ID: 1168335212

View in Genome Browser
Species Human (GRCh38)
Location 19:55593402-55593424
Sequence GGCCCCGAGGGGGCAGGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 530
Summary {0: 1, 1: 0, 2: 8, 3: 56, 4: 465}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168335212_1168335229 19 Left 1168335212 19:55593402-55593424 CCCGCGCCTGCCCCCTCGGGGCC 0: 1
1: 0
2: 8
3: 56
4: 465
Right 1168335229 19:55593444-55593466 GAGCCCCCGCACACCGAGCAGGG 0: 1
1: 0
2: 1
3: 3
4: 93
1168335212_1168335219 -9 Left 1168335212 19:55593402-55593424 CCCGCGCCTGCCCCCTCGGGGCC 0: 1
1: 0
2: 8
3: 56
4: 465
Right 1168335219 19:55593416-55593438 CTCGGGGCCCTCTCCGCCGCCGG 0: 1
1: 0
2: 0
3: 14
4: 156
1168335212_1168335228 18 Left 1168335212 19:55593402-55593424 CCCGCGCCTGCCCCCTCGGGGCC 0: 1
1: 0
2: 8
3: 56
4: 465
Right 1168335228 19:55593443-55593465 TGAGCCCCCGCACACCGAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168335212 Original CRISPR GGCCCCGAGGGGGCAGGCGC GGG (reversed) Exonic
900126684 1:1071867-1071889 GGGGCCGGGGGGGCAGGGGCAGG + Exonic
900165018 1:1241089-1241111 GGCCCTGAGGAGGCAGAGGCAGG - Intergenic
900214072 1:1471912-1471934 GGCCCCAAGGGTGAAGGCGCGGG + Exonic
900221621 1:1512296-1512318 GGCCCCAAGGGTGAAGGCGCGGG + Exonic
900344365 1:2204072-2204094 GGACCCGAGATGGCAGGAGCTGG - Intronic
900437833 1:2639926-2639948 GGCCCCCAGGCGGCAGGTGCAGG - Intronic
900512256 1:3066340-3066362 GGCCACGCGGGGGCAGGGCCTGG + Intergenic
900513209 1:3069877-3069899 GGCTCCGCGGGCGCAGGGGCAGG + Intronic
900595631 1:3478979-3479001 GGCCCCGAGGGCACAGCTGCAGG + Intronic
900621003 1:3587924-3587946 GGCCAGGAGGGGGCAGGAGGGGG + Intronic
900621180 1:3588344-3588366 GGCCAGGAGGGGGCAGGAGGGGG + Intronic
900621201 1:3588394-3588416 GGCCAGGAGGGGGCAGGAGGGGG + Intronic
900621257 1:3588534-3588556 GGCCAGGAGGGGGCAGGAGGGGG + Intronic
900640795 1:3687265-3687287 GGTCCTGAGAGGGCAGGGGCTGG - Intronic
900913377 1:5617726-5617748 GCCCCCGGGGGGGCAGGGGGTGG - Intergenic
901006011 1:6171844-6171866 AGCCACGAGGGGCCAGGAGCTGG - Intronic
901017935 1:6242374-6242396 GGCCCCGAGGGGGCGGGGGCGGG + Intergenic
901109564 1:6784714-6784736 GGCGCCGAGGGGGCGGGGCCTGG + Intergenic
901323227 1:8351839-8351861 GGCCACAGGGGGGCAGGCGTTGG - Intergenic
901327859 1:8379694-8379716 GGCCCACAGGGGGCACGCGGGGG + Intronic
901443461 1:9293115-9293137 GGCCCGGGAGGGGGAGGCGCGGG + Intronic
901626885 1:10629733-10629755 GGCCCCCAGGAGGAAGGCGAGGG + Exonic
901802900 1:11719505-11719527 GGCCCCGAGCGTGCAGGGGAAGG + Intronic
902518350 1:17001954-17001976 GGCCCAGAGGAGGCAAGCCCTGG + Intronic
902776981 1:18681222-18681244 GGCACCTTGGGGGCAGGGGCAGG - Intronic
903071232 1:20727896-20727918 GGCCCTCAGGTAGCAGGCGCTGG - Intronic
903072102 1:20731717-20731739 GGCCCCTGAGGGGCGGGCGCGGG + Intronic
903775441 1:25790444-25790466 GGCCCAGAGGGGTATGGCGCTGG - Intergenic
903813228 1:26046260-26046282 GGCCCCATGGGCGCAGGCACAGG - Intergenic
903820042 1:26095005-26095027 TGGCCCCAGGGGGCAGGGGCAGG + Intergenic
904009477 1:27381663-27381685 GGCTCCGAGGGAGAAGGCGCAGG + Intronic
905183159 1:36178745-36178767 GGCCCGGAGGCGGGAGGAGCAGG + Exonic
905350003 1:37338928-37338950 GGCCCTGGGCGGGCAGGCCCAGG - Intergenic
905733642 1:40312293-40312315 GGCCCAGAGTGGGCTGGCCCTGG + Intronic
905819620 1:40979621-40979643 GGCCTGGAGTGCGCAGGCGCGGG - Exonic
906275662 1:44513309-44513331 GGCCCCCATGGGCCAGGCTCGGG - Intronic
907118737 1:51990625-51990647 GGCGCGGAGGGGGCCGGGGCGGG + Exonic
910450123 1:87335452-87335474 GCCCACGAGGGGGCGAGCGCAGG + Intronic
912354208 1:109041928-109041950 GGCCCCGAAGCGGCCGGCTCCGG + Exonic
912515091 1:110212067-110212089 GGCCCCCACGAGGGAGGCGCGGG + Exonic
915213572 1:154326440-154326462 GGCCGAGAGGGGGCTGGGGCTGG + Intronic
915320193 1:155052072-155052094 GGGACCGAGAGGGCAGGCGCGGG + Intronic
915891792 1:159780629-159780651 GCCCGCGAGGAGGCAGGGGCAGG + Intergenic
915977734 1:160401435-160401457 GGGGCCGAGGGGACAGGCGCTGG + Intronic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
918215812 1:182391466-182391488 GGACCCGTCGGGGCTGGCGCTGG - Intronic
919182433 1:194103583-194103605 GGCCCCCAGGGTTCAGGTGCCGG + Intergenic
919991315 1:202710028-202710050 GGACCCGAGGGGCGAGGAGCCGG - Intronic
920242292 1:204562175-204562197 GACCCCGAAAGCGCAGGCGCGGG - Intergenic
920666055 1:207963702-207963724 GGCCACGAGAGGGCAGCCGCGGG - Intergenic
921255390 1:213334055-213334077 GGCTCCAAGGGGGCAGTGGCTGG + Intergenic
921389623 1:214605600-214605622 AGCCCCTGGGGGGCCGGCGCGGG + Intronic
922116499 1:222618449-222618471 AGGCCCGAGGGGCCGGGCGCAGG - Intronic
922455228 1:225768839-225768861 GGGCCCGGGAGGGCAGGCACTGG - Intergenic
922705411 1:227788002-227788024 TGCCCCGCAGGTGCAGGCGCCGG + Intergenic
922734402 1:227971651-227971673 GGCCCCTGGGAGGCAAGCGCGGG - Intergenic
922734691 1:227972783-227972805 GGCCCCTGGGAGGCAAGCGCGGG - Intergenic
923372660 1:233328344-233328366 GGCCGCGAGGGCGGCGGCGCGGG - Exonic
923674131 1:236065274-236065296 GGCCGCGAGGGGGAGGGCGAGGG + Intergenic
924613451 1:245592259-245592281 GCCGCCCAGGGTGCAGGCGCAGG + Intronic
924948056 1:248858952-248858974 GGCCCGGGAGGCGCAGGCGCAGG - Intronic
1064028848 10:11870100-11870122 GGCTCCGCGGGGCCCGGCGCTGG + Exonic
1064086308 10:12349081-12349103 GGACCCGAGGGGCAAGGCGTGGG - Intergenic
1065294279 10:24259709-24259731 GGCTCCCAGGGGGAAGGCACAGG - Intronic
1066080684 10:31928451-31928473 GGCGCCGAGGGGGAGGGGGCCGG - Intronic
1067089067 10:43257467-43257489 GGCCCCCAGGCGGCAGAGGCAGG - Intronic
1070717948 10:78736145-78736167 GGCTCCGTGGGGGCAGACCCTGG - Intergenic
1070785581 10:79160387-79160409 GACCCCGTGGGGGCTGGTGCTGG - Intronic
1071525283 10:86354716-86354738 GGTCCCGGGGAGGCAGGGGCAGG + Intronic
1073310136 10:102534479-102534501 GTCCCCTAGGGGACAGGCGGAGG + Intronic
1074008942 10:109457049-109457071 GGCCGCGGCGGGGCAGGCGTAGG + Intergenic
1074377420 10:112951367-112951389 CGCCCCGACCGGGCCGGCGCAGG - Intronic
1074830102 10:117241696-117241718 GGCCCTGAGCGAGCTGGCGCTGG + Exonic
1075091093 10:119444537-119444559 GGCCCCAAGGGGGCATGGGCTGG - Intronic
1075119196 10:119651828-119651850 GGCCCTCAGAGGGCACGCGCGGG - Exonic
1075207065 10:120457150-120457172 CGCCGGGCGGGGGCAGGCGCCGG - Exonic
1075541602 10:123318575-123318597 GGCCCCTAGGGAGCAGGTGTGGG + Intergenic
1075802535 10:125161538-125161560 AGGCCCGCGGGGTCAGGCGCGGG + Intergenic
1076282835 10:129264072-129264094 GGCCCCGTGGGGACGGGCTCAGG - Intergenic
1076365004 10:129916054-129916076 GGCTCCGAGGGGGAAGGAGAGGG + Intronic
1076474478 10:130742846-130742868 GGCCCAGAGGAGGCAGAGGCTGG - Intergenic
1076547401 10:131254470-131254492 GCCCCCAAGGAGCCAGGCGCAGG - Intronic
1076799212 10:132812872-132812894 GGCCCAGTGGGAGCAGGCCCTGG - Exonic
1077124622 11:926806-926828 CACCCCGAGGGGACAGGCACGGG - Intronic
1077235483 11:1480165-1480187 GGCCCAGAAGGTGCAGGAGCTGG - Intronic
1077417656 11:2432374-2432396 GGCCCCGTGGGGGCAGGGGCTGG - Intergenic
1078066319 11:8081447-8081469 GGGCCCGGAGGGGCCGGCGCGGG - Intronic
1078814170 11:14802268-14802290 GGCCCCGGTGGGGTAGGCACCGG + Intronic
1080406899 11:31987569-31987591 AGCCCCGGGGTGGCGGGCGCGGG + Intronic
1080418602 11:32091467-32091489 GGCCCCGTGGGGGGCGGCGCAGG + Intronic
1081869195 11:46375669-46375691 GGCCCAGAGAGGGCAGGGTCTGG - Intronic
1082795735 11:57376641-57376663 GGCCCGGTGGGGGCTGGCGGCGG - Intergenic
1083731110 11:64653261-64653283 GGCCACAAGGGGGAAGGCGAGGG - Intronic
1083849232 11:65355440-65355462 GGGGCCGAGGGGGCAGGTGTGGG - Intronic
1083941993 11:65900721-65900743 GGCCTCGAGAGGGCTGGGGCGGG - Intergenic
1083955739 11:65982008-65982030 GGCCCTGGGAGGGCAGGAGCTGG - Intergenic
1084002619 11:66305297-66305319 TTCCCCGAGGTGGCAGGCCCAGG + Intergenic
1084007840 11:66332563-66332585 GGGCCCCAGGGGGCAGGCGGTGG + Exonic
1084151240 11:67288993-67289015 GGGCCGGAGGGGGCGGGCACTGG - Intronic
1084173255 11:67410547-67410569 GGTCCCGAGGGGGCAGACGCAGG - Intronic
1084266615 11:68008425-68008447 GGCCCAGAGAGGGCAGCCACTGG - Intergenic
1084310256 11:68312607-68312629 GCGCCCGAGGGGGGAGGCGGAGG + Exonic
1085018907 11:73192714-73192736 GGCCCAGAGGAAGCAGGCACTGG - Intergenic
1085384924 11:76152083-76152105 AGCTCCCACGGGGCAGGCGCGGG + Intergenic
1086455397 11:86955204-86955226 GGCGACGAGGGGGCAGCGGCCGG + Exonic
1087241745 11:95789250-95789272 GTCCCCGAGTGGGGAGGCGAGGG + Intronic
1088644642 11:111908001-111908023 GGCCCCGGGGGAGCAGGAGATGG - Intergenic
1089505177 11:118957761-118957783 GGCCCCGAGGGCGCACGGGGAGG - Intronic
1090383308 11:126342102-126342124 GGCTCTGAGGGGCCAGGCACGGG - Intronic
1091293887 11:134459144-134459166 TGCCCCAAGGGGTCAGGCCCTGG - Intergenic
1091996721 12:4999704-4999726 TGCCCAGAGAGGGCAGGCGCTGG - Intergenic
1092538106 12:9405049-9405071 AGCCCCGGGGGGAAAGGCGCTGG - Intergenic
1092615636 12:10213255-10213277 GGGCCCGCGGGGGCGGGGGCGGG + Intronic
1094155469 12:27333212-27333234 CGGCCCGAGAGGACAGGCGCGGG - Intronic
1095978153 12:47953966-47953988 GGCCCTGTGGGGCCAGGGGCAGG - Intergenic
1096983456 12:55742435-55742457 GCCCCTGAGGAGGCAGGTGCAGG - Intergenic
1097033325 12:56104987-56105009 GGACCTGAGCGGGCAGGCCCAGG + Intronic
1097188534 12:57208651-57208673 GGGCCAGAGGAGGCAGGCCCAGG - Intronic
1097232847 12:57522828-57522850 GGCCCCCATGGCGCATGCGCGGG + Exonic
1098255435 12:68611088-68611110 GGCCGCGCGGGGCCGGGCGCCGG + Intronic
1098293394 12:68980387-68980409 GGCCCCCAGGGATCAGGCCCAGG + Intergenic
1099116159 12:78627042-78627064 GGCCACGAGGAGCCAGGAGCAGG + Intergenic
1099826647 12:87784431-87784453 TGTCCCCAGGGGGCAGGCGAGGG - Intergenic
1102278267 12:111599128-111599150 GGCGCCGAGCGGGGAGGCGCGGG + Exonic
1102375648 12:112419132-112419154 AGCCCCGAGGGGCCCGGCGCGGG + Intronic
1102453018 12:113055742-113055764 TGCCCCGGGGAGGCAGGCGTGGG + Intergenic
1103392548 12:120584834-120584856 GGCCGCGAAGGGGCAGCGGCGGG + Intergenic
1103595504 12:122022423-122022445 GGCCCGGAGGCGGCGGGCGCCGG + Intronic
1103856005 12:123972224-123972246 GACCCCGCGGGGGCGGGCGCGGG + Intronic
1104420447 12:128630280-128630302 GGTCACTAGGGGGCAGGGGCTGG + Intronic
1104718357 12:131031097-131031119 GGCCCCGGGGAGCCAGGGGCTGG + Intronic
1104945698 12:132414079-132414101 GGCCAGGACGGGGCAGGAGCTGG - Intergenic
1107467563 13:40664876-40664898 CGCCCCGCGCGGCCAGGCGCCGG + Intronic
1108221084 13:48233553-48233575 CGCCCCGAGGTGGCGGGCGCGGG + Intronic
1112752550 13:102597212-102597234 GCCCCCGAGGGCCCGGGCGCGGG + Intronic
1113655907 13:112067728-112067750 GGCCCCGCCGGGGCGGGCGGCGG + Exonic
1113766463 13:112883708-112883730 TGTCCCGAGGGGCCAGCCGCAGG + Exonic
1113893537 13:113749020-113749042 GGCGCCCACGGGGCAGGCTCCGG + Intergenic
1114195049 14:20469608-20469630 GGCCCAGAGGGAGCTGGCGGAGG + Intronic
1115331604 14:32203678-32203700 GGCACCGAGAGGGCCGGCCCGGG + Intergenic
1118749432 14:68795452-68795474 TGCCCCGCGGGGACAGGCCCTGG - Intronic
1118808864 14:69259826-69259848 GGCCGCGCGGGGGCAGCTGCCGG + Intronic
1119262525 14:73245957-73245979 GGCTCCGATGGGGCAGGCAAGGG + Intronic
1119357585 14:74019614-74019636 GGGTCCGAGTGGGCCGGCGCGGG - Intronic
1120788002 14:88554662-88554684 GGCCCCGAGGATGCGGGAGCGGG - Exonic
1122249328 14:100427076-100427098 GGCCCCAAGGTGGCAGGGACAGG - Intronic
1122286240 14:100654585-100654607 GGCCGAGAGAGGGCAGGGGCTGG - Intergenic
1122768179 14:104085574-104085596 GGCCCCGCGGAGGCGGGCGGGGG - Intergenic
1123025055 14:105420307-105420329 GGGGCCGAGGGGGCGGCCGCGGG + Intronic
1123405624 15:20018130-20018152 GGCCCCGTGGTGGCAGGGGTGGG - Intergenic
1123514954 15:21024778-21024800 GGCCCCGTGGTGGCAGGGGTGGG - Intergenic
1124135273 15:27029763-27029785 AGCCCCGAGCTGGCAGGCTCTGG + Intronic
1124230923 15:27945525-27945547 GGCCTCTTGGGGGCAGGCTCAGG - Intronic
1124696906 15:31870856-31870878 GGCCCCGGAGGGGCGGGGGCGGG - Intergenic
1124983173 15:34582933-34582955 TGCCCCGGGGCTGCAGGCGCCGG - Intronic
1125725442 15:41866106-41866128 GGCCCTCAGGGGCCAGGAGCTGG - Exonic
1126952245 15:53893959-53893981 GGCCCTGGTGGGGCAGGCACTGG + Intergenic
1128264137 15:66253149-66253171 GACCCCGGCGGGGAAGGCGCCGG + Intronic
1129051228 15:72783543-72783565 GGTCCCGGGGGCGCAGGCGCGGG + Exonic
1129292766 15:74581078-74581100 TGCCCAGATGGGGCAGGGGCAGG - Intronic
1129503215 15:76059820-76059842 GGAGGCGAGGGCGCAGGCGCGGG + Exonic
1129538642 15:76334015-76334037 GGCCAGGAGGGGGCAGCCCCAGG - Intergenic
1129850168 15:78789299-78789321 GGCCCAGAGAGGGCAGGCACTGG + Intronic
1130252093 15:82306277-82306299 GGCCCAGAGAGGGCAGGCACTGG - Intergenic
1131257492 15:90871834-90871856 GGCCCCGAGGGTGGAGCTGCCGG + Intronic
1131529656 15:93180515-93180537 GTCCCCACTGGGGCAGGCGCTGG + Intergenic
1132055643 15:98648862-98648884 GGCCGGGCGGGGGCCGGCGCGGG + Intergenic
1132397914 15:101488507-101488529 GGCCCCGTGGGGGCCGGTGAGGG + Intronic
1132517537 16:372814-372836 AGCTCCGAGGGGGCAGGCAGAGG - Intronic
1132642815 16:985379-985401 GGCCCTGAGGGCCCAGCCGCGGG + Exonic
1132809020 16:1788802-1788824 GGCCCTGCAGGGGCAGGCCCAGG + Exonic
1132851624 16:2027296-2027318 GGGCCCGAGGGGGCTCCCGCGGG + Intronic
1133405867 16:5523949-5523971 GGCCGGGAGGAGGCAAGCGCTGG - Intergenic
1134018788 16:10907438-10907460 GGCCCCGGGGGGGCTGTCGAGGG - Exonic
1135325582 16:21523499-21523521 GGTCCCCAGGAGGCGGGCGCAGG - Intergenic
1136139768 16:28281302-28281324 GGCCCGGAGGAGGCAGGCTGGGG - Intergenic
1136233301 16:28900431-28900453 GGCCCTGAGGCGGCAAGCCCAGG + Intronic
1136375396 16:29862513-29862535 GGTCCCGAGGAGGCAGGGGAAGG + Intronic
1136707757 16:32202881-32202903 GTCCCTGGGGGGGCCGGCGCGGG - Intergenic
1136760152 16:32726530-32726552 GTCCCTGGGGGGGCCGGCGCGGG + Intergenic
1136807952 16:33143856-33143878 GTCCCTGGGGGGGCCGGCGCGGG - Intergenic
1136909194 16:34132867-34132889 GACCCGGAAGGCGCAGGCGCGGG + Intergenic
1137751418 16:50863604-50863626 GGCTCCGTGGGTGCAGGCGTGGG + Intergenic
1139467750 16:67163265-67163287 GGCCGAGAGCGCGCAGGCGCGGG - Exonic
1139476886 16:67207305-67207327 GGCCCCCAGCGGGCAGGGTCTGG - Exonic
1139545763 16:67648829-67648851 GGCCGCGAGTGGGGAGGGGCAGG - Intronic
1139967606 16:70754429-70754451 GTCCCCGAGGAGGAAGGCTCAGG + Intronic
1140887708 16:79259250-79259272 GGCCCGGAGTGGGCAAGCGTGGG - Intergenic
1141177900 16:81732813-81732835 GGCCCACAGGGGGAAGGGGCTGG - Intergenic
1142038581 16:87878077-87878099 GGTCCCCAGGAGGCAGGCACAGG - Intergenic
1142120228 16:88383359-88383381 GCCCCCGAGGGCGCAGGAGCGGG - Intergenic
1142192176 16:88723094-88723116 GGCCCCGAGGAGGCAGCGGCAGG - Exonic
1142378961 16:89721241-89721263 GGCGCGGGGCGGGCAGGCGCCGG - Intronic
1142504829 17:356742-356764 GCCTCCGAAGGGGCAGGAGCAGG - Intronic
1142598308 17:1040189-1040211 GGCCCCCAGGACGCACGCGCAGG + Intronic
1142932276 17:3296997-3297019 GGCCCAGAGGGGGCAGCTACTGG - Intergenic
1143007458 17:3846160-3846182 GGCCCCGGCGGGGCCGGCCCTGG - Exonic
1143180191 17:4979889-4979911 GGCTCCAAGGGGGCAGGTGAGGG + Exonic
1143281448 17:5757702-5757724 GACACAGAGAGGGCAGGCGCAGG - Intergenic
1143521169 17:7445195-7445217 GGCCCCGAAGGGGCAGTGACGGG + Intronic
1143558264 17:7676094-7676116 GGCCAGGAGGGGGCTGGTGCAGG + Exonic
1143649359 17:8253974-8253996 GGCCATGAGGGGGCAGCCCCTGG + Exonic
1143679668 17:8467075-8467097 GGCACCGAGGGGTGAGGCGTGGG - Exonic
1143772267 17:9176162-9176184 GGCCACGGGGGGGCAGGGGAGGG - Intronic
1144799895 17:17918949-17918971 GGCCCCCAGGTGACAGGCACTGG + Intronic
1145034819 17:19533770-19533792 GGCCCCCGGGCGCCAGGCGCGGG + Intronic
1145191535 17:20844314-20844336 AGCCCCTGGGGGGCCGGCGCGGG - Intronic
1146439062 17:32877351-32877373 CGCCCCCTGGGGACAGGCGCTGG + Intergenic
1146787334 17:35731741-35731763 CGCCCCGACTGGGCAGGCGGGGG + Exonic
1147657370 17:42098494-42098516 GGGCCCGGCGGGGCAGGGGCGGG + Intergenic
1148830113 17:50425848-50425870 TGACCCGAGGGGGCAGGGGATGG + Intergenic
1148899524 17:50865903-50865925 GGCGCCGAGGGGGCAGCGCCAGG - Intronic
1148936486 17:51167269-51167291 GGACCCGAGTGGGCAGGCGCAGG - Intronic
1150225582 17:63523048-63523070 GGACCCGACGGGGCTGGGGCGGG - Intergenic
1150634736 17:66905019-66905041 GGCCAGGAGGGGGCAGGCCCCGG + Intergenic
1151296912 17:73192841-73192863 GGGCGCGAGGGGGCGGGGGCGGG - Intronic
1151556039 17:74847233-74847255 GGCCGTGAGTGGGCAGGCCCTGG - Intronic
1151746532 17:76014613-76014635 TGCCCCGTGGGGACAGGGGCAGG + Intronic
1151854487 17:76711060-76711082 GGGCCGGAGGGGGCGGGGGCGGG - Intergenic
1151934506 17:77253823-77253845 GGCCCTGAGGTGGAAGGAGCAGG - Intergenic
1152425152 17:80214577-80214599 GGCCGCCAGGGGGAAGGGGCAGG + Intronic
1152610540 17:81313136-81313158 GGCCCCGGTGGGGCTGGGGCTGG + Exonic
1152615143 17:81334464-81334486 GGCCCCCAGTGGGCCGGCTCTGG + Intergenic
1152626533 17:81390291-81390313 GGTCGGGAGGGGGCAGGCGCTGG + Intergenic
1152627201 17:81393279-81393301 GGCCCCGCGGGTGCAGGCGGAGG - Intergenic
1152695306 17:81741134-81741156 TGCCCAGAGGGGGCAGGCGTGGG - Intergenic
1152697663 17:81804817-81804839 GGCGCCGGGGGGGCCGGAGCCGG - Intronic
1152742163 17:82023118-82023140 GGCCCCGGGAGGGCATGCTCCGG - Intronic
1152809503 17:82374915-82374937 GGCCCCAGGCGGGCAGGCACAGG - Exonic
1152822140 17:82442802-82442824 AGCCCCTAGGCGGCAGGCCCAGG - Exonic
1153006285 18:500826-500848 TGCCCGGCGAGGGCAGGCGCGGG - Intergenic
1153265248 18:3262606-3262628 GGCGCCGGGAGGGCAGGCGTTGG - Exonic
1153565666 18:6414920-6414942 GGGCGCGAGGGTGCACGCGCGGG + Intronic
1154125633 18:11689710-11689732 CGCCCCGAGGGAGCAGGGTCCGG - Exonic
1154241619 18:12658153-12658175 GCCCCCTAAGGGGCGGGCGCTGG - Intronic
1155035279 18:22020611-22020633 GCCCCCGAGGGGTCAGCCGAGGG - Intergenic
1155928941 18:31685573-31685595 GGCCCCGGTGCGGCGGGCGCGGG - Intronic
1156448620 18:37254113-37254135 GCCCCTCCGGGGGCAGGCGCTGG + Intronic
1158579856 18:58671680-58671702 GGCCCCGTGGGGGCGGCCGAGGG - Exonic
1158931022 18:62325231-62325253 GGCGGCGCGGGGGCAGGTGCGGG + Intergenic
1160410574 18:78673092-78673114 GCCCTCGAGGGGGCTGGCACGGG + Intergenic
1160752011 19:738805-738827 GGGGCCGAGGGGCCAGGCGATGG + Intronic
1160760358 19:781090-781112 GGCCCCGGAGGGGCGGGGGCAGG + Intergenic
1160790353 19:920152-920174 GGCACCGTGGTGGGAGGCGCCGG + Intronic
1160851408 19:1194664-1194686 GGCCGCCAGGTGGCGGGCGCGGG - Intronic
1160858673 19:1228535-1228557 GGCCCTGAGGGAGCCGGCCCCGG - Exonic
1160897334 19:1408746-1408768 GGCCCCGCGGGGTCCGGAGCAGG - Intronic
1160907266 19:1457216-1457238 GGGCCCGAGGGAGGTGGCGCCGG + Exonic
1160984912 19:1834014-1834036 GGCCCCAGGAGGGCAGGCGGGGG + Intronic
1161001771 19:1914358-1914380 AGGCCCGAGGGGGCGGGCACGGG - Intronic
1161080640 19:2308303-2308325 GGCCACGTGGGCGCAGGTGCGGG + Intronic
1161167613 19:2796718-2796740 GCTCCCGAGGAGGCAGGGGCAGG - Intronic
1161216772 19:3098622-3098644 TGCCCCGTGGGGGCTGGCGCAGG - Intronic
1161234166 19:3189819-3189841 GGCCCCGAGCGAGCGGGGGCTGG + Intronic
1161304114 19:3557470-3557492 GGTGCCGTGGGGGCAGGCGCCGG + Exonic
1161309391 19:3585655-3585677 GGCTCCGAGGGCGCGGGCGGGGG - Exonic
1161430420 19:4229292-4229314 GGCCCCGAGGGTGGGGGCGGGGG - Intergenic
1161703060 19:5805316-5805338 GGGCCGGAGGGGGCGGCCGCGGG - Intergenic
1161811740 19:6475417-6475439 GGCCCTGAGTGGGCAGGTGTGGG + Intronic
1161867851 19:6847828-6847850 GGCCCCGTGGAGGCAGGGGCCGG - Intronic
1162128480 19:8511736-8511758 GGTCCGGTGGGGGCAGGGGCGGG + Exonic
1162140200 19:8580798-8580820 GGCCCCGGGGGGGCGGGAACTGG - Exonic
1162412997 19:10517636-10517658 GGCCCGGAGGGGGCAGCTGAGGG - Intronic
1162421646 19:10568905-10568927 GGCCCCCAAGGGGCGGGCGCCGG - Exonic
1162578652 19:11514197-11514219 GGCCCCGAGGGAGCCGGCGAGGG + Exonic
1162908508 19:13837084-13837106 GGCCACGGGGGGGGAGGCCCTGG - Intergenic
1163019666 19:14475420-14475442 GGCCCCCAGCGGGCGTGCGCGGG - Intergenic
1163103119 19:15109334-15109356 GGCCCCGGGGGCTCAGGTGCTGG - Exonic
1163117897 19:15199741-15199763 GGCCCGGACGGGGCAGGACCAGG - Intronic
1163314199 19:16531381-16531403 TGCCCAGCGGGGGGAGGCGCCGG + Intronic
1163584723 19:18157428-18157450 GGCCTCGAGGGGGCGGGTTCTGG - Intronic
1163666559 19:18606471-18606493 GGCGCCCCGGGGGCAGCCGCGGG - Intronic
1163793357 19:19321150-19321172 GGCCGCGAGGGAGGAGTCGCGGG + Intronic
1164078843 19:21845320-21845342 GGCCCCCTGTGGGCAGGCCCAGG + Intronic
1164693628 19:30227863-30227885 GGCGCGGAGGGGGCCGGCGGAGG + Intergenic
1165453939 19:35900189-35900211 GGCCCCGAGGGTGCAAGGGCTGG - Intronic
1166290488 19:41860366-41860388 GGCCCCGAGGCGCCCGGCGCGGG + Intronic
1166506202 19:43373161-43373183 GGCCCCAAGGATGAAGGCGCTGG - Intergenic
1166677477 19:44748626-44748648 GGCCCCGGGGGGGCCGGGGGCGG + Exonic
1166824823 19:45602179-45602201 TGCCCCGCGGGGGCATCCGCTGG - Exonic
1167096504 19:47377463-47377485 GAGCCCGAGAGGGCAGGGGCTGG - Intronic
1167277173 19:48545525-48545547 GTTCCCGAGGGGGCAGGGGCTGG - Intergenic
1167351678 19:48978915-48978937 GGGACCCAGGGGGCAGGCCCTGG + Intronic
1167380358 19:49134708-49134730 GGCCCTGAGGGGACAGGAGGAGG + Intronic
1167466217 19:49652164-49652186 GCCGCCGCGGGGGCAGCCGCAGG + Exonic
1167697867 19:51025632-51025654 GGCCTGGAGGGGGGAGGAGCGGG + Exonic
1167703437 19:51064899-51064921 GGCCCCGAGTGGGCGGGGGGCGG + Intronic
1168069828 19:53943200-53943222 GGCCTCGAGGGGGGAGAGGCGGG - Exonic
1168102342 19:54148007-54148029 GTCCCCAAGAGGGCAGGAGCAGG + Intronic
1168277020 19:55284230-55284252 GGCCCGGGGGGGTCAGGCCCCGG - Exonic
1168297303 19:55383739-55383761 GGGCCCGGGGCGGCGGGCGCGGG - Exonic
1168335212 19:55593402-55593424 GGCCCCGAGGGGGCAGGCGCGGG - Exonic
1168339433 19:55614900-55614922 GCCCACGCGGGGGCGGGCGCCGG + Exonic
1168350838 19:55674822-55674844 GGCCTCGAGGCTGCCGGCGCCGG - Intergenic
1168636733 19:58002666-58002688 GGCGCGGAAAGGGCAGGCGCAGG + Exonic
925069649 2:956287-956309 TGCCCAGCAGGGGCAGGCGCAGG - Intronic
925171160 2:1750978-1751000 GGCCTCTAGAGGGCAGACGCAGG - Intergenic
926914410 2:17878700-17878722 GCCGCCGCGGCGGCAGGCGCGGG + Intronic
927030603 2:19117107-19117129 GGACAGCAGGGGGCAGGCGCAGG - Intergenic
927517887 2:23682645-23682667 GAGCACGAGGGGGCAGGTGCAGG - Intronic
929681309 2:43995857-43995879 GGCCGCCAGGGAGGAGGCGCAGG + Exonic
930641738 2:53860068-53860090 GGGCCCCAGGAGGCAGGCGACGG - Intergenic
931665909 2:64609447-64609469 GCCCCCGAGCGGGCGGGCGGCGG - Intergenic
932039483 2:68284077-68284099 GGTCCCGTGGGGGCAGGAGATGG - Intergenic
933644393 2:84798797-84798819 GGCCCCTAGGGGTCAAGCACTGG - Intronic
935594315 2:104867597-104867619 AGCCCCGCGGGCCCAGGCGCGGG - Intergenic
937259567 2:120576820-120576842 GCCACCGAGGGGGCACGAGCTGG + Intergenic
938063827 2:128270574-128270596 GGGCCCGAGGCGGCCGGGGCAGG + Intronic
941119084 2:161507778-161507800 GGGCTCGAGGGGGCGAGCGCTGG - Intronic
943703061 2:191006948-191006970 GGCAAGGAGGGGGCAGGGGCAGG - Intronic
946027341 2:216679734-216679756 GGCCCGGAGGGGACCGGCGTGGG + Intronic
946328279 2:218996182-218996204 GGCCACCAGAGGGCAGGAGCAGG + Intergenic
946852256 2:223919045-223919067 GGCCCTGAGAGTGCAGGAGCAGG - Intronic
947154319 2:227146173-227146195 GGCCCCGAGGGGGCCAGCTCGGG + Intronic
947632295 2:231662121-231662143 GGCGCCCAGGGCGCAGGCGCCGG - Intergenic
947754322 2:232550792-232550814 GCCCCAGCGGGGGCGGGCGCGGG - Intronic
948118961 2:235514672-235514694 GGCCACCAGGTGGCAGGCCCTGG - Intronic
948547530 2:238743359-238743381 GGCCCCAAGAGAGCAAGCGCTGG - Intergenic
948710277 2:239820974-239820996 GGCCACGTGGGGGCAAGGGCGGG + Intergenic
948746225 2:240095905-240095927 GGGCCCGCGGGTGCAGGGGCTGG + Intergenic
948843648 2:240672619-240672641 GGCCCCGGGGGTGCAAGCGGTGG + Intergenic
948850116 2:240701691-240701713 GGCCCCGAGGGTGGAAGCGGTGG - Intergenic
1169068582 20:2708081-2708103 GGCGGCGAGGGGGCAGGGCCTGG - Intronic
1169164119 20:3407690-3407712 GGCCCGGCGGGGGCGGGGGCGGG + Intergenic
1169207824 20:3749904-3749926 GGCCGCCAGGGGGCAGTGGCGGG - Intronic
1169471266 20:5887626-5887648 AGGCCCGAGGGGGCATGGGCAGG + Intergenic
1170226315 20:13995364-13995386 GGGCCCCAGGGCGCACGCGCAGG - Exonic
1170991253 20:21303546-21303568 GGCTCCCCGGGGGCAGGCGGCGG - Intronic
1171359542 20:24577398-24577420 TGCCCCGATGGTGCAGGTGCTGG + Intronic
1171823251 20:29874399-29874421 GACCCCGAGGGCGCAGGCACGGG + Intergenic
1171896846 20:30815913-30815935 GACCCCGAGGGCGAAGGCGCGGG - Intergenic
1171904655 20:30891635-30891657 GACCCGGAAGGCGCAGGCGCGGG + Intergenic
1172702891 20:36863583-36863605 GAGGCCGAGGGGGCGGGCGCCGG - Exonic
1173258623 20:41413439-41413461 GGAGCCGAGGTGGCAGGCCCTGG + Exonic
1173603335 20:44311295-44311317 GGCCACGAGGGGGAGCGCGCGGG - Intergenic
1174386620 20:50191349-50191371 TGCCCGGAGGAGGCGGGCGCGGG - Exonic
1175132956 20:56803204-56803226 GGCCCAGACGAGGCAGGTGCGGG - Intergenic
1175358670 20:58389701-58389723 GGACCCGAGAGGGCTGGTGCGGG + Intronic
1175851809 20:62097756-62097778 GGCTCTGAAGGGGCAGGTGCAGG + Intergenic
1175873778 20:62220146-62220168 GGTGCCGAGGGGGCCGGGGCCGG + Exonic
1176106775 20:63393299-63393321 GGCCCAGAGGAGGAAGGAGCAGG + Intergenic
1176106823 20:63393429-63393451 GGCCCAGAGGAGGAAGGAGCAGG + Intergenic
1176138484 20:63535259-63535281 GACCCGGCGGGGGCAGGGGCAGG + Intronic
1176178566 20:63739600-63739622 GACCCGGAGGGGGCGGGCCCGGG + Intronic
1176274338 20:64255415-64255437 GGCCCCGAGTCAGCAGCCGCAGG + Intergenic
1176289280 21:5035613-5035635 GGCTCCGAGGAGCCTGGCGCTGG - Intronic
1176521757 21:7829733-7829755 GGACCCGGGGGGGCCGGGGCTGG - Intronic
1176550023 21:8217026-8217048 GGCCCCGCGGCGGCCGCCGCCGG - Intergenic
1176869396 21:14073672-14073694 GACCCCCTGGGGCCAGGCGCAGG + Intergenic
1178314829 21:31559110-31559132 GCCCCCGAGGCCGCAGGCGGAGG - Intronic
1178655777 21:34459745-34459767 GGACCCGGGGGGGCCGGGGCTGG - Intergenic
1179030962 21:37719098-37719120 AGCCCCGAGGGGCCAGGAGGAGG + Intronic
1179290853 21:40016639-40016661 GGCCCCGAAGGTGCAGGCTGAGG + Intronic
1179445366 21:41426803-41426825 GGCCGAGATGGGGCATGCGCGGG + Intronic
1179783997 21:43719502-43719524 GGCGCCCTGGAGGCAGGCGCGGG + Intronic
1179796769 21:43789542-43789564 GGCCAGGAGGAGGCGGGCGCAGG + Exonic
1179867955 21:44227991-44228013 GGCTCCGAGGAGCCTGGCGCTGG + Intronic
1179980432 21:44892949-44892971 CGCCCCCTGGGGGCAGACGCCGG - Intronic
1180078080 21:45473236-45473258 GGGCCCGAGAGGGCAGGGTCAGG + Intronic
1180147178 21:45928133-45928155 GGCCCTGCGGGGGCAGGAGGAGG - Intronic
1180799356 22:18624587-18624609 GTCCCCGTGGGGGCAGGCTGTGG + Intergenic
1181120759 22:20667742-20667764 AGCCCCTGGGGGGCCGGCGCGGG + Intergenic
1181222362 22:21370679-21370701 GTCCCCGTGGGGGCAGGCTGTGG - Intergenic
1181333724 22:22114769-22114791 AGCCCCTGGGGGGCCGGCGCGGG + Intergenic
1181595886 22:23914078-23914100 GGCTCTAAGGGGGCAGGCGAAGG + Intergenic
1181638122 22:24183665-24183687 GTCCCCGTGGGGGCAGGCTGTGG - Intronic
1181638739 22:24186113-24186135 CGACCTGAGGGTGCAGGCGCGGG + Exonic
1181843951 22:25690941-25690963 GTCCCCGAGGTGTCAGGTGCTGG - Intronic
1182123561 22:27801254-27801276 GGCTGCGAGGCGGCAGGCGCCGG + Exonic
1183587524 22:38761395-38761417 GGCCCCGGGCTGGCAGCCGCAGG - Intronic
1183830775 22:40417450-40417472 TGGGCAGAGGGGGCAGGCGCTGG + Exonic
1183924689 22:41197479-41197501 GGCGCCGGGCGGGCACGCGCTGG + Intergenic
1184245605 22:43234460-43234482 GGCCCAGATGGGGCAGGGGATGG - Intronic
1184255796 22:43286096-43286118 GGCCCTGAGAGGGCAGGGCCTGG - Intronic
1184335959 22:43853421-43853443 GGCCCAGAGTGGGCAGGGGTGGG - Intronic
1184641771 22:45876760-45876782 TGGCCCGAGGGGACAGGCTCAGG + Intergenic
1184679419 22:46062079-46062101 GGCCCCGGGGCGGGAGGTGCGGG - Intronic
1184759567 22:46537033-46537055 GGGCCGGAGGGCGAAGGCGCGGG + Exonic
1185006192 22:48278264-48278286 GGCCCCGAGGAGGCGGGAGATGG - Intergenic
1185279989 22:49965899-49965921 GGCCCAGGGGCGGCAGGAGCTGG + Intergenic
1185382586 22:50516968-50516990 GGCCCCGTGGCGGCAGGAGCTGG + Intronic
1203254913 22_KI270733v1_random:133352-133374 GGCCCCGCGGCGGCCGCCGCCGG - Intergenic
1203262969 22_KI270733v1_random:178431-178453 GGCCCCGCGGCGGCCGCCGCCGG - Intergenic
949559372 3:5187959-5187981 GGCCCCGAGGTGGGCGACGCGGG - Exonic
949860975 3:8504477-8504499 ACCCCCGAGGGGGCTGGGGCGGG + Intronic
951078547 3:18425274-18425296 GGCCCCGCTGGGGAAGGCTCCGG - Intronic
951485205 3:23202971-23202993 GGCCGCGAGGGGGCGGGGGCGGG - Intergenic
952382980 3:32818600-32818622 GGTGCCGAGCGGGAAGGCGCGGG - Exonic
953326106 3:42013712-42013734 GGCCCCGGGGCGGCGGGCGGGGG - Intergenic
954390347 3:50265211-50265233 GGCACAGTGGGGGCAGGCGTGGG - Intergenic
954718008 3:52536462-52536484 GGCCTCGAAGGAGCTGGCGCAGG - Intronic
955750925 3:62184881-62184903 AACTCCGAGGGGGCAGGTGCTGG + Intronic
961365767 3:126398308-126398330 GGCCCAGAGGGACCAGCCGCAGG - Intronic
961639183 3:128354177-128354199 GGCACCGTGAGGGCAGGAGCTGG - Intronic
961762688 3:129183458-129183480 GGCCCCAAGGGCGCACGGGCGGG + Intronic
962745997 3:138397515-138397537 GCGCCCTAGGAGGCAGGCGCAGG - Intronic
968068991 3:195774272-195774294 TTCCCCTATGGGGCAGGCGCCGG - Exonic
968453903 4:687716-687738 GGACCCAAGGGGGCGAGCGCAGG - Intronic
968473724 4:793288-793310 GGCCCTGCTGGGGCAGGAGCTGG + Intronic
968592524 4:1466113-1466135 GGCCCCGAGGAGGCCGTGGCAGG - Intergenic
968701510 4:2060063-2060085 GGCCCCGAGCGGGCCGGAGCCGG + Intronic
968717086 4:2168278-2168300 GGCAGGGAGGGGACAGGCGCTGG + Intronic
968814059 4:2812668-2812690 GCCCCCGAGCTGGCAGGCACAGG + Intronic
968907574 4:3461801-3461823 GGCCCCCAAGGGGCTGGCCCAGG - Intergenic
968943181 4:3649961-3649983 GCTCCCGAGGGGCCAGGCCCTGG - Intergenic
968950397 4:3688518-3688540 GGCCCTGAGGGAGGAGGTGCAGG + Intergenic
969714242 4:8860831-8860853 GACCCCGAGGGGTAAGGGGCCGG + Intronic
971409913 4:26359562-26359584 GGCCTCGAGGCTGCCGGCGCCGG - Intronic
972740405 4:41881896-41881918 GGCGCCCAGGGGGCGGGGGCGGG - Intergenic
974069370 4:57110210-57110232 AGCCCAGCGGGGGCAGGGGCGGG + Exonic
977536532 4:98261300-98261322 GGCTCCGAGCGGGCGGGCGGCGG - Intergenic
979231550 4:118353060-118353082 TGCCCCCTGGGGGCGGGCGCCGG + Intergenic
979674775 4:123398676-123398698 GGCCCCCAGGGGGCAGGGAGCGG - Intronic
981531952 4:145761923-145761945 GGCTCCGAGGGGCCGGGCGGGGG - Intronic
982783545 4:159516368-159516390 GGCCCAGAGTGGGCAGGCATGGG + Intergenic
985444695 4:190015470-190015492 GACCCCGAGGGCGCAGGCGCGGG + Intergenic
985688665 5:1295105-1295127 GGCCCGGAGGGGGCTGGGCCGGG + Intergenic
986269081 5:6216039-6216061 GGCCCCCAGGGGGTGGGCGATGG + Intergenic
986330492 5:6713578-6713600 GGGGCCGAGGGGGCGGGCCCAGG - Intergenic
986695783 5:10353649-10353671 GGCGCCGAGGCGGAAGGGGCGGG - Intergenic
990176053 5:53109758-53109780 GGCCGCAAAGGCGCAGGCGCGGG + Exonic
995010759 5:107255122-107255144 GGGACCGAGGGGGCTGGCACAGG + Intergenic
999720772 5:154397841-154397863 GAACCCGAGAGGGCAGGGGCTGG - Intronic
1002058197 5:176610471-176610493 GGCTCAGAGGGGGCAGTCGCCGG + Intergenic
1002322611 5:178384628-178384650 GGCTCAGAGGGGGCAGGGCCGGG + Intronic
1002512675 5:179733065-179733087 GGCCCCGAGAGGCCCGGCCCCGG + Exonic
1002692432 5:181059577-181059599 GGCGCCGCGGGGGCACGCGCAGG - Exonic
1003175894 6:3751968-3751990 GGCCGCGAGGGAGGAGGCGCGGG - Exonic
1003426068 6:5999276-5999298 GGCCGCCAGCGGGGAGGCGCAGG - Intronic
1004599432 6:17133188-17133210 GCCCTGGAGGGGGCAGGGGCAGG - Intergenic
1004690436 6:17987990-17988012 GGCCCCGCGGGCGCCGGTGCAGG - Intergenic
1005853655 6:29843478-29843500 TGCCCCAAGGGGGCAGCTGCTGG + Intergenic
1006386357 6:33733276-33733298 AGCCCCAAGGGGGCTGGCCCTGG + Intronic
1006611689 6:35297998-35298020 GGCTCCCAGGCGGCAGGGGCTGG - Intronic
1007260295 6:40558619-40558641 GGCCCAGTGGGGGAAGGCGAGGG + Intronic
1007412671 6:41673972-41673994 GGCCCCCAGGGAACAGGAGCAGG + Intergenic
1007739510 6:44002273-44002295 GGCCCCGCGGGGGAGGGCGTGGG - Intronic
1014098279 6:117482922-117482944 GGACCCGAGGCGCCAGGGGCGGG + Intronic
1015492122 6:133838100-133838122 AGCCCCCGGGGAGCAGGCGCGGG - Intergenic
1018705345 6:166460189-166460211 GGCCCAGAGGGGGCATGGGAAGG - Intronic
1019294288 7:265834-265856 GGCCCCGATGGCTCAGGGGCGGG - Intergenic
1019343077 7:517611-517633 GGCTCCGCGGGGGCTGGGGCGGG - Intronic
1019343476 7:519108-519130 GGCCCGGAGGAGGGTGGCGCGGG + Exonic
1019485270 7:1286299-1286321 GGCCCTGAGGTGGGAGGGGCCGG + Intergenic
1019550159 7:1598191-1598213 GGCCCAGAGGGAGCAGGGGCTGG - Intergenic
1019719416 7:2559275-2559297 GGCCCCGAGGCTGCGGGCGACGG - Intronic
1019742338 7:2681051-2681073 GGCCACGAGGGGGCATCCGTGGG - Intronic
1020002218 7:4762435-4762457 GGCCCCCAGGGGCCAGGCACCGG + Exonic
1020070400 7:5223483-5223505 GGACACGAGGAGGCAGGAGCTGG - Intronic
1020270143 7:6589980-6590002 GGCCCGCAGGGGCCAAGCGCAGG - Intergenic
1020274376 7:6615703-6615725 GGCCGCGCGGGGGCCGGGGCGGG - Exonic
1024226845 7:47331958-47331980 GGCTCTGATGGGGCAGGCCCGGG + Intronic
1025912778 7:65841176-65841198 GGCCACCAGGAGGCAGGAGCTGG - Intergenic
1026046046 7:66905851-66905873 GGCCACTAGGAGGCAGGAGCTGG - Intergenic
1028086640 7:86644640-86644662 AGCCGGGAGGGGGCAGGGGCAGG + Exonic
1028630323 7:92926807-92926829 GGCCCCGGTGGGGTAGGCACTGG + Intergenic
1029506431 7:100966300-100966322 GGCCCCGCGGGGGCGGGTGAGGG - Intronic
1029680764 7:102107575-102107597 GGCCCCGGGTGGGCGGGAGCTGG - Intronic
1029816922 7:103106267-103106289 GGCCCTGGTGGGGCAGGCACCGG - Intronic
1030354319 7:108526000-108526022 AGCCGCGAGGGGACAGGGGCGGG - Intronic
1030639596 7:111989088-111989110 GGACCTGAGGCGGCAGGTGCTGG - Exonic
1031011153 7:116526144-116526166 GGCGGCGAGGGGGCAGCCGCAGG - Intronic
1032085941 7:128884026-128884048 GGGGCCCAGGGGGCAGGAGCTGG + Exonic
1033412576 7:141132555-141132577 GGCCCCCAGGTGGCACGTGCAGG - Intronic
1033660575 7:143399257-143399279 GGCCCCCAGGTGGCATGCACAGG - Exonic
1034497873 7:151432993-151433015 GGCCCCGTGAGGGCAGGAGGGGG - Intronic
1034956308 7:155337541-155337563 GGGCCCGAGGGGGGAGGGCCGGG + Intergenic
1034988846 7:155534803-155534825 GGCACTGAGGGAGCGGGCGCTGG + Intergenic
1035580641 8:737599-737621 GGCGCCGAGTGCGCAGGCGCCGG + Intronic
1036767932 8:11560709-11560731 TGCCCCCACGGGGCAGGCGCTGG + Intronic
1037820055 8:22131089-22131111 GCCCGGGAGGGGGCAGGCCCAGG - Exonic
1038636667 8:29292911-29292933 GGCCCCGTGGGGACAGACGGGGG - Intergenic
1039884305 8:41646594-41646616 GGCGGCGCGGGTGCAGGCGCAGG - Exonic
1040676434 8:49756587-49756609 GACCCCGAGTGAGCAGGGGCTGG + Intergenic
1041689891 8:60678671-60678693 GGCCCGGAGGGAGCTGGCGGCGG + Intergenic
1042226756 8:66520419-66520441 GGCCCCGAGTGGGAAGGAGGAGG - Intergenic
1042859084 8:73295149-73295171 GGCACCTCGGGGGCGGGCGCGGG + Exonic
1043472593 8:80578043-80578065 GGCCCCCGGAGGGGAGGCGCCGG - Intergenic
1045047677 8:98294419-98294441 GGCCCCGAGGATGCAGACACTGG - Intergenic
1045266070 8:100619602-100619624 GGCCCCATGTGGGCAGCCGCTGG - Intronic
1047206589 8:122807157-122807179 GGCTCCTACTGGGCAGGCGCAGG + Intronic
1048345044 8:133570008-133570030 GGCCCCAAGGTGGAAGGTGCTGG - Intronic
1049004616 8:139846819-139846841 GGCCCAGGGTGAGCAGGCGCAGG + Intronic
1049214048 8:141399537-141399559 GGCCCAGAAAGGGCAGGAGCAGG - Intronic
1049236146 8:141513350-141513372 GGCCCCGAGGGGCAGGGCCCTGG + Intergenic
1049442287 8:142614875-142614897 GGGCTGGAGGGGGCTGGCGCTGG + Intergenic
1049613695 8:143567356-143567378 GGGCCCGCGGGGGCAGCCCCGGG + Exonic
1049689397 8:143952075-143952097 GATCCCGAGGTGGGAGGCGCTGG + Intronic
1049759712 8:144326506-144326528 GGCCCCGACGTGGGAGCCGCGGG - Exonic
1049788530 8:144462626-144462648 GGCGCCGAGGAGGCCGGCGGGGG - Intronic
1049861267 8:144901093-144901115 GGGCCCAAGGGGGTAGGGGCGGG + Intronic
1051105019 9:13569526-13569548 GGGGCCGAGGGGGCTGGGGCTGG - Intergenic
1053114526 9:35489819-35489841 CACCCCGCGGGGGCGGGCGCGGG + Intergenic
1053749472 9:41237210-41237232 GACCCCGAGGGTGCAGGCGCGGG - Intergenic
1054254917 9:62802090-62802112 GACCCCGAGGGTGCAGGCGCGGG - Intergenic
1054336391 9:63813515-63813537 AACCCCGAGGGTGCAGGCGCGGG + Intergenic
1057600049 9:96450129-96450151 GGCGCCGCGGGGGCGGGCGCCGG + Intergenic
1057669646 9:97076853-97076875 TGCCCCGTGGGCGCAGGAGCAGG - Intergenic
1058835468 9:108855662-108855684 TGCCCCGAGGCGGCCGACGCTGG - Exonic
1060985521 9:127817004-127817026 GGCCCAGAAGGGGCAGGAGGAGG - Intronic
1061052401 9:128204217-128204239 CGCGGCGAGGGGGGAGGCGCGGG + Intronic
1061149184 9:128819224-128819246 GGCCCCGCGAGGCCAGGCGCCGG - Intronic
1061202511 9:129145965-129145987 GGCTCTGAGGGGGCTGGCTCTGG + Intronic
1061212674 9:129202922-129202944 GGCCCGGGCGGGGCGGGCGCTGG - Intergenic
1061293593 9:129665835-129665857 GGCCCCGGGGGGGCCGGCGGGGG - Exonic
1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG + Intronic
1061779980 9:132989703-132989725 GGCCCCGGGGGGTCAGGTGCAGG - Intronic
1061962574 9:133995601-133995623 GGCCAGGAGGGGGCAGATGCTGG - Intergenic
1062291773 9:135798520-135798542 GGCCCCCAGGGGACAGGAGGAGG - Intergenic
1062381876 9:136290647-136290669 GGCCCGGCGGCGGCAGGCCCTGG - Exonic
1062398508 9:136362393-136362415 GGCACATAGGGGGCAGGAGCAGG - Intronic
1062461712 9:136665181-136665203 GGCCAGGTGGGGGCCGGCGCAGG + Intronic
1062502003 9:136855656-136855678 GGAGCCAAGGGGGTAGGCGCCGG + Intronic
1062631295 9:137464284-137464306 GGCCAGGAGGGGACAGGCACTGG + Intronic
1062696195 9:137877609-137877631 AGCCCCGGGGTGGGAGGCGCGGG + Intergenic
1203794399 EBV:168962-168984 GTCCTCGAGGGGGCCGTCGCGGG + Intergenic
1203376322 Un_KI270442v1:380932-380954 GACCCCGAGGGCGCAGGCGCGGG + Intergenic
1187507291 X:19887805-19887827 GGCCGCGTCGGGGCAGGCGCCGG + Intergenic
1189491309 X:41473509-41473531 GGCCCCCACGGCCCAGGCGCTGG - Exonic
1192561716 X:72131792-72131814 GGCCCGGAGGCGCCAGGCGGAGG + Exonic
1197335165 X:125203691-125203713 CGCCCCGAGGCTGCAGGCGGCGG - Intergenic
1197719619 X:129736277-129736299 TGCCCAGAGAGGGCAGGCTCAGG + Intergenic
1197769306 X:130079972-130079994 GGCCACTAGGGGGCAGGCTTTGG + Intronic
1198051853 X:132958248-132958270 GGCCCCGAGTGAGCAGGGCCCGG + Exonic
1199613833 X:149639726-149639748 GCCCCTCAGGGGGCAGGCTCAGG + Intergenic
1200060693 X:153482482-153482504 GGGACCGAGGGGGCAGGCCTGGG + Intronic
1200292103 X:154884801-154884823 GGCCTCGAGGGAGCAGGCCTGGG - Intronic
1200338941 X:155380538-155380560 GGCCTCGAGGGAGCAGGCCTGGG - Intergenic
1200347528 X:155460154-155460176 GGCCTCGAGGGAGCAGGCCTGGG + Intergenic
1200831120 Y:7689533-7689555 GGCCCTCAGGGGGCATGCGCCGG + Intergenic