ID: 1168334859

View in Genome Browser
Species Human (GRCh38)
Location 19:55591997-55592019
Sequence CTTGATCTGGAGAATGTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 258}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168334859_1168334867 3 Left 1168334859 19:55591997-55592019 CCCTCCACATTCTCCAGATCAAG 0: 1
1: 0
2: 0
3: 22
4: 258
Right 1168334867 19:55592023-55592045 GTTAGGAATGATGGCTCTCAGGG 0: 1
1: 0
2: 0
3: 15
4: 154
1168334859_1168334869 9 Left 1168334859 19:55591997-55592019 CCCTCCACATTCTCCAGATCAAG 0: 1
1: 0
2: 0
3: 22
4: 258
Right 1168334869 19:55592029-55592051 AATGATGGCTCTCAGGGAATGGG 0: 1
1: 0
2: 1
3: 52
4: 607
1168334859_1168334870 10 Left 1168334859 19:55591997-55592019 CCCTCCACATTCTCCAGATCAAG 0: 1
1: 0
2: 0
3: 22
4: 258
Right 1168334870 19:55592030-55592052 ATGATGGCTCTCAGGGAATGGGG 0: 1
1: 0
2: 0
3: 17
4: 332
1168334859_1168334866 2 Left 1168334859 19:55591997-55592019 CCCTCCACATTCTCCAGATCAAG 0: 1
1: 0
2: 0
3: 22
4: 258
Right 1168334866 19:55592022-55592044 CGTTAGGAATGATGGCTCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 91
1168334859_1168334865 -6 Left 1168334859 19:55591997-55592019 CCCTCCACATTCTCCAGATCAAG 0: 1
1: 0
2: 0
3: 22
4: 258
Right 1168334865 19:55592014-55592036 ATCAAGGTCGTTAGGAATGATGG 0: 1
1: 0
2: 0
3: 4
4: 88
1168334859_1168334868 8 Left 1168334859 19:55591997-55592019 CCCTCCACATTCTCCAGATCAAG 0: 1
1: 0
2: 0
3: 22
4: 258
Right 1168334868 19:55592028-55592050 GAATGATGGCTCTCAGGGAATGG 0: 1
1: 0
2: 3
3: 31
4: 346
1168334859_1168334873 28 Left 1168334859 19:55591997-55592019 CCCTCCACATTCTCCAGATCAAG 0: 1
1: 0
2: 0
3: 22
4: 258
Right 1168334873 19:55592048-55592070 TGGGGCAGTCTTCCCTTGGTGGG 0: 1
1: 0
2: 4
3: 5
4: 124
1168334859_1168334872 27 Left 1168334859 19:55591997-55592019 CCCTCCACATTCTCCAGATCAAG 0: 1
1: 0
2: 0
3: 22
4: 258
Right 1168334872 19:55592047-55592069 ATGGGGCAGTCTTCCCTTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 121
1168334859_1168334874 29 Left 1168334859 19:55591997-55592019 CCCTCCACATTCTCCAGATCAAG 0: 1
1: 0
2: 0
3: 22
4: 258
Right 1168334874 19:55592049-55592071 GGGGCAGTCTTCCCTTGGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 134
1168334859_1168334871 24 Left 1168334859 19:55591997-55592019 CCCTCCACATTCTCCAGATCAAG 0: 1
1: 0
2: 0
3: 22
4: 258
Right 1168334871 19:55592044-55592066 GGAATGGGGCAGTCTTCCCTTGG 0: 1
1: 0
2: 3
3: 13
4: 194
1168334859_1168334875 30 Left 1168334859 19:55591997-55592019 CCCTCCACATTCTCCAGATCAAG 0: 1
1: 0
2: 0
3: 22
4: 258
Right 1168334875 19:55592050-55592072 GGGCAGTCTTCCCTTGGTGGGGG 0: 1
1: 0
2: 0
3: 20
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168334859 Original CRISPR CTTGATCTGGAGAATGTGGA GGG (reversed) Exonic
900648975 1:3721900-3721922 CTTCATCTGGGGGTTGTGGAAGG + Intronic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
902468471 1:16631955-16631977 CTGGACCTGGAGAGCGTGGATGG + Intergenic
902505665 1:16938033-16938055 CTGGACCTGGAGAGCGTGGATGG - Intronic
903154650 1:21435693-21435715 CTGGACCTGGAGACAGTGGATGG - Intergenic
906566363 1:46803955-46803977 CTGGGTCTGAAGAATCTGGAGGG + Intronic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
910602457 1:89046542-89046564 CTTGATATTGAGATTATGGAGGG + Intergenic
912563790 1:110570384-110570406 TTTGATCTGGAAAATGGGGATGG + Intergenic
913199338 1:116483533-116483555 TTTGATCTGGAGGATGTGAAGGG - Intergenic
913256977 1:116962690-116962712 CTTGAAATTGAGACTGTGGAGGG - Intronic
917750690 1:178050592-178050614 TTTGAGCTGGAGAATGATGAGGG + Intergenic
919801005 1:201354628-201354650 TGTGATCTGGGGACTGTGGATGG + Intergenic
920813095 1:209305388-209305410 CTAGGTATGGAGAATGTGAAAGG - Intergenic
921373855 1:214452966-214452988 ATTGATCTGTATAATGTTGAGGG - Intronic
922465570 1:225843969-225843991 CGTGCTCTGGGGAAAGTGGAAGG + Intronic
924157887 1:241199941-241199963 CTTCATCTGCAAAATGTGGGTGG + Intronic
1064323860 10:14330767-14330789 GTAGATCTGGGGAAGGTGGAAGG - Exonic
1064328858 10:14375379-14375401 GTTGACCTTGGGAATGTGGAAGG - Intronic
1065845454 10:29739228-29739250 CTGGATCTGGAGCTTGGGGAGGG - Intergenic
1067209993 10:44252108-44252130 CCAGATCTGAAGAATGAGGATGG + Intergenic
1067471070 10:46538290-46538312 CTTCATCTATAGAATGAGGATGG - Intergenic
1069231834 10:66020264-66020286 CTTGAGCTGAAGAAAGTGGAAGG + Intronic
1069303526 10:66938928-66938950 CTTTCTCAGGAGGATGTGGACGG - Intronic
1069905100 10:71727544-71727566 CAGGAACTGGAGGATGTGGATGG - Intronic
1070312595 10:75284397-75284419 GTTGCTCTGGAGAGTGGGGAAGG + Intergenic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071710203 10:88042394-88042416 CTTGATATGAAAAATGTGAATGG + Intergenic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1073961492 10:108935331-108935353 CTTGATCTGGAGTTTGAGGCTGG - Intergenic
1074474362 10:113755751-113755773 CTTGGTTTGGAGAATGTAGCAGG + Intronic
1075359055 10:121813327-121813349 GTTGAGATGGAGAATGAGGAGGG - Intronic
1076648063 10:131967436-131967458 TTACATTTGGAGAATGTGGATGG - Exonic
1078012177 11:7580958-7580980 CTTGATCTGGAGTATGGGAAGGG - Intronic
1078850196 11:15156681-15156703 CTCCATCTGTAGAATGGGGATGG + Intronic
1081039265 11:38191010-38191032 TTTGACCAGCAGAATGTGGAAGG - Intergenic
1081286764 11:41279826-41279848 CTTGATCTATAAAATGTGGCTGG + Intronic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1084665394 11:70573631-70573653 CTTGATCTGGTCAATGTAGGAGG - Intronic
1085692688 11:78676546-78676568 TTGGATATGGAGAATCTGGATGG - Intronic
1087252734 11:95922124-95922146 CTTGATCTAGAAAATCTGTAAGG - Intronic
1088130600 11:106484634-106484656 CATGATGAGGAGAATGAGGATGG - Intergenic
1093590181 12:20893546-20893568 ATTGATGTGGAGGTTGTGGAAGG + Intronic
1096070143 12:48770770-48770792 CTTCATCTGGAAATTGTTGAAGG + Exonic
1097454669 12:59783173-59783195 TTTCATATGTAGAATGTGGAAGG + Exonic
1098621715 12:72608951-72608973 TTTGATCTGTAGAATGGGGATGG + Intronic
1102147808 12:110668010-110668032 GTTGATCAAGAGAATGTGGTGGG + Intronic
1102516556 12:113452617-113452639 CTTCATCTGAAGTATGTGGGTGG - Intergenic
1103526951 12:121575457-121575479 CCTGATCTGGAGCAAGGGGAAGG + Intronic
1103598479 12:122038804-122038826 TTTAATCTGTAGAATGGGGATGG + Intronic
1104157515 12:126148165-126148187 CTCCATCTGGAAAATGAGGATGG - Intergenic
1104199012 12:126568956-126568978 CCTGATGTGGAAAATGGGGAAGG + Intergenic
1106321921 13:28648051-28648073 TTTGATCAGAAGAATGTGGGTGG - Intergenic
1107839084 13:44436995-44437017 CGGGATCTGGAGAATGGGGGCGG - Intronic
1108424883 13:50289477-50289499 CTTGAATTGGAGGATGGGGAGGG + Intronic
1110167436 13:72460324-72460346 CTTGGTCTGTAGAATGGGGAGGG + Intergenic
1111350195 13:87018460-87018482 GTTGACCTGGATAAAGTGGATGG + Intergenic
1112944708 13:104914084-104914106 CTTCATTTGGAGAATGCGGATGG - Intergenic
1114840475 14:26257028-26257050 CTTAAGCAGGTGAATGTGGATGG + Intergenic
1117314877 14:54565197-54565219 CTGGATCTGGAGAGTGCGCAGGG - Intergenic
1118736601 14:68705624-68705646 ATTGATGGGGAGAATGGGGAAGG - Intronic
1119548365 14:75489966-75489988 CTTCATCTGTAAAATGTGGGGGG + Intergenic
1120256526 14:82126727-82126749 CTTCATCTGTATAATGTGAATGG - Intergenic
1121966023 14:98306505-98306527 CTTGATGAAGAGAATGTGGCAGG - Intergenic
1121983535 14:98476424-98476446 TTTGTTGGGGAGAATGTGGACGG + Intergenic
1125702219 15:41696973-41696995 CCTGATCTGGAAGATGTGGATGG + Exonic
1127299385 15:57637950-57637972 CATGATCTGCAGGATGTGGCTGG - Intronic
1127371762 15:58348135-58348157 CTGAATCTGGAGAGTGTGGAAGG - Intronic
1128210996 15:65902450-65902472 CTGGGACTGGAGAATGGGGAAGG + Intronic
1128890646 15:71328920-71328942 CCTGATCTGTAGAATGAGGCTGG + Intronic
1129854590 15:78814178-78814200 CCTGCTCAGGAGAATGTGGAGGG + Intronic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1131668659 15:94596636-94596658 GTTGAACTGGAGGAGGTGGAGGG - Intergenic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132533534 16:466122-466144 CTTGCTCTGCACAATGTGGCTGG + Intronic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133898697 16:9953034-9953056 CTTGAGCTTGAGTATGAGGAAGG + Intronic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134385071 16:13764093-13764115 TTTGATGAGGTGAATGTGGAGGG + Intergenic
1137010788 16:35317542-35317564 CTTGGTCTTGAGAATGTTGCTGG - Intergenic
1137378955 16:47980012-47980034 GCTGTTCTGCAGAATGTGGAAGG - Intergenic
1137806119 16:51307128-51307150 ATTGTTCTCCAGAATGTGGATGG - Intergenic
1139658949 16:68407078-68407100 CTTGATCAGGAGAATATTGAAGG + Intronic
1141745361 16:85922160-85922182 CTTCATTTTGAGAAGGTGGAAGG + Exonic
1143608709 17:8005303-8005325 CTTGATCTGGAGAAAGGTGTTGG - Intronic
1143694940 17:8606945-8606967 CTTGATTGGGAGAAAGTGCAAGG - Intronic
1143963116 17:10736995-10737017 CATGAACTGGAGAGGGTGGAAGG + Intergenic
1144421010 17:15098458-15098480 CTTGATGCGGAGAATGAGGGAGG - Intergenic
1144535137 17:16081456-16081478 TTTGATCAGGAGAATGAGAATGG - Intronic
1144693690 17:17286711-17286733 ATAGAAATGGAGAATGTGGAAGG - Intergenic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1150346727 17:64410505-64410527 ATTGCTCTTTAGAATGTGGAAGG + Intronic
1151423682 17:74015797-74015819 CTGGAGGTGGAGAAAGTGGAAGG + Intergenic
1151688200 17:75662277-75662299 CTTGTTCTGGATCCTGTGGAAGG - Intronic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1153326157 18:3822483-3822505 GTGGATCTGGTGAATCTGGAGGG + Intronic
1153851573 18:9100254-9100276 CTTTATTAGGAGAATGTGAAAGG - Intergenic
1153973363 18:10246256-10246278 CTTGCACTGGAGAATGGAGATGG + Intergenic
1155468689 18:26168163-26168185 ATTGCTCTGGAGAATTAGGAGGG - Intronic
1157042211 18:44053453-44053475 TTTGAATTGGAAAATGTGGAAGG + Intergenic
1157929378 18:51804301-51804323 CTGGCTCTGGGGAATATGGATGG + Intergenic
1159840285 18:73391276-73391298 GCTGATTTGGAGAATATGGATGG - Intergenic
1162156574 19:8682237-8682259 TATGATCTGGAGGATGAGGATGG + Intergenic
1162809319 19:13154677-13154699 CTGAATCACGAGAATGTGGAGGG + Exonic
1165252492 19:34551638-34551660 CTTCATCAGGAGAATCTGGTGGG + Intergenic
1165359593 19:35327913-35327935 CTTCATCTGTAGGATGTGCATGG + Intronic
1166702117 19:44888236-44888258 CTGGATCTAGAGGATGAGGAGGG + Exonic
1168334859 19:55591997-55592019 CTTGATCTGGAGAATGTGGAGGG - Exonic
926699160 2:15791098-15791120 CTCTTTCTGGAGAATGTGAAGGG - Intergenic
927412829 2:22846142-22846164 CTTAATCTTGAGACTGTAGATGG + Intergenic
927608608 2:24513274-24513296 TTTCCTCTGGGGAATGTGGAAGG - Intronic
928434346 2:31244442-31244464 CTTGAACAGGTGAGTGTGGAGGG + Exonic
929259219 2:39845733-39845755 CTTGAAAAGGAAAATGTGGAGGG + Intergenic
936111921 2:109671545-109671567 CTTCTCCTGGAGAATCTGGAGGG + Intergenic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
938210957 2:129465379-129465401 CTTGGTCTGGACAATGGGGCTGG - Intergenic
938550736 2:132379922-132379944 CTTGATATGGGGAATTTTGAAGG - Intergenic
938766578 2:134463926-134463948 CTTCATCTGGAGCTTGAGGAAGG + Intronic
938917972 2:135963260-135963282 CTTCATCTGGAAAATGGAGACGG + Intronic
938923883 2:136021107-136021129 CTGGGTCAAGAGAATGTGGATGG + Intergenic
939349749 2:141020084-141020106 ATAGATCTGGATAATGTAGAGGG - Exonic
939939562 2:148333538-148333560 CTTGAACTGGGGAATTTTGAAGG - Intronic
941409116 2:165131272-165131294 CTTGGTCTGTCAAATGTGGAGGG - Exonic
941425724 2:165342419-165342441 CTTGGTTTGGCAAATGTGGAAGG + Exonic
941652778 2:168111260-168111282 CTTAATCTGAAGAAAGTGGAAGG - Intronic
941710468 2:168706597-168706619 CTTGATCATGAGAATTTTGATGG + Intronic
942242189 2:173972814-173972836 CTTGAACTGAAGCATGGGGAGGG - Intergenic
942614492 2:177776331-177776353 CTTAATTTGGAGCATGTAGAAGG - Intronic
943220397 2:185096596-185096618 TTTGATCTAAAGAGTGTGGAAGG + Intergenic
943270569 2:185797233-185797255 CTTTATCTGAAGTATCTGGAGGG + Exonic
946046099 2:216822372-216822394 CCTAATCTGGAAAATGGGGATGG - Intergenic
948499378 2:238380561-238380583 CTTCTTCTCGAGCATGTGGATGG + Intronic
1170529437 20:17275742-17275764 CTTGGTCTGGAAAAAGAGGAGGG + Intronic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1172356155 20:34281412-34281434 CTTGAGTTGAAGAATGAGGAAGG - Intronic
1172878091 20:38178290-38178312 CAGGCTCTGGAGAGTGTGGAGGG + Intergenic
1173187940 20:40855611-40855633 CTGGGTCTTGAGACTGTGGAGGG - Intergenic
1173380965 20:42540849-42540871 CTTCATCGGGAGGATGGGGAAGG + Intronic
1174080349 20:47967073-47967095 TTTGCTCTGGACAAGGTGGATGG - Intergenic
1174149183 20:48474122-48474144 CTGGAGCTGGAGAATTTGGGTGG - Intergenic
1175300362 20:57938575-57938597 CTTTATCTGTAAAATGGGGATGG + Intergenic
1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG + Intergenic
1176452420 21:6875996-6876018 CTTGAGCACGAGCATGTGGATGG + Intergenic
1176830593 21:13741045-13741067 CTTGAGCACGAGCATGTGGATGG + Intergenic
1177057263 21:16321578-16321600 CTTGTTCTGAATAATCTGGAGGG + Intergenic
1180636562 22:17266780-17266802 CTTGATCTGGGGGCTGGGGAAGG + Intergenic
1181912282 22:26248243-26248265 CTTCATCTGTAAAATGTGAATGG + Intronic
1182541391 22:31044594-31044616 GTGGAGCTGGTGAATGTGGAGGG + Intergenic
1184337925 22:43865826-43865848 CATGAGCTAGAGAATGTGGGTGG - Intergenic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1185044379 22:48521877-48521899 CTTCATGTGGAGGGTGTGGAGGG + Intronic
1185128072 22:49022741-49022763 CTTGGTGTGGAGAAAGAGGAGGG + Intergenic
1185142133 22:49108434-49108456 CTGGATCTGGGGAGTGAGGATGG - Intergenic
949396108 3:3616076-3616098 CTAGATGTGGAGAAAGAGGAGGG + Intergenic
949948960 3:9213373-9213395 CTTGCTCTGAGGAGTGTGGAGGG - Intronic
950429789 3:12944162-12944184 CATGATGTGGAGAATCTCGAAGG - Intronic
950608937 3:14112386-14112408 CTTGACCTTGAGTATGTGAAGGG - Exonic
950687643 3:14629972-14629994 CTTGCTCAGGAGAATGTGGCAGG + Intergenic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
951463610 3:22977700-22977722 CTTTATCTGTACAATGAGGACGG + Intergenic
951735386 3:25857906-25857928 CTAGATCTGGATAAGGGGGAGGG - Intergenic
952844837 3:37679556-37679578 CTTCATCTGTAAAATGTGAAGGG + Intronic
954856429 3:53647709-53647731 CTTCATTTGTTGAATGTGGAGGG + Intronic
956034260 3:65073286-65073308 CTCCTTCTGGAGACTGTGGAAGG - Intergenic
956732108 3:72205815-72205837 CTTGAACTTGAGAATCTGTAGGG - Intergenic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
959820180 3:110724788-110724810 CCTGATCTGCAGTATGTGGCAGG + Intergenic
959892351 3:111570756-111570778 CTGGATCTAGAGGATGAGGAGGG - Intronic
962013579 3:131418240-131418262 CTGTATCTGTAGAATGAGGAAGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963943819 3:151123174-151123196 CTTGATATGCAGAATGTTTAGGG - Intronic
965730404 3:171765663-171765685 CTTGATCTGTAAAATGAGGAAGG + Intronic
965845610 3:172958083-172958105 CTTGAACAGGACAATGTTGAAGG - Intronic
970305701 4:14729765-14729787 CATGTTCTAGAAAATGTGGATGG - Intergenic
970499937 4:16666904-16666926 CTTGAGCTGACCAATGTGGAGGG - Intronic
970996143 4:22269225-22269247 CCTGTTCTGGTGAAGGTGGAAGG - Intergenic
976010223 4:80477588-80477610 CTTGAAGTTGAGATTGTGGAAGG - Intronic
977636204 4:99301522-99301544 CTTCATCTGTACAATGTGCATGG - Intergenic
977638249 4:99325683-99325705 CTTCATCTGTAAAATGTGCATGG - Intergenic
978643741 4:110903342-110903364 CTTCATCTGGTTAATGTGAAAGG - Intergenic
979994804 4:127418034-127418056 CTGAATCTGGGGAATGTGGGAGG - Intergenic
981073257 4:140567512-140567534 CTCCATCTGGAGAATATGGGTGG - Intronic
981571280 4:146153295-146153317 CTTAATTTTGAGTATGTGGATGG + Intergenic
982289465 4:153765315-153765337 CTTCATCTGTAAACTGTGGATGG - Intergenic
982570943 4:157050104-157050126 CTTGAGCAGGAGCATTTGGATGG + Intergenic
983691096 4:170469861-170469883 GTTAATTTGGAGAATCTGGATGG - Intergenic
983699468 4:170574013-170574035 CTTGATCTGAACAATGGTGAGGG + Intergenic
984537308 4:180992377-180992399 CTTGATCTGGATGATGTGTTTGG + Intergenic
984639515 4:182145334-182145356 CTTGATCGGGAAACTCTGGATGG + Intronic
986410624 5:7475302-7475324 CGTGGTCTGGAGAATGGAGAGGG + Intronic
989518891 5:42377655-42377677 CTTTAACTGGAGATTGTTGAAGG - Intergenic
990514691 5:56520390-56520412 CTTGGTGTGAAGAATGTGGCAGG - Intronic
990708654 5:58558374-58558396 CTTGATCAGAAGAAGGAGGAAGG - Intergenic
991984632 5:72272092-72272114 CTTGATCTTTAAAATGTGGCAGG - Intronic
992834471 5:80626529-80626551 ATTGCTCTGGAGAATTAGGAGGG - Exonic
993029238 5:82685329-82685351 CTTCAGCTGGAAAATGGGGATGG - Intergenic
993616777 5:90122665-90122687 CTAGTTCTGGAGAATGTATAGGG - Intergenic
996650188 5:125866447-125866469 CTTGATCTAGAGCAACTGGAAGG - Intergenic
997512617 5:134463927-134463949 GTTGATCTCGAGAATGTCAAGGG + Intergenic
998244431 5:140485705-140485727 ACTGATCTTGAGAAGGTGGAGGG - Exonic
998246685 5:140513465-140513487 CTTGATCTGGAAAAGGTGAGTGG + Exonic
998618460 5:143767754-143767776 CCTGATTTAGAGGATGTGGATGG + Intergenic
1000981642 5:167823096-167823118 CTTAGTCTGGAAAATGTGGTCGG + Intronic
1001241434 5:170074515-170074537 CTGACTCTGGAGAATGTGAATGG - Intronic
1001945639 5:175775315-175775337 CAGGATCTGGAGCATCTGGATGG - Intergenic
1002352339 5:178591862-178591884 CTTGACCTGGAGGATGAGGAGGG - Intergenic
1006053618 6:31363765-31363787 ATTGCTCTGGAGAATTAGGAGGG - Intergenic
1006735149 6:36268080-36268102 CTGGGGCTGGAGAATGAGGAAGG - Intronic
1006983317 6:38162458-38162480 CCCTAGCTGGAGAATGTGGAAGG + Intergenic
1007549981 6:42721849-42721871 CTCGATCTGCAGCATGTCGATGG + Exonic
1007834293 6:44662963-44662985 GTAGATCTGGGGAGTGTGGATGG - Intergenic
1009026673 6:58008312-58008334 CTTGACTTGGGGAATATGGAAGG - Intergenic
1009202218 6:60759785-60759807 CTTGACTTGGGGAATATGGAAGG - Intergenic
1009270427 6:61606740-61606762 CTAGATCTGGATATTGAGGAGGG + Intergenic
1010070363 6:71737188-71737210 CTTGATTTGGGGAGTGGGGATGG - Intergenic
1010311699 6:74393803-74393825 CTTGGTCTAAAGAATTTGGAGGG + Intergenic
1010347620 6:74830659-74830681 CTTTATCTGGAGCATGAGAATGG - Intergenic
1013431559 6:110060953-110060975 CTTGAACTGCAGTTTGTGGAGGG - Intergenic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1021889755 7:25175971-25175993 CTTAATCTGGTGATTGTGAAAGG + Intronic
1024084927 7:45884989-45885011 CTTGAGATGGAGAAGCTGGAAGG + Intergenic
1024218340 7:47266806-47266828 CATGATCTGTAAAATGGGGATGG + Intergenic
1024228851 7:47348719-47348741 TTTGATCTGGAGAAGGAGGATGG + Intronic
1024325982 7:48109556-48109578 CTAGAGCTTGAGAAGGTGGAAGG - Intergenic
1024912934 7:54466773-54466795 CTTCATATGGAAAAGGTGGAAGG + Intergenic
1025577754 7:62669413-62669435 ATTGATCTGTATAATGTTGATGG - Intergenic
1026481246 7:70781525-70781547 CTGGAGCTGGAGACTGTGAACGG - Intronic
1028137559 7:87238297-87238319 CTTGATCTGTCAAATGGGGATGG + Intergenic
1028616980 7:92779658-92779680 CTAGGTCTGTAGGATGTGGATGG - Intronic
1030285687 7:107824572-107824594 CTTAATCTGTAGGATTTGGATGG - Intergenic
1030697646 7:112603681-112603703 CTTTATCTGTAAAATGGGGATGG - Intergenic
1032626493 7:133597052-133597074 CTTGATCTGGACAATCTGGCTGG - Intronic
1033042207 7:137928796-137928818 CTTGACCAAAAGAATGTGGAGGG - Intronic
1033542730 7:142372279-142372301 CTTGCTCTGCAGGATGAGGAGGG + Intergenic
1033929955 7:146508697-146508719 CTTGAGCTGGAGCATCTGGGTGG + Intronic
1034882279 7:154771802-154771824 CTTAGTCTGTAGCATGTGGAAGG + Intronic
1036594954 8:10203173-10203195 CATGAATTGGAGAAGGTGGAGGG - Intronic
1037396788 8:18451884-18451906 CTGGCTTTGGAGAATGAGGAAGG - Intergenic
1037490772 8:19395262-19395284 CTTGTTCGGGAGAATGGGGCCGG + Exonic
1038008537 8:23455804-23455826 TTAGACCTGGAGAATTTGGAGGG - Intronic
1038278710 8:26143336-26143358 ATTGATGTGGAGAATGGTGATGG - Intergenic
1039680725 8:39732652-39732674 CTTGATATCCAGAATGTAGAAGG + Intergenic
1040023831 8:42763847-42763869 CATGGACTGGAGAATGTGGTGGG + Intronic
1040551489 8:48440892-48440914 CTGTATGTGCAGAATGTGGACGG - Intergenic
1043870060 8:85422418-85422440 GTTGATCTGTCTAATGTGGATGG + Intronic
1043946199 8:86255617-86255639 CTTTAACTCGAGAATGTGGCAGG + Intronic
1044252566 8:90021342-90021364 CTAGATGTGGAGAAAGAGGAGGG + Intronic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1045070479 8:98499216-98499238 CTTGCTCTGGAGACTGTTAAGGG - Intronic
1045998819 8:108395528-108395550 CTGGATCTGTGGAATGGGGATGG - Intronic
1049324206 8:142013562-142013584 CTGGATCAGGAGACTGTGGGAGG + Intergenic
1050475656 9:6038070-6038092 CTGAATCACGAGAATGTGGAGGG - Intergenic
1050649567 9:7760736-7760758 CTACATCTGTAGTATGTGGAAGG + Intergenic
1052798584 9:32946649-32946671 CTTGATCTCGAGAATGTCAGGGG - Intergenic
1055574898 9:77650958-77650980 CCTTATCTGTAGAATCTGGAAGG + Intergenic
1056207263 9:84332413-84332435 ATTGCTCTGGAGAATTAGGAGGG + Intronic
1056625789 9:88252096-88252118 CTTGACCAGGACAATGGGGAGGG + Intergenic
1056943767 9:90976704-90976726 CTTGGTCTAGAAAATGTGAAAGG - Intergenic
1056948794 9:91025352-91025374 CTTTATCTGTAAAATGTGGATGG + Intergenic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1061368728 9:130186136-130186158 CTTGATTTAGAGAATGTTTATGG + Intronic
1203516761 Un_GL000213v1:8519-8541 CTTGAGCACGAGCATGTGGATGG - Intergenic
1185596136 X:1308105-1308127 ATTGGACTGGAGAATGTGGGTGG - Intronic
1185857799 X:3552040-3552062 GTTCATCTGTAGAATGTGGATGG - Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186844580 X:13517962-13517984 CTGGGTATGGAGAAAGTGGAAGG - Intergenic
1186871683 X:13780168-13780190 CTAGCTCTGGGGAATGTGGCTGG - Intronic
1187082723 X:16007979-16008001 CTAAATTTGGAGAATGAGGAAGG + Intergenic
1187864938 X:23715377-23715399 CTTGGTCTGGGGAATAGGGATGG - Intronic
1188287574 X:28346696-28346718 CTTGATTTGAAGAATGAGCAGGG - Intergenic
1188670071 X:32871368-32871390 CTTGATCTTAAGTATGGGGAGGG - Intronic
1188948118 X:36333716-36333738 CTTGAAATGGAGATTATGGAGGG - Intronic
1189298219 X:39934062-39934084 CTTCATCTGTAAAATGTGAAGGG + Intergenic
1189966134 X:46375739-46375761 CTTGTGCTGGTGAAAGTGGAGGG + Intergenic
1190197043 X:48328707-48328729 CGTCATCTGGGGAATGTGGAGGG + Intergenic
1192268859 X:69559599-69559621 TTGGATGTGGAGAATGAGGAAGG + Intergenic
1196889407 X:120277605-120277627 CTTCATCTGTAAAATGTGCATGG - Intronic
1199438541 X:147841991-147842013 CTTCATCTGGGGAATGGGGGAGG - Intergenic
1200243025 X:154507648-154507670 CTTGGTCTGGAGGCTGTGGGAGG - Intronic