ID: 1168337651

View in Genome Browser
Species Human (GRCh38)
Location 19:55605579-55605601
Sequence GACTTCCGCTTCCGGGCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 62}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168337646_1168337651 -7 Left 1168337646 19:55605563-55605585 CCTCGGGAACGGGCGCGACTTCC 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1168337651 19:55605579-55605601 GACTTCCGCTTCCGGGCGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 62
1168337635_1168337651 22 Left 1168337635 19:55605534-55605556 CCTCCTCTTTCCGATCCTCCACG 0: 1
1: 0
2: 0
3: 10
4: 193
Right 1168337651 19:55605579-55605601 GACTTCCGCTTCCGGGCGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 62
1168337638_1168337651 12 Left 1168337638 19:55605544-55605566 CCGATCCTCCACGCCGGCGCCTC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1168337651 19:55605579-55605601 GACTTCCGCTTCCGGGCGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 62
1168337645_1168337651 -1 Left 1168337645 19:55605557-55605579 CCGGCGCCTCGGGAACGGGCGCG 0: 1
1: 0
2: 0
3: 11
4: 81
Right 1168337651 19:55605579-55605601 GACTTCCGCTTCCGGGCGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 62
1168337633_1168337651 28 Left 1168337633 19:55605528-55605550 CCACCGCCTCCTCTTTCCGATCC 0: 1
1: 0
2: 0
3: 45
4: 591
Right 1168337651 19:55605579-55605601 GACTTCCGCTTCCGGGCGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 62
1168337636_1168337651 19 Left 1168337636 19:55605537-55605559 CCTCTTTCCGATCCTCCACGCCG 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1168337651 19:55605579-55605601 GACTTCCGCTTCCGGGCGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 62
1168337641_1168337651 7 Left 1168337641 19:55605549-55605571 CCTCCACGCCGGCGCCTCGGGAA 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1168337651 19:55605579-55605601 GACTTCCGCTTCCGGGCGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 62
1168337642_1168337651 4 Left 1168337642 19:55605552-55605574 CCACGCCGGCGCCTCGGGAACGG 0: 1
1: 0
2: 3
3: 30
4: 87
Right 1168337651 19:55605579-55605601 GACTTCCGCTTCCGGGCGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 62
1168337634_1168337651 25 Left 1168337634 19:55605531-55605553 CCGCCTCCTCTTTCCGATCCTCC 0: 1
1: 1
2: 5
3: 291
4: 2500
Right 1168337651 19:55605579-55605601 GACTTCCGCTTCCGGGCGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168337651 Original CRISPR GACTTCCGCTTCCGGGCGGG CGG Intronic