronic
961182457 3:124887269-124887291 GCTCCGGGTAGGGGAGGGGCTGG + Exonic
961427828 3:126861794-126861816 GGTGATGGTGGAGGAGGGGGAGG - Intronic
961427845 3:126861842-126861864 GGTGATGGTGGAGGAGGGGGAGG - Intronic
961427854 3:126861866-126861888 GGTGATGGTGGAGGAGGGGGAGG - Intronic
961427900 3:126862007-126862029 GGTGATGGTGGAGGAGGGGGAGG - Intronic
961427909 3:126862031-126862053 GGTGATGGTGGAGGAGGGGGAGG - Intronic
961427940 3:126862127-126862149 GGTGATGGTGGAGGAGGGGGAGG - Intronic
961427949 3:126862151-126862173 GGTGATGGTGGAGGAGGGGGAGG - Intronic
961428046 3:126862499-126862521 GGTGATGGTGGAGGAGGGGGAGG - Intronic
961428078 3:126862610-126862632 GGTGATGGTGGAGGAGGGGGAGG - Intronic
961428093 3:126862658-126862680 GGTGATGGTGGAGGAGGGGGAGG - Intronic
961428102 3:126862682-126862704 GGTGATGGTGGAGGAGGGGGAGG - Intronic
961428245 3:126863177-126863199 GGTGATGGTGGAGGAGGGGGAGG - Intronic
961428261 3:126863225-126863247 GGTGATGGTGGAGGAGGGGGAGG - Intronic
961428379 3:126863651-126863673 GGTGATGGTGGAGGAGGGGGAGG - Intronic
961428516 3:126864181-126864203 GGTGATGGTGGAGGAGGGGGAGG - Intronic
961657627 3:128452172-128452194 GTTGCGGGTGGAGGAGGAGCTGG - Intergenic
962343310 3:134602667-134602689 GCTCTCTGTGGAGGTGGGGCAGG + Intronic
964606193 3:158562801-158562823 GGTCGGGGTGGGGGCGGGGCGGG - Intergenic
965683500 3:171276378-171276400 GGAACCTGTGGAGGAGGGGCTGG + Intronic
965693231 3:171380103-171380125 GGACCAGGTTGAGCAGGGGCTGG - Intronic
966237419 3:177717649-177717671 ATTCCTGGTGGAGGAGGGGGAGG + Intergenic
966712037 3:182980734-182980756 GGGCGCGGCGGGGGAGGGGCGGG + Intronic
966802336 3:183775950-183775972 GGTGCCGGAGGAGGAGGAGGAGG + Exonic
966866562 3:184261592-184261614 GGGCGCGGTGGAGGCGGGGCGGG + Intronic
967859017 3:194137886-194137908 GGTCCCGGTGGGGGCGGTGGCGG - Exonic
968595128 4:1478238-1478260 GGTGGGGGTGGAGGTGGGGCAGG - Intergenic
968698199 4:2042699-2042721 GGTCAGGGTGGAGGGGGCGCAGG - Intronic
969350122 4:6593518-6593540 TTTCCAGGTGGGGGAGGGGCTGG - Intronic
969455439 4:7297405-7297427 GGTGGGGGTGGGGGAGGGGCGGG - Intronic
969662867 4:8540570-8540592 GGTTCCGGTGGGGCAGGGGCGGG + Intergenic
970491822 4:16582797-16582819 GGTCCCAGTGGAGCTGTGGCTGG - Intronic
970610645 4:17722054-17722076 TGTCCAGGAGGAGGAGTGGCAGG + Intronic
974577414 4:63744741-63744763 GGGCCTGCTGGCGGAGGGGCGGG + Intergenic
978351592 4:107825271-107825293 GGGCCAGGAGGAGGATGGGCTGG + Intronic
979014733 4:115419072-115419094 GGCCCTTGGGGAGGAGGGGCAGG - Intergenic
979224240 4:118265882-118265904 GGGCGCGGTGGAGCAGGGGGCGG - Intergenic
980628643 4:135406947-135406969 GGGCCCTGTGGAGCAGGGGGTGG - Intergenic
981042128 4:140233175-140233197 GGTGCCGGTGGGGGTGGGGGGGG - Intergenic
981148029 4:141348940-141348962 GCTTCCCGTGGAAGAGGGGCAGG + Intergenic
981550459 4:145937225-145937247 GGCGCGGGTGGAGGAGGGGAAGG + Intronic
982224428 4:153153046-153153068 GCTCCTTGTGGGGGAGGGGCGGG + Intronic
985122549 4:186658837-186658859 GGGTCCGGTGGAGGCGTGGCAGG - Intronic
985544324 5:501485-501507 CCTCCCGGGGGACGAGGGGCCGG + Intronic
985552311 5:539939-539961 GGTCACGGGTGGGGAGGGGCTGG - Intergenic
985693454 5:1326303-1326325 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693476 5:1326482-1326504 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693500 5:1326654-1326676 TGTCCCCGTAGAGGAGGAGCTGG - Intronic
985693507 5:1326683-1326705 TGTCCCCGTAGAGGAGGAGCTGG - Intronic
985693514 5:1326712-1326734 TGTCCCCGTAGAGGAGGAGCTGG - Intronic
985693519 5:1326741-1326763 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693525 5:1326770-1326792 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693556 5:1326973-1326995 TGTCCCTGTGGAGGAGGAGCTGG - Intronic
985693562 5:1327002-1327024 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693569 5:1327031-1327053 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693576 5:1327060-1327082 TGTCCCTGTCGAGGAGGAGCTGG - Intronic
985693606 5:1327263-1327285 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693632 5:1327437-1327459 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693638 5:1327466-1327488 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693643 5:1327495-1327517 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693649 5:1327524-1327546 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693674 5:1327698-1327720 TGTCCCTGTAGAGGAGGAGCAGG - Intronic
985693679 5:1327727-1327749 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693686 5:1327756-1327778 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693704 5:1327872-1327894 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693774 5:1328367-1328389 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693818 5:1328744-1328766 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693839 5:1328918-1328940 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985731915 5:1554082-1554104 GGTCCCGCTGGTGGAGGAACTGG + Intergenic
985761471 5:1751416-1751438 GGTCCCTGTGGAGGAAGGAGAGG - Intergenic
985761484 5:1751453-1751475 GGTCCCTGTGGAGGAAGGAGAGG - Intergenic
985801883 5:2009973-2009995 GGTCCCGGTGGCTTAGGGGATGG + Intergenic
985828148 5:2207943-2207965 GGTCCCTGTGGATGGGCGGCTGG + Intergenic
985908894 5:2863871-2863893 GGTTCCCTTCGAGGAGGGGCCGG + Intergenic
986269430 5:6218143-6218165 GGTCCCTGTGCAGAAGGGCCTGG + Intergenic
986993320 5:13578800-13578822 GGGCGCGGTGGAGCAGGGGGCGG - Intergenic
987347395 5:16991013-16991035 GGGCACGGTGGAGCAGGGGGCGG + Intergenic
992050412 5:72935572-72935594 GGGCACCGTGGAGCAGGGGCAGG - Intergenic
992620691 5:78589603-78589625 GGTGCAGGTTGAGGAGGGACAGG - Intronic
993168378 5:84384651-84384673 GGTCCCGGCAGAGGCGCGGCGGG + Exonic
995353132 5:111205346-111205368 GGTCCCTCTGGAGGAGCTGCTGG - Intergenic
995566138 5:113434431-113434453 GGTCCCGGTGGACGACGTCCAGG + Exonic
996663175 5:126027646-126027668 GGTGCTGGTGGAGGTGGAGCTGG - Intergenic
997356707 5:133267184-133267206 GGTCTGGGAGGAGGAGGTGCAGG + Intronic
997428572 5:133821663-133821685 GGGCACTGTGGAGGAGGCGCAGG + Intergenic
997454324 5:134005879-134005901 GGGCCCTGTGGAGGAGGTGCCGG + Intergenic
997588901 5:135061120-135061142 GGGACAGGTAGAGGAGGGGCAGG - Intronic
997801166 5:136864019-136864041 GGGCATGGTGGAGGAGGGGGTGG + Intergenic
997963301 5:138338447-138338469 GGACCCGGTGGGGGAGGGGGTGG + Intronic
998364352 5:141619085-141619107 GGTCCGGGCGGAAGTGGGGCAGG - Intergenic
999365484 5:151020883-151020905 GGTCCCGGCGGCGGAGGGGGCGG - Intronic
1001541475 5:172542788-172542810 GGGCCAGGTGGCAGAGGGGCGGG + Intergenic
1001700804 5:173705413-173705435 GGGGCCGCTGGAGAAGGGGCAGG + Intergenic
1001999889 5:176191693-176191715 GGCCACGGTGGAGGAGTGGGAGG + Intergenic
1002149086 5:177211978-177212000 TGACCCTGTGCAGGAGGGGCGGG + Exonic
1002522803 5:179800769-179800791 GGACCTGGTGGGGGAGGGGTGGG - Intronic
1003415643 6:5905598-5905620 AGTCCATGAGGAGGAGGGGCTGG - Intergenic
1003908181 6:10720918-10720940 GGGCCCTGTGGAGCAGGGGGTGG - Intergenic
1004396319 6:15248775-15248797 CGTCACGGAGGAGGAGGGGAAGG - Intronic
1004689044 6:17976219-17976241 GGGCGCGGTGGAGAAGGGGCCGG + Intronic
1005561480 6:27045561-27045583 GGTGCCCGTGGAGTAGGGGGCGG - Intergenic
1005671667 6:28112595-28112617 GGTTCTGGGGGAGGAGGTGCAGG - Intergenic
1005709472 6:28489821-28489843 CGTCCCGGTGGTGGGGGGGGGGG + Intergenic
1006078265 6:31548252-31548274 GGTGTCGCTGGAGGAGGGCCTGG - Exonic
1007341559 6:41194162-41194184 GGTCAGTGGGGAGGAGGGGCAGG - Intronic
1007546019 6:42695341-42695363 GTGCCCGGACGAGGAGGGGCAGG + Intergenic
1007780104 6:44247743-44247765 AGTCCCGGTGGAGGAGGGGCGGG + Intronic
1011443019 6:87407929-87407951 GGGCCAGGTGGGGGTGGGGCGGG - Intergenic
1011517376 6:88167456-88167478 GGCCCCGGGGGCGGAGGGGAGGG - Intergenic
1014001460 6:116370731-116370753 AGTCCCGGGAGAGGAGGAGCGGG + Intronic
1014253350 6:119137744-119137766 GGTCCAGGAGGAGGAGAGACAGG - Intronic
1014612081 6:123558884-123558906 GGTCCTGGGGGAGGAGGTTCTGG - Intronic
1015625959 6:135181339-135181361 GGTCACGGAGGAGGAGGAGAAGG - Exonic
1016007955 6:139108474-139108496 GGTGTCGGTGGAGCAGGGGCGGG - Intergenic
1017027911 6:150197674-150197696 CGCCACGGTGGAGGAGGGCCTGG + Intronic
1017027927 6:150197722-150197744 CGCCACGGTGGAGGAGGGCCTGG + Intronic
1017027943 6:150197770-150197792 CGCCACGGTGGAGGAGGGCCTGG + Intronic
1017027959 6:150197818-150197840 CTTCACGGTGGAGGAGGGCCTGG + Intronic
1017027987 6:150197914-150197936 TGCCACGGTGGAGGAGGGCCTGG + Intronic
1017028003 6:150197962-150197984 CGTCACGGTGGAGGAGGGCCTGG + Intronic
1017028032 6:150198058-150198080 CGCCACGGTGGAGGAGGGCCTGG + Intronic
1017028048 6:150198106-150198128 CGTCACGGTGGAGGAGGGCCTGG + Intronic
1017028063 6:150198154-150198176 CTTCACGGTGGAGGAGGGCCTGG + Intronic
1017028078 6:150198202-150198224 CGCCACGGTGGAGGAGGGCCTGG + Intronic
1017028093 6:150198250-150198272 TGCCACGGTGGAGGAGGGCCTGG + Intronic
1017028125 6:150198346-150198368 CGCCACGGTGGAGGAGGGCCTGG + Intronic
1017810874 6:157982299-157982321 GATCCCCGTGGAGGGGCGGCCGG - Intronic
1017908278 6:158771640-158771662 GGGACGGGTGGAGGAAGGGCAGG + Intronic
1018291782 6:162298832-162298854 GAGCCAGGTGGAGGAGGGGAGGG + Intronic
1018450220 6:163900885-163900907 GGTCATGGTGGGGGAGGGGTTGG + Intergenic
1018495404 6:164342201-164342223 GCTCCTGGTGGAGGAGGTTCTGG + Intergenic
1019137736 6:169921909-169921931 AGACAGGGTGGAGGAGGGGCTGG + Intergenic
1019440992 7:1046704-1046726 GGACAAGGTGGAGGTGGGGCAGG + Intronic
1019453064 7:1109699-1109721 GGGCCCGGCGGGGGAGGGGAAGG - Intronic
1019702356 7:2480136-2480158 GCCCCCGCTGGAGGAGGCGCGGG + Intergenic
1020264485 7:6551271-6551293 GATCCTGGAGGTGGAGGGGCTGG - Exonic
1020334781 7:7054598-7054620 GGAGCGGGTGGAGGAGGAGCAGG + Intergenic
1021686720 7:23193764-23193786 GGTGCCGGTGGAGCAGGGGGTGG + Intronic
1022322277 7:29298325-29298347 GGTCGCGGGGGAGGGGGGACGGG - Intronic
1023320671 7:38994379-38994401 GGTCCCAGAGGAGGAAGGGAAGG + Intronic
1023435139 7:40134503-40134525 GGTCCGGGTGGAGGAGGTTGGGG - Exonic
1023995686 7:45157777-45157799 GGTCCCGCTGGGGGCGCGGCTGG - Exonic
1024572134 7:50732141-50732163 GGACACGCTGGAGCAGGGGCTGG - Intronic
1024794108 7:53002631-53002653 GATCCTGGAGGAGGAGGAGCAGG + Intergenic
1025021670 7:55485254-55485276 GTTCCCTGTGGAGGAGAAGCTGG - Intronic
1025093506 7:56081349-56081371 CGTCCCTGTGCTGGAGGGGCAGG - Intronic
1025943011 7:66087396-66087418 TCTCCCTGGGGAGGAGGGGCAGG - Intronic
1027228620 7:76260098-76260120 GGTCCTGGGGGAGAAGGGGCGGG - Exonic
1027674524 7:81142067-81142089 GGGCCCCGTGGAGCAGGGGGCGG - Intergenic
1027987898 7:85318425-85318447 GGTACCTGTGGAGGATGTGCAGG + Intergenic
1028762326 7:94509886-94509908 GGCCGCGGCCGAGGAGGGGCAGG + Exonic
1028852468 7:95552497-95552519 GGGCGCGGTGGAGCAGGGGACGG + Intergenic
1029123035 7:98281309-98281331 CCTACCGGTGGAGGAGGGGGAGG - Intronic
1029172969 7:98643783-98643805 GTGCCAGGTGGAGAAGGGGCAGG + Intergenic
1029494822 7:100890999-100891021 GGTGGAGGAGGAGGAGGGGCAGG + Exonic
1029730138 7:102433509-102433531 GGGCGGGGTGGAGGCGGGGCCGG + Exonic
1032187827 7:129742538-129742560 AGGCCTGGTGGGGGAGGGGCTGG + Intronic
1032431951 7:131869590-131869612 GGTGACAGTGGAGGAGGGGAAGG - Intergenic
1032544147 7:132727922-132727944 GGTGCAGGTGGAGGAAGGTCTGG - Exonic
1032719145 7:134536658-134536680 GGAGCTGGTGGATGAGGGGCTGG + Exonic
1032724115 7:134575428-134575450 GGAGCTGGTGGACGAGGGGCTGG + Exonic
1033030450 7:137820938-137820960 GGCCCCAGGGGAGGAGGGGAGGG - Intronic
1033732770 7:144195469-144195491 GAGCCCGGCGGAGGTGGGGCAGG - Intronic
1033743621 7:144294049-144294071 GAGCCCGGCGGAGGTGGGGCAGG - Intergenic
1033750281 7:144355548-144355570 GAGCCCGGCGGAGGTGGGGCAGG + Intronic
1034467779 7:151239884-151239906 AGTCCCAGGGGAGGAGGGGATGG + Intronic
1034559563 7:151871474-151871496 GGTCTTGGAGGAGGAGGGGGAGG - Intronic
1034578713 7:152024719-152024741 GGTATCTGTGGAAGAGGGGCTGG + Intergenic
1034994004 7:155566542-155566564 TGCCCTGGTGGAGGATGGGCAGG + Intergenic
1035374624 7:158399785-158399807 GGTTCCGGTGCAGTAGGAGCTGG - Intronic
1035579209 8:729381-729403 GGTGCCGCAGGAGGAGGGGATGG - Intronic
1035625780 8:1069363-1069385 GGTCTCACTGGAGGACGGGCCGG + Intergenic
1035690168 8:1554767-1554789 GGGCGCGGGGGAGGGGGGGCTGG - Intronic
1035724035 8:1813744-1813766 GGGCCCGGTGGGGGAGGAGTGGG - Intergenic
1036664681 8:10730722-10730744 GGCCCTGGCGGCGGAGGGGCGGG - Intronic
1036687902 8:10924090-10924112 GGCCCAGGAGGAGGAGGGGCTGG - Intronic
1036708021 8:11059587-11059609 GGTGCCAGTGGAGGAGGAGCAGG + Intronic
1037757616 8:21721440-21721462 GGTCCCTGTGGAGGAAGGCTGGG + Intronic
1037858673 8:22389452-22389474 GGACCCGGGGGAGGTGGGGTAGG + Intronic
1037941711 8:22956463-22956485 GGACCAGGAGGAGGAGGGGGAGG - Intronic
1037998308 8:23369071-23369093 GGGGCCGGTGGAGAAGGAGCGGG + Intronic
1038420701 8:27432304-27432326 CCTCCCGCTGGAGGAGGGCCAGG + Exonic
1038554097 8:28494476-28494498 GATCCCTGAGGAGGAGGCGCCGG - Intronic
1038584677 8:28778100-28778122 GGCCCCGTGGAAGGAGGGGCAGG + Intronic
1039410628 8:37352291-37352313 GCTCCAGGAGGAGGAGGGGTAGG + Intergenic
1039842863 8:41306510-41306532 GGTCCCTGTGGAGGGGAGGGTGG - Intronic
1039897246 8:41725204-41725226 GGGGCCGGTGGAAGAGGGGAGGG + Intronic
1040723169 8:50350246-50350268 GGCTCCGGTGGAGCAGGGGGCGG - Intronic
1041102270 8:54408298-54408320 GCTCTGGGTGGAGGAGGGGAGGG + Intergenic
1041327626 8:56685760-56685782 GGCCCCAGTAGGGGAGGGGCTGG + Intergenic
1041717633 8:60946394-60946416 GGGCAGGGTGGGGGAGGGGCTGG + Intergenic
1043527467 8:81112140-81112162 CGTCACGGGGGAGGAGGGGCGGG + Intergenic
1044088529 8:87971444-87971466 GGGCACGGTGGAGCAGGGGGTGG - Intergenic
1045009365 8:97944114-97944136 GGTCCAGGCGGAGGAGGGCTAGG + Intronic
1045111088 8:98940210-98940232 GGTCCCGGGGGAGGAGCGGGCGG - Intronic
1046763684 8:118046979-118047001 TGTTTCTGTGGAGGAGGGGCAGG + Intronic
1047748093 8:127860188-127860210 GGTCCTGGTGGCGGAGGTGCTGG + Intergenic
1048223428 8:132563969-132563991 GGTCCTGCTGGTGGAGGGGAAGG - Intergenic
1048588447 8:135798068-135798090 GGTCCTGCTGGAGCTGGGGCAGG + Intergenic
1049086150 8:140480111-140480133 TTTCCCTGGGGAGGAGGGGCTGG - Intergenic
1049203833 8:141354277-141354299 AACACCGGTGGAGGAGGGGCAGG + Intergenic
1049476530 8:142799562-142799584 GGGCCAGCTGGAAGAGGGGCAGG + Intergenic
1049574096 8:143382531-143382553 GGCTCCAGTTGAGGAGGGGCCGG - Exonic
1051875923 9:21793544-21793566 GGTCCAGCTGTTGGAGGGGCTGG - Intergenic
1052765377 9:32635089-32635111 GGTCCCGGGGGTGGAGGTGGAGG + Exonic
1053135987 9:35650528-35650550 TGTCCCAGTGGACCAGGGGCCGG - Exonic
1053267250 9:36724258-36724280 GGTCCAGCTGCAGGAGGGTCTGG + Intergenic
1053707147 9:40767709-40767731 GGAGCAGGTGGAGGAGTGGCGGG - Intergenic
1054417060 9:64888477-64888499 GGAGCAGGTGGAGGAGTGGCGGG - Intergenic
1054711812 9:68518010-68518032 GGTCCAGGTGGAGGAGGATCTGG + Intronic
1055611763 9:78031543-78031565 GTTCCCGGGGAAGGAGGCGCGGG - Intergenic
1055805065 9:80083783-80083805 GGTGCTGGTGGCGGAGGGGGCGG + Intergenic
1055834130 9:80419100-80419122 GGTTCCGGGGGAAGAGGGGTTGG + Intergenic
1056643321 9:88388766-88388788 GGGCACGGAGGAGTAGGGGCCGG - Intronic
1057398444 9:94701250-94701272 GGGCCAGGTGGAGGATGGGGAGG - Intergenic
1057997032 9:99828291-99828313 GATCAAAGTGGAGGAGGGGCGGG + Exonic
1058526887 9:105867971-105867993 GGTTACGGGGGAGGAGGGGATGG - Intergenic
1058618801 9:106862577-106862599 GGTGGTGGTGGAGGAGGGGGAGG - Intergenic
1059368390 9:113805344-113805366 GGTGATGGTGGAGGAGAGGCAGG - Intergenic
1060106709 9:120877213-120877235 GGTCTCGGCGGGGGCGGGGCGGG + Exonic
1060161588 9:121369927-121369949 GGTCACGATGGAGGGGTGGCGGG - Intronic
1060224787 9:121784149-121784171 GATGCTGGTGGAGGAAGGGCTGG + Exonic
1060599590 9:124869159-124869181 GGAGGCGGTGGAGGAGGTGCTGG + Exonic
1060765245 9:126290944-126290966 AGACGCAGTGGAGGAGGGGCAGG - Intergenic
1061222144 9:129258498-129258520 GCGCCCGGAGCAGGAGGGGCCGG - Intergenic
1061296956 9:129682018-129682040 GGTCCCTGAGGAGGAGGCGTGGG + Intronic
1061484713 9:130914454-130914476 GGTGGCCCTGGAGGAGGGGCAGG + Intronic
1061865687 9:133490835-133490857 GGTGCTGGAGGAGGAGGGGAGGG + Intergenic
1061924807 9:133800735-133800757 GGTTTAGGTGGACGAGGGGCTGG + Intronic
1061967645 9:134025279-134025301 GGGGCTGGAGGAGGAGGGGCTGG - Intergenic
1061967651 9:134025294-134025316 GGGGCTGGAGGAGGAGGGGCTGG - Intergenic
1062024094 9:134332509-134332531 GCTGCCTGTGGAGGAGGGGTGGG + Intronic
1062060312 9:134491942-134491964 GGCCACGGTGCAGGAGGTGCTGG + Intergenic
1062150228 9:135014368-135014390 GGTGCAGGTGGAGGCAGGGCTGG - Intergenic
1062182714 9:135199323-135199345 GGTCTGGGTGGGGGAGGGGGTGG - Intergenic
1062237047 9:135515316-135515338 GGTCCCGGGAGGGGAGTGGCAGG - Intergenic
1062284702 9:135767836-135767858 GGGCCTGGGGGAGGAAGGGCAGG + Intronic
1062452659 9:136622018-136622040 GGGCTCAGTGGTGGAGGGGCTGG + Intergenic
1062478596 9:136741449-136741471 GGTCCCACGGGAGCAGGGGCGGG - Intronic
1062532651 9:137008657-137008679 GGTCTGGGGTGAGGAGGGGCAGG + Intronic
1202630678 M:13977-13999 GGTCTAGGAGGAGTAGGGGCAGG - Intergenic
1185593143 X:1291749-1291771 GGTCCAGGTGGAGGTGGTACAGG - Intronic
1185593187 X:1291963-1291985 GGTCCAGGTGGAGGTGGTGCAGG - Intronic
1185593211 X:1292088-1292110 GGTCCAGGTGGAGGTGGTGCAGG - Intronic
1185593245 X:1292260-1292282 GGTCCAGGTAGAGGTGGGGCAGG - Intronic
1185593457 X:1293610-1293632 GGTCCAGGTGGAGGTGGGGCAGG - Intronic
1185593477 X:1293697-1293719 GGTCCAGGTGGAGATGGGGCAGG - Intronic
1185593497 X:1293784-1293806 GGTCCAGGTGGAGGTGGGGCAGG - Intronic
1185593518 X:1293870-1293892 GGTCCAGGTGGAGGTGGGGCAGG - Intronic
1185593547 X:1294000-1294022 GGTCCAGGTGGAGGTGGGGCAGG - Intronic
1185593567 X:1294084-1294106 GGTCCAGGTAGAGGTGGGGCAGG - Intronic
1185593579 X:1294127-1294149 GGTCCAGGTGGAGATGGGGCAGG - Intronic
1185593590 X:1294171-1294193 GGTCCAGGTGGAGGTGGAGTAGG - Intronic
1185593599 X:1294208-1294230 GGTCCAGGTGGAGGTGGAGTAGG - Intronic
1185593905 X:1295726-1295748 GGTCTCTGTGGAGGTGGGGCAGG - Intronic
1186508052 X:10109937-10109959 GGCCCGGCTGGAGGAGGAGCGGG + Exonic
1187573591 X:20530861-20530883 GGGCTCGGGGGAGGAGGGGGTGG - Intergenic
1189323007 X:40097525-40097547 GGGCCGGGTGGGGGCGGGGCGGG + Intronic
1189407102 X:40735309-40735331 GCTCCCGGGGGAGGAGGGGCTGG + Exonic
1190136587 X:47804475-47804497 GGCCCCGGAGGAGGAGGAGGGGG - Intergenic
1190268175 X:48841875-48841897 GGTCTCGGGGGAGGAGGGAACGG + Intergenic
1190726369 X:53193155-53193177 GGTCCAGGAGGAGGAAGAGCTGG - Exonic
1190844819 X:54182484-54182506 GGTCAAGGTGAGGGAGGGGCCGG - Exonic
1190993078 X:55572631-55572653 GGTACAGGTGCAGGATGGGCAGG - Intergenic
1191053868 X:56222636-56222658 GGGCACGGTGGAGCAGGGGGCGG + Intergenic
1191880480 X:65839930-65839952 GGTCCTGGTGGTGGAGAGGTTGG + Intergenic
1192214626 X:69150057-69150079 GAGCCGGGTGGGGGAGGGGCGGG + Intergenic
1192224954 X:69221706-69221728 GAGCCAGGTGGGGGAGGGGCGGG - Intergenic
1192468442 X:71375226-71375248 GGTCCCGGGGGTGGAGGTGGAGG - Exonic
1193610946 X:83631042-83631064 GGTGCTGGTGGAGGTGGGGCTGG + Intergenic
1193647993 X:84092028-84092050 GGTCCTGTTGGGGGAGGGGCAGG + Intronic
1193812704 X:86070282-86070304 GGTACCTGTGCAGGATGGGCAGG - Intergenic
1199649951 X:149940399-149940421 GTGCCGGGTGGAGCAGGGGCTGG + Intergenic
1199746084 X:150772612-150772634 GGTCCCGCTGGAGGAGCGTGAGG + Intronic
1200059513 X:153478017-153478039 GGAAGCAGTGGAGGAGGGGCAGG - Intronic
1201291244 Y:12421782-12421804 GGCCGCGGTGGGCGAGGGGCTGG - Intergenic