ID: 1168341229

View in Genome Browser
Species Human (GRCh38)
Location 19:55624289-55624311
Sequence CTATGTCATGGTGGGCGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168341229_1168341248 30 Left 1168341229 19:55624289-55624311 CCACCCCGCCCACCATGACATAG 0: 1
1: 0
2: 0
3: 12
4: 193
Right 1168341248 19:55624342-55624364 CACAAGAAGCCCCACCCCCAGGG 0: 1
1: 0
2: 2
3: 36
4: 405
1168341229_1168341247 29 Left 1168341229 19:55624289-55624311 CCACCCCGCCCACCATGACATAG 0: 1
1: 0
2: 0
3: 12
4: 193
Right 1168341247 19:55624341-55624363 CCACAAGAAGCCCCACCCCCAGG 0: 1
1: 0
2: 4
3: 40
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168341229 Original CRISPR CTATGTCATGGTGGGCGGGG TGG (reversed) Intronic
900374330 1:2346671-2346693 TTATCTCAGGGTGGGCGCGGTGG - Intronic
900639802 1:3683171-3683193 ATCTGTCATGGTGAGTGGGGGGG + Exonic
900785057 1:4644286-4644308 GTGTGTCCTGGGGGGCGGGGTGG + Intergenic
901511888 1:9721690-9721712 CTAGGTCCTGCTGGGCGGGAGGG + Intronic
901742970 1:11354419-11354441 CTGTGTCAAGCTGGGCGTGGTGG - Intergenic
904457124 1:30654502-30654524 CCATGTGGTGGTGGGTGGGGAGG - Intergenic
905642495 1:39600824-39600846 CTGTGTGTTGGTTGGCGGGGAGG - Intergenic
905973462 1:42157712-42157734 CTCTGGCATGGTGGGCATGGAGG - Intergenic
907665435 1:56430251-56430273 GTATTTCATGGTGGTGGGGGAGG + Intergenic
914338605 1:146739226-146739248 CGAGGTCTTGGTGGGAGGGGAGG + Intergenic
917854558 1:179090091-179090113 CCATGTGGTTGTGGGCGGGGTGG + Intronic
919842544 1:201619720-201619742 CTGTGTCCTGGTGGGTGGGCAGG + Intergenic
921340155 1:214126608-214126630 CTATGTGATCGTGGGCAAGGAGG - Intergenic
921610750 1:217209609-217209631 CTATGTCAGGCTGGGCATGGTGG - Intergenic
921712692 1:218388479-218388501 TTCTTTCATGGTGGGCGAGGGGG - Intronic
1066624759 10:37395217-37395239 CAATCTCATGGTGGGTGGTGGGG - Intergenic
1074483114 10:113846013-113846035 GTATGTCATGGTGGGAAGGATGG - Intronic
1074875086 10:117607449-117607471 CTATGTAATGATGGGCTGGAAGG + Intergenic
1076256842 10:129033288-129033310 TTATGACATGGTGGGGGGGGGGG + Intergenic
1077028756 11:453788-453810 CACTCTCATGGTGGGCAGGGAGG - Intronic
1077499106 11:2901311-2901333 CAAAGTCCTGGTGGGCAGGGGGG - Intronic
1079207005 11:18424718-18424740 CTATGTAATGCTGGGCATGGTGG + Intronic
1084692115 11:70733689-70733711 CTAGGTCATGGAGAGGGGGGTGG + Intronic
1084794021 11:71492113-71492135 GGATGACATGGTGGGAGGGGAGG + Intronic
1086921604 11:92594038-92594060 ATGTGTCATGGTGGGAGGTGTGG + Intronic
1088667168 11:112104810-112104832 ATAAGTCAGGGTGGGCGCGGTGG + Intronic
1088799269 11:113290542-113290564 ATATGTCAAGGTGAGTGGGGGGG + Intergenic
1089315125 11:117586289-117586311 CTATGGGAGGGTGGGAGGGGAGG + Intronic
1090628675 11:128627516-128627538 CCAGGTCAGGGTGGGCGGTGGGG - Intergenic
1094699710 12:32857071-32857093 CTCTGTCCTGTTGGGCTGGGAGG - Intronic
1095455833 12:42384917-42384939 CTATGGAAAGGTGGGCAGGGAGG - Intronic
1095697087 12:45155310-45155332 CAATATCATGGTGGGTGGGGGGG - Intergenic
1095745966 12:45659371-45659393 CTTTGTCAGGCTGGGCGCGGTGG + Intergenic
1096866444 12:54566482-54566504 CTTGGTCATGGTGTGGGGGGTGG - Intronic
1098864001 12:75741548-75741570 ATTTGTTTTGGTGGGCGGGGAGG - Intergenic
1099220645 12:79909985-79910007 ATATGACAGGCTGGGCGGGGTGG - Intronic
1100288931 12:93195037-93195059 CCATGTGATGGTGGGCGGGAAGG - Intergenic
1102470327 12:113156205-113156227 CTATGTCACGCTGGGTGTGGTGG - Intronic
1103523504 12:121551838-121551860 CCCTGTCATGCTGGGCGCGGTGG - Intronic
1107892528 13:44926859-44926881 CTATATCAGGCTGGGCGCGGTGG + Intergenic
1110558104 13:76884170-76884192 GTAAGACTTGGTGGGCGGGGTGG - Exonic
1114476305 14:22997409-22997431 CTATGTCTTGTTGTGGGGGGAGG + Intronic
1116455538 14:45116976-45116998 CTCTGTCTCGGTGGGGGGGGCGG - Intronic
1117379348 14:55144849-55144871 CCAAGTTATGCTGGGCGGGGTGG - Intronic
1117557985 14:56906370-56906392 CTATGTGAGGCTGGGCGTGGTGG + Intergenic
1118932435 14:70255074-70255096 CTCAGGCATGGCGGGCGGGGAGG - Intergenic
1123131928 14:105994251-105994273 CTCTGCCATGGTGGTTGGGGTGG + Intergenic
1123803842 15:23851467-23851489 CTATGTCATGAGGGGCAAGGAGG - Intergenic
1125362358 15:38877406-38877428 CTGGGGCAGGGTGGGCGGGGTGG + Intergenic
1128390249 15:67177841-67177863 CTGAGGCATGGTGGGCGGGAGGG + Intronic
1128567057 15:68707944-68707966 CTGTGAGATGGTGGGAGGGGGGG - Intronic
1129288819 15:74547468-74547490 CTGTGTCAGGGTAGGCGCGGTGG - Intronic
1130997533 15:88912300-88912322 GTCTTTCATGGTGGCCGGGGAGG + Intronic
1131056040 15:89375751-89375773 CTAATTCATGGGGGGTGGGGGGG - Intergenic
1131113589 15:89780322-89780344 CTATGTCTGGCTGGGCGTGGTGG - Intergenic
1133100482 16:3476275-3476297 CTATGTCATCGTGGCAGAGGAGG - Exonic
1136857935 16:33676186-33676208 CTCTGTCAGGGGGGGTGGGGGGG + Intergenic
1136993665 16:35173282-35173304 CGCTGCCATGGTGGGCGGGAGGG - Intergenic
1138983196 16:62295649-62295671 CTATGTCATGGGAGGAGGAGAGG + Intergenic
1139127361 16:64094914-64094936 TTATGTCATGCTTGGTGGGGTGG + Intergenic
1139298689 16:65925541-65925563 ATATGTGTTGGTGGGCCGGGTGG + Intergenic
1139995672 16:70978128-70978150 CGAGGTCTTGGTGGGAGGGGAGG - Intronic
1141916006 16:87097571-87097593 GTGTGTCAGGGGGGGCGGGGGGG + Intronic
1142769202 17:2084455-2084477 CTATGTCATCAGGGGTGGGGTGG + Intronic
1143914712 17:10281410-10281432 TTCAGTCATGGTGGGAGGGGAGG + Intergenic
1144439101 17:15265380-15265402 ATATGTCATGGTGGCCTGAGAGG + Intergenic
1144929704 17:18849405-18849427 CAATGTGATGCTGGGCGTGGTGG + Intronic
1145884160 17:28371358-28371380 CGATGTCACGTGGGGCGGGGAGG + Intronic
1146957007 17:36941789-36941811 CTCTGTCATGGTTGGGGGGAGGG + Intronic
1147374255 17:40014761-40014783 ATGAGTCATGGGGGGCGGGGGGG + Intergenic
1147665501 17:42144639-42144661 CCATCTCAGGGTGGGCGTGGTGG + Intronic
1147882884 17:43665339-43665361 CTGGGTCATGGTGGGGTGGGTGG + Intergenic
1151205397 17:72502658-72502680 CTAAGTCAGGGTGGGGTGGGGGG + Intergenic
1153457063 18:5294574-5294596 CAATGGCAAGGGGGGCGGGGCGG - Intronic
1156190194 18:34710162-34710184 CTTTGTCAGGGTGGGTGGAGGGG + Intronic
1161992720 19:7694077-7694099 CCATGTGAGGGTGGGCGTGGTGG - Intronic
1163818869 19:19484818-19484840 CTATGACAGGCTGGGCGCGGTGG - Intronic
1164116068 19:22219940-22219962 CTATGACAGGCTGGGCGTGGTGG - Intergenic
1164199765 19:23007440-23007462 CTATGACAGGCTGGGCGCGGTGG - Intergenic
1165774977 19:38399060-38399082 CCCTTCCATGGTGGGCGGGGGGG + Intergenic
1167090529 19:47340955-47340977 CAATGCCATGGTGGCCTGGGTGG + Exonic
1167300558 19:48675103-48675125 CTTCCTCATGGTGGGCGGAGGGG + Intergenic
1168240708 19:55087512-55087534 CTTTGTCCTGGAGGGCGGGGTGG - Exonic
1168341229 19:55624289-55624311 CTATGTCATGGTGGGCGGGGTGG - Intronic
1168388707 19:55988103-55988125 CTATGTAAGGCTGGGCGTGGTGG + Exonic
926001286 2:9334949-9334971 CTCTGTCTTGGTGGGAGGGAAGG + Intronic
926202810 2:10813411-10813433 CTTTGTCCTGGGGGGCGAGGGGG + Intronic
927199008 2:20567068-20567090 CTGTGTGATGGTGAGCAGGGTGG - Intronic
928575978 2:32655431-32655453 CTATGTCAGGCTGGGCATGGTGG - Intronic
932433049 2:71686823-71686845 ATATGCCTGGGTGGGCGGGGAGG + Intergenic
936442214 2:112564430-112564452 CGGTGTCATGGTTGGCTGGGTGG + Exonic
939662737 2:144910552-144910574 TGATTTCATGGTGGGTGGGGGGG + Intergenic
942451427 2:176110159-176110181 CTATTTCAGTGGGGGCGGGGAGG - Intronic
942677753 2:178446300-178446322 CTATGCCAGGCTGGGCGGGGTGG - Intronic
944347244 2:198684249-198684271 CATGGTCATGGTGGGAGGGGTGG + Intergenic
944530936 2:200667456-200667478 CAATGTCATGATGGTGGGGGCGG - Intronic
944652406 2:201844298-201844320 CGAAGTCATGGGGGGCAGGGTGG + Intronic
945764045 2:213950997-213951019 CTATGTCAGGCTAGGCGTGGTGG - Intronic
948665595 2:239532858-239532880 GTGTGTCCTGGTGGGTGGGGTGG + Intergenic
1170916213 20:20628578-20628600 CTTTGTCATGGTGGGGGTGGGGG + Intronic
1173246208 20:41339645-41339667 CTATGTCAAGGTGGCCAGGAGGG - Intergenic
1173950474 20:46989104-46989126 ATATGTTATGGGGGGCGGGCAGG - Intronic
1174214099 20:48902984-48903006 CCAGGTGATGGTGGGGGGGGGGG + Intergenic
1174708966 20:52685177-52685199 CTCTGCCATGGAGGGTGGGGTGG - Intergenic
1175476266 20:59276891-59276913 ATTTCTCATAGTGGGCGGGGGGG - Intergenic
1176219408 20:63962939-63962961 GTGTGTCCTGGTGGGCGGGAGGG - Intronic
1176407721 21:6430486-6430508 CAAACTCAGGGTGGGCGGGGAGG + Intergenic
1179934409 21:44592967-44592989 CCATGGCATGGTGGGGGTGGGGG + Intronic
1181053163 22:20247121-20247143 CTGTGTCATGGGTGGCCGGGAGG + Intronic
1182233650 22:28858642-28858664 CTATGGCATGGCAGGCGCGGTGG - Intergenic
1182339150 22:29605459-29605481 CTAGGTGAGGCTGGGCGGGGTGG - Intronic
1183816779 22:40308534-40308556 CTATGGCATGGTTGGTGGGAAGG + Exonic
1184692036 22:46121837-46121859 CTAGGGCAGGGTGGGCAGGGAGG - Intergenic
1184794950 22:46726782-46726804 CTGTGTCAGGGTGGACGTGGTGG - Intronic
950316092 3:12003658-12003680 CTCTGTCATGGAAGGAGGGGTGG - Intergenic
950715838 3:14847267-14847289 CTATCTCATGGGTGGCTGGGAGG - Intronic
951263376 3:20539012-20539034 CTATTTCATAGTGGGTGGGGTGG + Intergenic
951973276 3:28473278-28473300 GTTTGTCATGTTGGGCGGGCTGG - Intronic
952134666 3:30403881-30403903 TTATGTCATGTTGGGTTGGGTGG + Intergenic
952924296 3:38309910-38309932 CCATGTCATGGGAGGTGGGGAGG + Intronic
953411637 3:42693563-42693585 CTGGGTCATAGAGGGCGGGGGGG - Intronic
954084051 3:48230096-48230118 ATATGTCAGGCTGGGCGCGGTGG - Intergenic
955979697 3:64512520-64512542 CTAAGTGGAGGTGGGCGGGGGGG - Intergenic
956535169 3:70267701-70267723 CTATTTTAGGCTGGGCGGGGTGG - Intergenic
956598657 3:70995346-70995368 CTCTGTCATGGTGGGGGTGGAGG + Intronic
956621761 3:71228000-71228022 CAATATCATGGTGGGGCGGGTGG + Intronic
956628037 3:71286315-71286337 CTGTGTGCTGGCGGGCGGGGCGG - Intronic
959576578 3:107940743-107940765 CTTTGTCATGGTGGAGGTGGGGG + Intergenic
961545823 3:127632267-127632289 CTGTGGCATGGCAGGCGGGGAGG - Intronic
964147810 3:153487023-153487045 CCATGTCAGGTTGGGCGCGGTGG + Intronic
965688191 3:171327680-171327702 CTGAGTTTTGGTGGGCGGGGTGG + Intronic
966424413 3:179765906-179765928 CTATGTTGTGGTGGGAGGGAAGG - Intronic
967027815 3:185579765-185579787 CTTTTTCAGGGTGGGCGTGGTGG - Intergenic
970911613 4:21283642-21283664 CTATTTCATGGGGAGGGGGGAGG + Intronic
972371787 4:38431085-38431107 TTAGGGCATGGTGGGAGGGGAGG + Intergenic
973199593 4:47485215-47485237 CTACGTCACGGAGGGCGGGGCGG + Intergenic
978268376 4:106857019-106857041 CTATGTGCTGGTGGGCTGGCAGG - Intergenic
979390757 4:120124844-120124866 CTAACACATGGTGGGCAGGGTGG + Intergenic
979958489 4:126986818-126986840 CTATGTCCTGGTGGTGTGGGTGG - Intergenic
982466960 4:155743613-155743635 CACTGTCATGGAGGGCTGGGAGG + Intergenic
982938985 4:161524253-161524275 CAAAGTTGTGGTGGGCGGGGTGG - Intronic
985072186 4:186177401-186177423 CTTTGTCTTGGGGGGCTGGGTGG - Intergenic
991620867 5:68544262-68544284 CTATGGAATGGAGGCCGGGGTGG + Intergenic
992395267 5:76363736-76363758 CTGTGTCATGGTGGGATAGGAGG + Intergenic
992834140 5:80623573-80623595 GTATGGCATGGTGGGGGAGGGGG + Intergenic
993305699 5:86272628-86272650 TTCTGTTATGGGGGGCGGGGAGG + Intergenic
995924357 5:117352620-117352642 CTGTGACATGGTGGTGGGGGAGG + Intergenic
996553775 5:124757053-124757075 CTATTTCAGGCTGGGCGTGGTGG - Intergenic
996815953 5:127572666-127572688 CTCTACCATGGTGGGTGGGGTGG + Intergenic
997510120 5:134448270-134448292 CTGGGTCATGGTGGGCAGGTGGG + Intergenic
998683286 5:144495377-144495399 CACTGTCATGGTGTGGGGGGAGG - Intergenic
998949999 5:147384067-147384089 CTAAGTCATGGTGTGTGGAGTGG - Exonic
1002258538 5:177978047-177978069 CTCTGTGATGGTGGGGCGGGAGG + Intergenic
1002501327 5:179649499-179649521 CTCTGTGATGGTGGGGCGGGGGG - Intergenic
1003828451 6:9977996-9978018 CTCTGTCGTGGTGGGCAGAGGGG + Intronic
1005352664 6:24951686-24951708 AAATGTCATGGTTGGTGGGGCGG + Intronic
1006020597 6:31115474-31115496 CTCTGTAATGGAGGGTGGGGTGG + Exonic
1006834904 6:36992099-36992121 CTTTGTCTTGGTGGGGGTGGGGG - Intergenic
1011028331 6:82894190-82894212 CTATGAAATGGTTGGGGGGGTGG - Intronic
1018508472 6:164496695-164496717 CAATTACATTGTGGGCGGGGGGG - Intergenic
1020220118 7:6229846-6229868 CTATCTCAGGCTGGGCTGGGTGG + Intronic
1022157904 7:27678757-27678779 CCATGTCATGGTGGGTGGGTGGG - Intergenic
1023285399 7:38613998-38614020 GGATGTCATGGTGGGAGGTGGGG - Intronic
1027223376 7:76228435-76228457 CTGTGTCTTGCTGGGCGCGGTGG + Intronic
1029387291 7:100251779-100251801 CAATGTCATGGTCGGTGTGGGGG + Intronic
1029539498 7:101174307-101174329 CTATGTCAGTGAGGGTGGGGTGG - Intronic
1031589320 7:123570321-123570343 CTATGGCAGGCTGGGCGCGGTGG - Intronic
1031935332 7:127730252-127730274 CAATGTCAGGCTGGGCGCGGTGG - Intronic
1031987785 7:128174536-128174558 ATACGTCATGGTGGGCTGGTTGG - Intergenic
1032392107 7:131562029-131562051 CTATTTATTGGGGGGCGGGGGGG - Intergenic
1033849244 7:145474438-145474460 CTAGGTCATAGTGGGGTGGGAGG + Intergenic
1034451843 7:151141378-151141400 CTATGCCATGGTAGTGGGGGAGG + Intronic
1034815561 7:154169316-154169338 CCATATGGTGGTGGGCGGGGTGG + Intronic
1034923722 7:155104035-155104057 CTATGTCTTCGTGGGTGGGGGGG - Intergenic
1035049070 7:155988068-155988090 CTTTGTCTGGGTGGGCTGGGTGG + Intergenic
1035381967 7:158446105-158446127 CTGTGTGTTGGTGGGCTGGGTGG - Intronic
1035396177 7:158536550-158536572 CTCGGTGATGGTGGGCTGGGAGG - Intronic
1036767058 8:11555965-11555987 TTATATCCTGGTGGGCGGGGGGG - Intronic
1036813519 8:11884609-11884631 CTGTGTCAGGGAGGGTGGGGAGG + Intergenic
1038427500 8:27473804-27473826 CTGTGTCAGAGTGGACGGGGGGG - Intronic
1038444959 8:27596816-27596838 CTCTGTCTCGGGGGGCGGGGGGG + Intergenic
1038786150 8:30618276-30618298 CTCTGTCTCGGGGGGCGGGGGGG + Intronic
1040849581 8:51885250-51885272 CTAAGTATTGGGGGGCGGGGAGG + Intronic
1041284505 8:56246111-56246133 ATATCTCATGGGGGGTGGGGGGG + Intergenic
1041474341 8:58247419-58247441 GTGTGTCAGGGGGGGCGGGGTGG - Intergenic
1041566721 8:59286799-59286821 CTATGTCCTGTTGGGGAGGGAGG - Intergenic
1043320626 8:78981228-78981250 TTTTTTCATGGTGGGAGGGGGGG - Intergenic
1044262788 8:90147270-90147292 CCATGTCATGGTGGCCAGAGTGG + Intergenic
1049349114 8:142154629-142154651 CTGTGTCATGGATAGCGGGGAGG - Intergenic
1049621339 8:143599598-143599620 CTCTGCCATGGGGGGCGGAGAGG + Exonic
1053000236 9:34573939-34573961 CAAGGACATGGTGGGCAGGGAGG + Intronic
1054825258 9:69566809-69566831 GTGTGTGATGGTGGGTGGGGTGG - Intronic
1055644167 9:78347014-78347036 CTATTTCAATGTGGGCGGGAAGG + Intergenic
1056353126 9:85771944-85771966 CTATATCAGGCTGGGCGCGGTGG - Intergenic
1056851264 9:90086428-90086450 CTCAGTCAGGGTGGGAGGGGTGG + Intergenic
1057483446 9:95463348-95463370 CTGTGTCAGGGTGAGCGTGGAGG + Intronic
1058673521 9:107380689-107380711 CTATGTCATGGTGAGTTGGCCGG - Intergenic
1203532979 Un_KI270743v1:1531-1553 CTCTCTAATGGTGGGGGGGGGGG + Intergenic
1188065232 X:25650764-25650786 TTATGCGGTGGTGGGCGGGGGGG + Intergenic
1190737422 X:53264740-53264762 AGATGTCAAGGTGGGTGGGGAGG - Intronic
1192024479 X:67434459-67434481 GTATGTCAAGGTGGGAGGGATGG - Intergenic
1192150467 X:68709093-68709115 CCATCTCATGGAGGGCTGGGAGG - Intronic
1192415674 X:70978163-70978185 TTATGTGATGCTGGGCGTGGTGG - Intergenic
1193112450 X:77743374-77743396 TAATGTCATGATAGGCGGGGTGG - Intronic
1193125291 X:77864251-77864273 GTGTGTTGTGGTGGGCGGGGTGG + Intronic
1200077378 X:153557883-153557905 ACATGTCACGGTGGGGGGGGGGG - Intronic