ID: 1168334142

View in Genome Browser
Species Human (GRCh38)
Location 19:55587293-55587315
Sequence CGGGCGCTTGTGAGACACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168334135_1168334142 17 Left 1168334135 19:55587253-55587275 CCGCTATGTGACGCGTTGGGTGC No data
Right 1168334142 19:55587293-55587315 CGGGCGCTTGTGAGACACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168334142 Original CRISPR CGGGCGCTTGTGAGACACGG AGG Intergenic
No off target data available for this crispr