ID: 1168340659

View in Genome Browser
Species Human (GRCh38)
Location 19:55621469-55621491
Sequence CAGCCCGTGGGCCTTGCCTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168340654_1168340659 8 Left 1168340654 19:55621438-55621460 CCAACCAAGAGACAGTCGGGGAA 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1168340659 19:55621469-55621491 CAGCCCGTGGGCCTTGCCTTTGG 0: 1
1: 0
2: 1
3: 11
4: 144
1168340655_1168340659 4 Left 1168340655 19:55621442-55621464 CCAAGAGACAGTCGGGGAAGTGA 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1168340659 19:55621469-55621491 CAGCCCGTGGGCCTTGCCTTTGG 0: 1
1: 0
2: 1
3: 11
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168340659 Original CRISPR CAGCCCGTGGGCCTTGCCTT TGG Exonic
900110221 1:1002078-1002100 CAGCCCCTGGGCCCCGGCTTGGG + Intergenic
901394950 1:8974341-8974363 CCCCCCGTGGCCCTTGCCTGAGG - Exonic
902864483 1:19269302-19269324 CAGCCCGTGGGCCGCTTCTTTGG - Intergenic
902866711 1:19284716-19284738 CAGCCCGTGGGCCGCTTCTTTGG - Exonic
902952478 1:19897191-19897213 CTGCCCCTGGGCCTTCCCCTTGG + Intronic
903327472 1:22577650-22577672 GAGCCCCTGGGCCATGACTTAGG + Intronic
904617909 1:31759921-31759943 CAGACCATGAGCCTTGCCCTGGG + Intronic
906706721 1:47900290-47900312 GAGCAAGTGGGCCCTGCCTTAGG - Intronic
908480529 1:64534864-64534886 CAGCCCCCTGGCCTTGCCCTTGG + Intronic
912570126 1:110615345-110615367 CAGGCAGTGGGGCTTGCCCTGGG + Intronic
922618571 1:226977451-226977473 CTGGCCGTGGGCCTGGGCTTCGG + Exonic
922741739 1:228017979-228018001 CAGCACGGGGGCTTTGCCATTGG + Intronic
923535955 1:234852007-234852029 CAGCCCCAGCTCCTTGCCTTGGG + Intergenic
924030740 1:239882826-239882848 CAGCCAGTGTGCCCTGCCTTAGG - Intronic
1062996876 10:1874358-1874380 CAGCCCCTGTGGCCTGCCTTTGG + Intergenic
1064070126 10:12221605-12221627 CAGCCCGTGGGCCATGGCCCGGG + Intronic
1065354817 10:24829637-24829659 GAGCCAGTGGGCCTAGCCTCAGG + Intergenic
1067739076 10:48881252-48881274 CGGCCCTTGGGCCATGCCATAGG - Intronic
1071159950 10:82734206-82734228 CAGCCACTGGGCTTTTCCTTGGG + Intronic
1073791112 10:106941469-106941491 CAGCACGTGGGCTTTGGCCTTGG - Intronic
1075643715 10:124084175-124084197 CAGCGCGTGGCCCCTGCCCTTGG - Intronic
1076723132 10:132401433-132401455 CATCCGCTGGGCCTTGCCTGTGG - Intronic
1077107192 11:847373-847395 CAGCCCAGGGGCCTTGCCAGCGG + Intronic
1077168389 11:1153847-1153869 CAGCCCGTGGCCCATGCCCAGGG + Intergenic
1080427816 11:32172443-32172465 AGGGCCGAGGGCCTTGCCTTTGG + Intergenic
1080592056 11:33733032-33733054 CCGCCTGTGTGCCTTGGCTTAGG - Intronic
1083158731 11:60841740-60841762 CATCCACTGGGCCTTGCCTATGG + Intergenic
1083766282 11:64843078-64843100 CTGCCTGTGGGCCTGGGCTTCGG - Intronic
1084938012 11:72597493-72597515 CAGCCCCTAGCCCTTACCTTGGG + Exonic
1085554764 11:77410376-77410398 CTGCCTCTGTGCCTTGCCTTGGG - Intronic
1087027283 11:93661923-93661945 CAGGCCGTGGGCCCTGCCCGCGG + Intronic
1088064145 11:105695353-105695375 CAGGCCATGGGCCTGGCCATGGG - Intronic
1091933329 12:4414896-4414918 CAGCTCTCCGGCCTTGCCTTGGG + Intergenic
1092607096 12:10132418-10132440 CATCCTATGGACCTTGCCTTAGG + Intergenic
1095906152 12:47380127-47380149 CAGCTCCTGGGCGTGGCCTTGGG - Intergenic
1101910087 12:108854919-108854941 CTGAACGAGGGCCTTGCCTTCGG + Intronic
1102838733 12:116094882-116094904 GAGCCCCTGTGCCTGGCCTTTGG - Intronic
1104846603 12:131850239-131850261 CAGCTCGTGGGCCAGGCCTTCGG - Intronic
1107263076 13:38518775-38518797 CAGCCCATGGACCTGGCCCTGGG + Intergenic
1108490580 13:50977366-50977388 TTTCCCTTGGGCCTTGCCTTGGG - Intergenic
1112100670 13:96185450-96185472 CAGCCAATGGGCCTTGGCTGGGG - Intronic
1113960431 13:114122834-114122856 CAGCCAGTGGTCCTTGCTTTGGG - Intronic
1115661352 14:35497267-35497289 CAGCCACTGTGCCTTGCCTAGGG + Intergenic
1119383234 14:74241420-74241442 CTGCCCGGGGGCCTTGGCGTCGG + Intronic
1122338458 14:101008867-101008889 CAGCCCTAGAGCCTTGCCTTTGG + Intergenic
1122470046 14:101960369-101960391 CAGCCTGAGGGCCAAGCCTTGGG + Intergenic
1122686024 14:103506987-103507009 GAGCCCCTGCGCCTGGCCTTGGG - Intergenic
1122806896 14:104264414-104264436 CTCCCCCTGGGGCTTGCCTTCGG + Intergenic
1124398840 15:29331002-29331024 CAGCCCCTGAGCCTGGCCCTGGG - Intronic
1125755948 15:42065189-42065211 CAGCCTGTGGGCCCTTCCTGGGG - Intergenic
1130040913 15:80404579-80404601 CAGCCCGCAGGCCTTGCCCGGGG + Intronic
1130520491 15:84657740-84657762 CAGCCGGTGCCCCTTACCTTAGG - Intronic
1131077154 15:89502531-89502553 GAGCACCTGGGCCTTGCCTGAGG - Intergenic
1132915108 16:2340023-2340045 CGGACCGTGGGCCTTGGATTCGG + Intronic
1133542178 16:6766931-6766953 CAGCCCGTGGTACTAGCCCTTGG + Intronic
1136365248 16:29806573-29806595 CGGCCCGCGGGCCATGCGTTCGG + Intronic
1137349237 16:47696687-47696709 TTGCTCGTGTGCCTTGCCTTGGG - Intronic
1138346705 16:56324648-56324670 CAGCCCTGGGGCCTGGGCTTTGG - Intronic
1138353864 16:56362407-56362429 GAGCCCGTGGGTCTGGCCTCTGG + Exonic
1139573509 16:67827595-67827617 CAGCCTGTGGGACTCGCCTATGG - Intronic
1140851248 16:78936598-78936620 CAGCCTGTGGACCTTGCCCAGGG - Intronic
1145060470 17:19730063-19730085 CAGCCCGCCGGCCTCGCCTCAGG + Intergenic
1146000460 17:29127599-29127621 CAGCATGTTGGCCTTGCCATAGG - Intronic
1146926921 17:36751673-36751695 CAGCCTGAGGGCCTTTCCTGGGG + Intergenic
1147372430 17:40002298-40002320 GAGCCAGTGGGCCTGGCCTCAGG - Intergenic
1147586701 17:41657214-41657236 CAGCACCTGGGCCCTTCCTTGGG + Intergenic
1148480369 17:47956082-47956104 CAGCCCTTGTGCCCTGCCCTGGG + Intronic
1148734615 17:49858414-49858436 CAGCCTCTGGGACTTGCCTCTGG + Intergenic
1150072430 17:62163151-62163173 CATCACGTGGGCCTTGCCATAGG - Intergenic
1151555243 17:74843258-74843280 CAGCCCGTGGGGCTCGGCTCTGG + Exonic
1152460252 17:80438706-80438728 AAGCAGGTGGGCCTGGCCTTTGG + Intergenic
1152579420 17:81159558-81159580 CAGCCGGTGGGGCTTGCTTAGGG - Intronic
1153245045 18:3065499-3065521 CAGCCCTTGGCCCTTGGCATGGG + Intergenic
1160508359 18:79439780-79439802 GAGCCCGTGGGCTTTGCTTTAGG - Intronic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1161810966 19:6471224-6471246 TAGGCCGTGGGCGTTGGCTTAGG - Intronic
1165108329 19:33487323-33487345 CATGCCGTGGGCCTTGACATGGG - Intronic
1165996233 19:39846065-39846087 AAGGCCGTGGGCCTGGCATTGGG - Intronic
1166139293 19:40797321-40797343 GAGCCACTGGGCCTGGCCTTGGG + Intronic
1166996593 19:46722509-46722531 CAGCCCCTGGGCCCTGTTTTGGG + Intronic
1167066362 19:47189119-47189141 CAGGCCCAGGGCTTTGCCTTAGG + Intronic
1168101863 19:54145564-54145586 CAGCCCCTGAGCCTGGCCCTGGG + Intronic
1168340659 19:55621469-55621491 CAGCCCGTGGGCCTTGCCTTTGG + Exonic
925055900 2:857181-857203 CAGACCATGGGCATTGCCTGGGG - Intergenic
926045392 2:9706176-9706198 CAGGCCCTGGGCTTTGCCCTGGG + Intergenic
927826502 2:26313272-26313294 CAGCCTGTGGGCTGGGCCTTGGG + Intronic
928086198 2:28347864-28347886 CAGCCCCGGGGCGTTGCCTTGGG + Intergenic
928381732 2:30823929-30823951 GTGCCTGTGAGCCTTGCCTTGGG + Intergenic
929686994 2:44043680-44043702 CAGCAATTGGGCCCTGCCTTTGG - Intergenic
931802752 2:65774487-65774509 CTGCCCGCGTTCCTTGCCTTGGG + Intergenic
932219670 2:69989945-69989967 CAGCACATGGCCCTTGCCATGGG + Intergenic
937904653 2:127047007-127047029 AAGCCCCTGGGCTTTGCTTTAGG - Intergenic
938733058 2:134161289-134161311 AAGGCCGTGGGGCTAGCCTTGGG + Intronic
946368685 2:219266919-219266941 CAGACCCTGGGCCTTGCCACAGG + Intronic
946481406 2:220060280-220060302 CAGCATGTGGGCCTTTCCATAGG + Intergenic
948908115 2:240989461-240989483 CAGCCCGTGGGCCTTGGGTTTGG - Intronic
948928966 2:241118736-241118758 CAGCCCCTGGGCTTTGCACTGGG - Intronic
1169267874 20:4177656-4177678 CACTCCCTGGGCCTTGCATTTGG + Intronic
1171454106 20:25257282-25257304 CAGGCCCTGGGCAGTGCCTTGGG + Intronic
1172688960 20:36777688-36777710 CCTCCCATGGGCCTTGCCCTGGG + Exonic
1172895203 20:38295410-38295432 CAGGGCGTGGGGCTTGCTTTTGG + Intronic
1175985196 20:62760995-62761017 GAGCCCCTGGGCCTTGGCCTGGG - Exonic
1176239079 20:64067664-64067686 CAGCCCTTGGGCCTGGCTCTGGG + Intronic
1178043139 21:28663470-28663492 CAGCCTGTGGGCCATGGTTTGGG + Intergenic
1179558269 21:42194562-42194584 CAGGCTGTGGGCCTTGCCATAGG + Intergenic
1180963939 22:19776020-19776042 GAGCCGGTGGGACTTGCCTGGGG - Intronic
1181022384 22:20110224-20110246 CAACCTGTGGGCCCGGCCTTAGG + Exonic
1181838891 22:25637197-25637219 CAGACCTTTGGCCTTGGCTTGGG + Intronic
1182418312 22:30235693-30235715 CAGTGCCTGGGCCTTGCCTATGG + Intergenic
1183331854 22:37226463-37226485 CATACCTTGGGCCTTGCCTCTGG + Intronic
954557972 3:51533208-51533230 CATACCGTGGTCCTTGCTTTTGG + Intergenic
955380434 3:58433892-58433914 CAGCCGGCGCGCCTTGCCATTGG - Intergenic
958043168 3:88250022-88250044 CAGCCAGTTGGCCTGGCTTTGGG + Intergenic
959741369 3:109724033-109724055 TAGCCCAAGGGCCTTCCCTTGGG - Intergenic
961089000 3:124093550-124093572 CAGCCCCTGGGCATTGTCTAAGG - Intronic
963467876 3:145705104-145705126 CAGGCCGTGTGACTTTCCTTTGG - Intergenic
966879741 3:184343373-184343395 CAGCCCGTGGGCCTTTCTCTGGG + Intronic
968919228 4:3514097-3514119 CAGCCTGTGGCCCTTGCCCGTGG - Intronic
968956638 4:3722815-3722837 CAGCCAGTAGGCCTGGGCTTTGG - Intergenic
969627026 4:8310915-8310937 CAGCACGTGGGCTTCTCCTTTGG - Intergenic
981733817 4:147927755-147927777 CAGCCTCTGCGCCTTCCCTTAGG - Intronic
984883515 4:184430244-184430266 CAGCCCCTGGGCCTCACCCTGGG + Intronic
986252745 5:6075640-6075662 CATCTTGTGGGCCATGCCTTTGG - Intergenic
986578375 5:9236234-9236256 CCTGCCGTGGGCCTTGCCTGGGG - Intronic
993006740 5:82436565-82436587 CAGCCTGTGGGCCTACCCTGAGG - Intergenic
995417983 5:111931406-111931428 CACCATGTGGGCCTCGCCTTAGG - Intronic
997365668 5:133323682-133323704 CAGCCCCTGGCCCTGGCCTCAGG + Intronic
997505287 5:134412037-134412059 CAGCCCGTGGCTCCTGCCCTGGG + Intergenic
998374438 5:141681834-141681856 CAGCACGCGGGCCCTGGCTTGGG - Intronic
999225397 5:150018692-150018714 CAGCCAATGGACCTTACCTTTGG - Exonic
1007392912 6:41560931-41560953 CAGCCCGTGGGTCCCCCCTTTGG + Intronic
1011794385 6:90936695-90936717 CTGCCCCGGTGCCTTGCCTTTGG - Intergenic
1019626364 7:2017906-2017928 CAGCCCTTGGGCCTGGGCTTGGG + Intronic
1022173231 7:27849331-27849353 CAGCCCTTGTCCCTTGCCTTTGG - Intronic
1029180994 7:98701679-98701701 CAGCAGATGGGCCTTCCCTTTGG - Intergenic
1029539243 7:101173157-101173179 CGGCCCATGAGCCTTGCCCTGGG - Intronic
1031908826 7:127491610-127491632 TAGACCATGGGCCTTCCCTTTGG + Intergenic
1034728231 7:153360447-153360469 CAGCCCGAGAGCCTCACCTTGGG + Intergenic
1035563685 8:627670-627692 CAGCCCTGTGGCCTTGCTTTCGG - Intronic
1036204449 8:6794765-6794787 CAGCCTGTGGTCTTTGCCCTGGG - Intergenic
1037628013 8:20625001-20625023 CAGCCCATGTGCCTTGAGTTGGG - Intergenic
1037993503 8:23337209-23337231 CAGCACGTCCACCTTGCCTTTGG + Intronic
1049611623 8:143558621-143558643 CAGCCCAGGGGCCCGGCCTTTGG + Intronic
1049746235 8:144264482-144264504 CAGCCCCTGGGGCTTGGCCTGGG - Intronic
1052831633 9:33220866-33220888 CTGCCTTTGGGCCTTTCCTTGGG + Intronic
1053288853 9:36866958-36866980 CTAGCCGAGGGCCTTGCCTTTGG - Intronic
1056664694 9:88572252-88572274 CAGCCCTTGTGCCTGCCCTTGGG + Intronic
1057537267 9:95923980-95924002 CAGGCCTTGGGCATTGCCTGTGG + Intronic
1061573150 9:131489977-131489999 ATGCCCGTGGGCCCTGCTTTGGG + Intronic
1061838217 9:133342870-133342892 CAGCCTGCCTGCCTTGCCTTGGG - Intronic
1061906569 9:133702329-133702351 CAGCCCGTCGCCCCTGCCTGGGG - Intronic
1062448613 9:136606220-136606242 CGGCCCCGGGGCCTTGCCTCTGG - Intergenic
1203780804 EBV:99749-99771 CAGACCCTGGGCCTTGGCTATGG + Intergenic
1187365382 X:18662010-18662032 CAGCGCGTGGTCCCTGCCTCGGG - Intronic
1188015737 X:25105905-25105927 GAGCCCTAGGGCTTTGCCTTTGG - Intergenic
1199874867 X:151921525-151921547 CAGAGCCTGGGCCCTGCCTTGGG - Intronic
1200046511 X:153405681-153405703 CAGCACGTGGGCCTCTCCATAGG - Intergenic