ID: 1168341248

View in Genome Browser
Species Human (GRCh38)
Location 19:55624342-55624364
Sequence CACAAGAAGCCCCACCCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 405}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168341234_1168341248 21 Left 1168341234 19:55624298-55624320 CCACCATGACATAGTCTCCTCCC 0: 1
1: 0
2: 15
3: 227
4: 2478
Right 1168341248 19:55624342-55624364 CACAAGAAGCCCCACCCCCAGGG 0: 1
1: 0
2: 2
3: 36
4: 405
1168341235_1168341248 18 Left 1168341235 19:55624301-55624323 CCATGACATAGTCTCCTCCCCTG 0: 1
1: 0
2: 0
3: 21
4: 275
Right 1168341248 19:55624342-55624364 CACAAGAAGCCCCACCCCCAGGG 0: 1
1: 0
2: 2
3: 36
4: 405
1168341237_1168341248 1 Left 1168341237 19:55624318-55624340 CCCCTGCCCCGCCCCTCGCGAAA 0: 1
1: 0
2: 1
3: 9
4: 173
Right 1168341248 19:55624342-55624364 CACAAGAAGCCCCACCCCCAGGG 0: 1
1: 0
2: 2
3: 36
4: 405
1168341232_1168341248 25 Left 1168341232 19:55624294-55624316 CCGCCCACCATGACATAGTCTCC 0: 1
1: 0
2: 0
3: 10
4: 167
Right 1168341248 19:55624342-55624364 CACAAGAAGCCCCACCCCCAGGG 0: 1
1: 0
2: 2
3: 36
4: 405
1168341238_1168341248 0 Left 1168341238 19:55624319-55624341 CCCTGCCCCGCCCCTCGCGAAAC 0: 1
1: 0
2: 2
3: 9
4: 118
Right 1168341248 19:55624342-55624364 CACAAGAAGCCCCACCCCCAGGG 0: 1
1: 0
2: 2
3: 36
4: 405
1168341231_1168341248 26 Left 1168341231 19:55624293-55624315 CCCGCCCACCATGACATAGTCTC 0: 1
1: 0
2: 0
3: 4
4: 127
Right 1168341248 19:55624342-55624364 CACAAGAAGCCCCACCCCCAGGG 0: 1
1: 0
2: 2
3: 36
4: 405
1168341236_1168341248 4 Left 1168341236 19:55624315-55624337 CCTCCCCTGCCCCGCCCCTCGCG 0: 1
1: 0
2: 24
3: 218
4: 1660
Right 1168341248 19:55624342-55624364 CACAAGAAGCCCCACCCCCAGGG 0: 1
1: 0
2: 2
3: 36
4: 405
1168341243_1168341248 -10 Left 1168341243 19:55624329-55624351 CCCCTCGCGAAACCACAAGAAGC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1168341248 19:55624342-55624364 CACAAGAAGCCCCACCCCCAGGG 0: 1
1: 0
2: 2
3: 36
4: 405
1168341230_1168341248 27 Left 1168341230 19:55624292-55624314 CCCCGCCCACCATGACATAGTCT 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1168341248 19:55624342-55624364 CACAAGAAGCCCCACCCCCAGGG 0: 1
1: 0
2: 2
3: 36
4: 405
1168341239_1168341248 -1 Left 1168341239 19:55624320-55624342 CCTGCCCCGCCCCTCGCGAAACC 0: 1
1: 0
2: 1
3: 19
4: 218
Right 1168341248 19:55624342-55624364 CACAAGAAGCCCCACCCCCAGGG 0: 1
1: 0
2: 2
3: 36
4: 405
1168341240_1168341248 -5 Left 1168341240 19:55624324-55624346 CCCCGCCCCTCGCGAAACCACAA 0: 1
1: 0
2: 1
3: 1
4: 44
Right 1168341248 19:55624342-55624364 CACAAGAAGCCCCACCCCCAGGG 0: 1
1: 0
2: 2
3: 36
4: 405
1168341229_1168341248 30 Left 1168341229 19:55624289-55624311 CCACCCCGCCCACCATGACATAG 0: 1
1: 0
2: 0
3: 12
4: 193
Right 1168341248 19:55624342-55624364 CACAAGAAGCCCCACCCCCAGGG 0: 1
1: 0
2: 2
3: 36
4: 405
1168341241_1168341248 -6 Left 1168341241 19:55624325-55624347 CCCGCCCCTCGCGAAACCACAAG 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1168341248 19:55624342-55624364 CACAAGAAGCCCCACCCCCAGGG 0: 1
1: 0
2: 2
3: 36
4: 405
1168341233_1168341248 22 Left 1168341233 19:55624297-55624319 CCCACCATGACATAGTCTCCTCC 0: 1
1: 0
2: 1
3: 19
4: 150
Right 1168341248 19:55624342-55624364 CACAAGAAGCCCCACCCCCAGGG 0: 1
1: 0
2: 2
3: 36
4: 405
1168341242_1168341248 -7 Left 1168341242 19:55624326-55624348 CCGCCCCTCGCGAAACCACAAGA 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1168341248 19:55624342-55624364 CACAAGAAGCCCCACCCCCAGGG 0: 1
1: 0
2: 2
3: 36
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168341248 Original CRISPR CACAAGAAGCCCCACCCCCA GGG Intronic
900362390 1:2295509-2295531 AACAAGAAGCCCCATGCACATGG + Intronic
900699421 1:4034877-4034899 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
901175461 1:7295409-7295431 CACAACAAGCCCTCCCCTCAGGG - Intronic
901311333 1:8271501-8271523 CACAATGAGCCCCACCTCCAGGG - Intergenic
901797682 1:11690197-11690219 GACAAGAATCCCTGCCCCCATGG - Intronic
902179641 1:14678178-14678200 CTCAGGAAGACCCACCCACAGGG + Intronic
902454967 1:16526823-16526845 CACTACAAGCCCCACCCTCCTGG + Intergenic
903380418 1:22892910-22892932 CATAAAAAGCCCCACCAACACGG + Exonic
904974824 1:34447880-34447902 CTTATGAAGCCCCATCCCCAGGG - Intergenic
905240160 1:36576178-36576200 CTCTAGGATCCCCACCCCCAAGG - Intergenic
906531676 1:46527236-46527258 CAGAAGAGGCCCCGCCCCCACGG + Intergenic
906594541 1:47063158-47063180 CTCAGGAAGCCCCACTCCTAGGG + Intergenic
906603449 1:47148689-47148711 CACCAGGATCCCCATCCCCATGG + Exonic
910821820 1:91358880-91358902 CTCTAGAAGCTCCATCCCCAGGG - Intronic
910919498 1:92328864-92328886 CTCAGGAAGCCCCATCCCTAGGG - Intronic
911259993 1:95674388-95674410 CAATAGAAGCCCCAACACCAGGG - Intergenic
911653754 1:100419108-100419130 CACTACAACCTCCACCCCCAAGG - Intronic
912181013 1:107219630-107219652 CTCAGGAAGCCCCATCCCTAGGG - Intronic
912493493 1:110076236-110076258 CGGAAGAAGCCCCACGCCCTGGG + Intergenic
913036451 1:114970630-114970652 CTCAGGAAGCCCCATCCCTAGGG - Intronic
913658001 1:120979843-120979865 CACCACAACCTCCACCCCCAGGG - Intergenic
914522575 1:148431103-148431125 CACCACAACCTCCACCCCCAGGG - Intergenic
914647982 1:149671563-149671585 CACCACAACCTCCACCCCCAGGG - Intergenic
915315416 1:155026091-155026113 CTCAGGAAGCCCCACCCCAGAGG + Intronic
915712227 1:157910929-157910951 CTCAGGCAGCCCCACCCCTATGG - Intergenic
916331611 1:163624365-163624387 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
917705025 1:177624036-177624058 CACCCTAAGCCCCACACCCAAGG + Intergenic
918171849 1:182004814-182004836 TTCAGGAAGCCCCACCCCTAGGG + Intergenic
918883972 1:190166797-190166819 CACTACAACCTCCACCCCCAGGG + Intronic
920403723 1:205693638-205693660 CACACATACCCCCACCCCCAAGG + Intergenic
920409658 1:205749608-205749630 CCCAAGAGGCCCCACCTCCTCGG - Intronic
921116581 1:212097941-212097963 CTCAGAAAGCCCCACCCCTAGGG - Intronic
921788488 1:219262554-219262576 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
922000108 1:221468573-221468595 CTCAGGAAGCACCACCCCTAGGG - Intergenic
922703647 1:227777355-227777377 CACAAGACGCCTGTCCCCCAGGG - Intronic
922721316 1:227901588-227901610 CTCAAAAAGCCCCTCTCCCATGG + Intergenic
923174130 1:231446610-231446632 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
924609713 1:245563616-245563638 CTCAAGCAGCCCCACTCCCGAGG - Intronic
924762237 1:246998890-246998912 CACTACAAGCCCCACCTCCTGGG - Intronic
1062985295 10:1762772-1762794 CACAGGAAACCCCACTTCCACGG - Intergenic
1063404923 10:5784646-5784668 CTCAGGAAGCCCCATCCCTAGGG - Intronic
1064904482 10:20330895-20330917 CTCAGGCAGCCCCACCCCTATGG - Intergenic
1066132710 10:32409678-32409700 CTCAGGCAGCCCCACCCCTATGG - Intergenic
1067080475 10:43209674-43209696 CTCAGGAAGCCCCCCCACCAGGG + Intronic
1067126381 10:43519541-43519563 CACTAGAAGCTCCACCTCCCAGG + Intergenic
1068532914 10:58209469-58209491 CTCAGGAAGCCCCATCGCCAGGG - Intronic
1069160476 10:65085257-65085279 CTCGGGAAGCCCCATCCCCAGGG + Intergenic
1069818774 10:71214831-71214853 CAGAAGAAACCCCAGGCCCAGGG + Intronic
1069832281 10:71288755-71288777 CTCCAGAGTCCCCACCCCCAGGG - Intronic
1069958390 10:72065449-72065471 CACAGGAGGCCGCACCACCAAGG + Intronic
1070912880 10:80133402-80133424 CATAAGAAGCCACACTCCAAAGG + Intronic
1071761364 10:88611185-88611207 CTCAGGAAGCCCCATTCCCAGGG + Intergenic
1073085470 10:100885707-100885729 CACTACAAGCTCCACCTCCAGGG + Intergenic
1073111737 10:101066742-101066764 CACCAAAAGCCCCACCCCACCGG + Intronic
1073115021 10:101087111-101087133 CACTAGAATCCCCAGCTCCAGGG - Intergenic
1073131093 10:101189742-101189764 CCTGAGCAGCCCCACCCCCAAGG + Intergenic
1073488876 10:103839596-103839618 CCCACACAGCCCCACCCCCAAGG + Intronic
1074986185 10:118662131-118662153 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
1075285719 10:121184210-121184232 CACAAGAAGCAGCATGCCCAAGG + Intergenic
1076685593 10:132197144-132197166 CACAGGCAGCCCCTGCCCCACGG - Intronic
1077093847 11:791153-791175 CCCCAGCAGCCCCATCCCCAAGG + Exonic
1077177622 11:1197835-1197857 CACCCGAAGGCCCACCCCCTGGG - Intronic
1079415849 11:20235727-20235749 CTCAGGAAGCCCCACCCCTAGGG + Intergenic
1080092032 11:28360004-28360026 CAAAAGAAGCCCAACCCCTCAGG + Intergenic
1080864013 11:36177537-36177559 CTCAGGAAGCCCCATCCCTAGGG - Intronic
1080923453 11:36731590-36731612 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
1081155206 11:39681387-39681409 CATAAATATCCCCACCCCCACGG + Intergenic
1081429582 11:42961860-42961882 CACAGGCAGCCCTACCCCTATGG + Intergenic
1082113050 11:48298350-48298372 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
1083094321 11:60233816-60233838 CAAAGGTAGCCCCACTCCCAAGG - Intronic
1084329778 11:68423631-68423653 CCCACGCAGCACCACCCCCATGG - Exonic
1084460460 11:69294061-69294083 CACAAGCAGCCCCACCCACCTGG + Intergenic
1084567815 11:69941723-69941745 GGTGAGAAGCCCCACCCCCAGGG - Intergenic
1085153153 11:74268246-74268268 AACAAGAGGGCCCAGCCCCAGGG + Intronic
1085757099 11:79210960-79210982 CACAAAAAGCCCCACCTCCTTGG + Intronic
1087169434 11:95036600-95036622 CACTGCAACCCCCACCCCCAGGG + Intergenic
1087817478 11:102675730-102675752 CTCAAGAAGCCTCATTCCCAGGG - Intergenic
1089004937 11:115083527-115083549 CCCCAGAAGCCCCACCCTCCAGG - Intergenic
1090228380 11:125085004-125085026 CACCCGCAGCCCCAACCCCAAGG - Intronic
1090682714 11:129078227-129078249 CTCAGGAAGCCCCATCCCTAGGG + Intronic
1091125444 11:133091487-133091509 CTCAGGAAGCCTCACCTCCACGG - Intronic
1091684195 12:2550052-2550074 CAGAAAAAGCCCCAGCCCCTGGG - Intronic
1092193848 12:6537471-6537493 CCCCAGAACCCCCAACCCCAGGG - Intronic
1092630302 12:10369631-10369653 CACAAGGACCCTCATCCCCAAGG + Intergenic
1093604424 12:21073268-21073290 ATCAGGAAGCCCCACCCCTAGGG - Intronic
1093963829 12:25303947-25303969 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
1095176369 12:39096378-39096400 CTCAAGAAGCCCCATGCCTAGGG + Intergenic
1096751565 12:53762166-53762188 CACTAGCAGCCACACCCCAACGG - Intergenic
1097130108 12:56805302-56805324 AAGAAGAAGCCCCACCCCCTGGG - Intergenic
1098346776 12:69513726-69513748 CTTGAGGAGCCCCACCCCCAAGG - Intronic
1098522268 12:71446478-71446500 CACAAGTTGCCCCACCACAAGGG - Intronic
1098539710 12:71640561-71640583 CACAAGTCCACCCACCCCCAAGG + Intronic
1099866462 12:88288672-88288694 CAAAAGAAGCTCCACTCCAAAGG - Intergenic
1100918625 12:99456191-99456213 CTCAGGAAGCCCCATCCCTAGGG + Intronic
1103172502 12:118833648-118833670 CAAAAGAACACCCACCCCAAAGG - Intergenic
1103963961 12:124626381-124626403 CACACACGGCCCCACCCCCAGGG + Intergenic
1104306723 12:127616407-127616429 CACAAGAAGCTCATCTCCCATGG + Intergenic
1104658320 12:130590827-130590849 CAAAACAATCCTCACCCCCAAGG + Intronic
1104696987 12:130871604-130871626 CTCAAGAACCCCCACCCCACGGG + Intergenic
1104852295 12:131882872-131882894 CACAGCAAGCCCCGCCTCCAGGG - Intergenic
1106378177 13:29210645-29210667 CTCAGGAAGCCCCATCCCTAGGG - Intronic
1106392169 13:29345875-29345897 CTCAGGAAGCCCCACCCCTAGGG - Intronic
1107253211 13:38391497-38391519 CACAGTAAGCCCCATCCCTAGGG - Intergenic
1107361249 13:39619575-39619597 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
1107970869 13:45641117-45641139 CTCAACAAATCCCACCCCCATGG - Intergenic
1109267069 13:60213732-60213754 CACAAGAAAGCCCTTCCCCAAGG - Intergenic
1110643323 13:77852159-77852181 CACTGCAAGCTCCACCCCCAAGG + Intergenic
1112508221 13:99988215-99988237 CCAAAGCACCCCCACCCCCATGG + Intergenic
1113851756 13:113421833-113421855 CAGAGGAAGCCCCAGCCTCAGGG - Intergenic
1113876080 13:113595570-113595592 CACTAGAATCCCCAACCACAGGG - Intronic
1113952557 13:114080050-114080072 CAGAGGAAACCCCACTCCCACGG - Intronic
1114229216 14:20765570-20765592 CACTGGAAGCTCCACCCCCCAGG + Intergenic
1114756746 14:25268706-25268728 CTCAAGAAGCCCCACCCCAGGGG - Intergenic
1114760557 14:25309122-25309144 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
1117193355 14:53315949-53315971 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
1117240785 14:53830126-53830148 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
1117271447 14:54147506-54147528 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
1117681283 14:58205388-58205410 CACTACAAGCCCCACCTCCCGGG + Intronic
1119385954 14:74258314-74258336 CAAAAGAAGAGTCACCCCCAGGG - Intronic
1121685509 14:95832314-95832336 CACAGCAAGCCCCTCCCCCAGGG + Intergenic
1122954058 14:105061656-105061678 CACTTGAAGACCCAGCCCCAGGG - Intronic
1123947865 15:25247609-25247631 ACCAACATGCCCCACCCCCAGGG - Intergenic
1124082828 15:26517293-26517315 CACTAGAAGCGCCACCTCCCGGG + Intergenic
1127390430 15:58500899-58500921 CACAGGAACCCCTACCCCCTTGG + Intronic
1127573984 15:60272515-60272537 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
1128561718 15:68673010-68673032 CAGGAGAACCCACACCCCCAGGG + Intronic
1128981850 15:72193985-72194007 CACAGGAAGCTCCATTCCCAGGG + Intronic
1129174137 15:73827770-73827792 CACACAAAGGCCAACCCCCAGGG - Intergenic
1131117340 15:89803396-89803418 CAGAAGGAGACCCACCCTCATGG + Intronic
1131176291 15:90211638-90211660 CAGCAGCAGCCCCACCTCCAGGG - Intronic
1131183037 15:90253481-90253503 GACAAGAAAGACCACCCCCAGGG + Intronic
1132605246 16:790982-791004 CACCAGGGGCTCCACCCCCACGG - Intronic
1132682066 16:1146475-1146497 CAGAGGCAGCCCCACCCCTAGGG + Intergenic
1132861740 16:2075145-2075167 CACTAGAAGCTCCACCTCCTGGG - Intronic
1132914138 16:2333163-2333185 CTCAAGACCCACCACCCCCAGGG - Intronic
1133262402 16:4559473-4559495 CACTAGAACCTCCACCTCCAGGG - Intronic
1133964535 16:10520798-10520820 CCCAAGTAGCCCCACCATCATGG + Intergenic
1135125600 16:19806926-19806948 CCCAATAACCCCCACCCCCTGGG + Intronic
1136229510 16:28878286-28878308 CAAAGGTAGCCCCAGCCCCAGGG - Intergenic
1136553195 16:30992689-30992711 CCCAGGCAGCCCCACCCCCACGG - Exonic
1138026819 16:53528608-53528630 CACAGGAAGCACCAACCACAGGG + Intergenic
1139372949 16:66479878-66479900 CTCAAGCAGCCCCCTCCCCATGG + Intronic
1141657801 16:85425326-85425348 AGGAAGCAGCCCCACCCCCAGGG + Intergenic
1141906147 16:87028354-87028376 CTGAAGAAGCCCCACCTCCTGGG + Intergenic
1142243505 16:88957865-88957887 CAAAAGAAACCCCATGCCCACGG - Intronic
1142249752 16:88985882-88985904 CCCAAGAAGCCCTACCCTCTCGG - Intergenic
1142867591 17:2800036-2800058 CGCAAGCATCCCCAGCCCCAGGG - Intronic
1143151109 17:4807930-4807952 CACAACAGGCCCCAGCCCCCTGG - Intronic
1144539117 17:16121914-16121936 GACAAGCTGCCTCACCCCCATGG + Intronic
1144550948 17:16240467-16240489 CACGCGCAGCCCCAGCCCCAAGG + Intronic
1144690140 17:17256101-17256123 CACAACAAGCTCCACCTCCTGGG - Intronic
1146255600 17:31390324-31390346 CAGAGGAAGCCCCACCCAGAGGG - Intergenic
1147488088 17:40837974-40837996 CACCAGAAGGCCCACTACCACGG + Intergenic
1147780754 17:42940084-42940106 CACAGGAAGCTCCACCTCCCGGG + Intergenic
1148271885 17:46267694-46267716 CACCGTCAGCCCCACCCCCACGG + Intergenic
1149210244 17:54292666-54292688 CACAAGAATCTCAACTCCCATGG + Intergenic
1149652518 17:58284887-58284909 CCCAAATATCCCCACCCCCAGGG + Intergenic
1150491963 17:65580487-65580509 CTCAACAAGCCCCTCGCCCAAGG - Intronic
1153176710 18:2382655-2382677 CAGAAGAAGGCCTTCCCCCAAGG + Intergenic
1153828847 18:8901624-8901646 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
1156228100 18:35128946-35128968 CACACAGAGCCCCATCCCCAGGG + Intronic
1157507592 18:48239639-48239661 CTCAGGAAGCCCCATCCCTAGGG + Intronic
1159053090 18:63439954-63439976 CACAACAACCACCAGCCCCATGG - Intergenic
1159530245 18:69646852-69646874 CACAAGGGGCCCCACCCTGATGG - Intronic
1161808695 19:6459455-6459477 AACAGGTACCCCCACCCCCAGGG - Exonic
1161957819 19:7506251-7506273 CCCATGGAGCCCCGCCCCCACGG + Intronic
1162761654 19:12892051-12892073 CACAGGAAGCCCCAGCCCCAAGG - Intronic
1163864177 19:19758345-19758367 CACAACAAGTGCCACCACCAGGG - Intergenic
1163886515 19:19970460-19970482 CTCAGGAAGCCCCATCCCAAGGG - Intergenic
1163950022 19:20575712-20575734 CTCAAGAAGCCCCATCCCAAGGG - Intronic
1163967985 19:20765672-20765694 CTCAGGAAGCCCCATCCCAAGGG + Intronic
1164189167 19:22899558-22899580 CACAGGAACCTCCACCCACAAGG + Intergenic
1164708899 19:30340243-30340265 CACAAGAAGCCCAAATCCAATGG + Intronic
1164997583 19:32733965-32733987 CACTGGAAGCCCCACCTCCCGGG + Intronic
1165138624 19:33686215-33686237 CAGATGAAGCTCCACCACCATGG + Intronic
1166411934 19:42561252-42561274 CACAAAAGTCCCCACCCTCACGG - Intergenic
1166899707 19:46050086-46050108 CTCAGGAAGCCCCATCCCTAGGG + Intronic
1168297572 19:55384883-55384905 CAGACGAAGCCCCTGCCCCAAGG + Intergenic
1168341248 19:55624342-55624364 CACAAGAAGCCCCACCCCCAGGG + Intronic
1168476781 19:56681749-56681771 CACATGAACCTCCACCTCCAGGG - Intergenic
925210482 2:2041616-2041638 CAGAAGGAGCCCGTCCCCCATGG + Intronic
925581735 2:5417871-5417893 CTCAGGCAGCCCCACTCCCATGG + Intergenic
925961231 2:9018799-9018821 CACAAGAAGCAGCACCCAGATGG - Intergenic
926178326 2:10617015-10617037 CAGAACAATCCCCACCCTCAAGG + Intronic
926867086 2:17371983-17372005 CTCAGGAAGCCCCACCCATAGGG - Intergenic
927285660 2:21354378-21354400 CACAAGTAGCCCCAGCTGCATGG + Intergenic
929557418 2:42934290-42934312 CAGAAGAAGCCTCACCTCAAGGG - Intergenic
929570843 2:43022024-43022046 ATCAAGCAGCCCCACCCACAGGG - Intergenic
931732657 2:65166921-65166943 CACTAGAACCTCCACCTCCAGGG + Intergenic
931834711 2:66086212-66086234 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
933730030 2:85449397-85449419 CACAGGAGGCCTCACCCCCAGGG - Intergenic
934969864 2:98754663-98754685 AACAAGAAGCACCTCCCGCAAGG + Intergenic
935105480 2:100039565-100039587 AACAAAAAGGCCCTCCCCCATGG + Intronic
937798892 2:126058781-126058803 CCCAGGAAGCCCCATCCCTAGGG - Intergenic
938216511 2:129522401-129522423 CTCAGGAAACCCCACCCACAGGG - Intergenic
938599520 2:132822478-132822500 CTCAGGAAGCCCCATTCCCAGGG + Intronic
939442322 2:142264846-142264868 CACCACAACCTCCACCCCCAGGG + Intergenic
939461065 2:142495483-142495505 CAGAAAAATCCCCACCCCCAAGG + Intergenic
940174486 2:150863562-150863584 CTCAGGAAGCCCCATCCCCATGG + Intergenic
940387424 2:153090171-153090193 CTCAAGAAGCCCCATCCTAAGGG - Intergenic
940630406 2:156230638-156230660 CTCAGGAAGCCCCATCCCCAGGG + Intergenic
940679046 2:156761232-156761254 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
941802249 2:169672743-169672765 GAGAAGAAGACCCACCCTCAAGG - Intronic
942316750 2:174703501-174703523 CACCAGAATCCCCAACCACAAGG - Intergenic
943705215 2:191026966-191026988 CTCAAGCAGCCCTACTCCCAAGG - Intergenic
946036538 2:216746718-216746740 CACAGGAAGCCACATCCACAGGG + Intergenic
946144158 2:217716303-217716325 CACATGGAGCCCCAGCTCCATGG + Intronic
946369541 2:219272224-219272246 GAGAAGAAGCCCTCCCCCCATGG - Intronic
948094834 2:235325254-235325276 AACAAGACTCCCCTCCCCCATGG - Intergenic
948576808 2:238957063-238957085 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
948817960 2:240523052-240523074 CGCAAGAAGCGCTTCCCCCAGGG - Intronic
949024916 2:241762921-241762943 CACAAGAAGACAAACCACCACGG - Intronic
949063907 2:241977836-241977858 CACAAGAAGCCTGCCTCCCATGG + Intergenic
1168771415 20:419271-419293 CTCAGGGAGACCCACCCCCATGG + Intronic
1168918828 20:1514084-1514106 CACATGAAGTCCCAGGCCCATGG + Intergenic
1169081020 20:2797837-2797859 GACAACAAGCCACACCCCCCTGG + Intronic
1170553807 20:17499584-17499606 CATAAGGAGGCCCACCCCAAAGG + Intronic
1170741129 20:19057364-19057386 CCCAGGAAGCCCCATTCCCAGGG + Intergenic
1171280605 20:23893410-23893432 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
1172666623 20:36604977-36604999 CGGAAGGAGCCCCATCCCCAGGG + Intronic
1172851361 20:37968642-37968664 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
1174369286 20:50075657-50075679 CACATGAAGGGCCACCACCACGG - Intergenic
1174921334 20:54705628-54705650 CACTACAAGCCCCACCTCCCAGG + Intergenic
1175192932 20:57223734-57223756 AACAAGAAGCCTCAACCACAGGG + Intronic
1175286813 20:57842069-57842091 CTCAGGAAGCCCCAAACCCAAGG - Intergenic
1175508343 20:59503464-59503486 CACTACAAGCTCCACCCCCTGGG - Intergenic
1175629781 20:60525787-60525809 TACTAGTATCCCCACCCCCATGG - Intergenic
1175699311 20:61125515-61125537 CCCAAGAAGCCCCTTCCCCGAGG + Intergenic
1175801516 20:61803605-61803627 CTCAAGATGCCCCACCCTCCAGG - Intronic
1175838010 20:62008607-62008629 CACCAGAAGCCCCCTCCCCATGG - Intronic
1175874493 20:62222923-62222945 CACATCAAGCCCCACCCCAGAGG - Intergenic
1176017156 20:62940258-62940280 CACTAGAAGCTCCACCTCCCGGG + Intronic
1176916950 21:14636786-14636808 CACTGCAAGCTCCACCCCCAGGG - Intronic
1177657345 21:24035638-24035660 CAAAGGAAGCCCCATCCCTAGGG + Intergenic
1178659867 21:34498420-34498442 CCCAGGAAGCCCCATCCCTAGGG - Intergenic
1179003587 21:37487222-37487244 TATAAGAAGCCCCATACCCAGGG + Intronic
1179937461 21:44614385-44614407 CACAAGAGGCACCGTCCCCAGGG + Intronic
1179965769 21:44804234-44804256 CCCAGGAACCCCCACTCCCAGGG - Intergenic
1180131951 21:45832573-45832595 GACAATAAGTCCCACCCCCGTGG + Intronic
1181053410 22:20248261-20248283 CAGGAGAAGCCACAGCCCCAGGG + Intronic
1181340015 22:22171449-22171471 CACCAGATGCACCACCTCCAGGG + Intergenic
1183285980 22:36964293-36964315 CACAAGGAGGCCCAGACCCAAGG - Intergenic
1184704595 22:46201948-46201970 CTCCCGCAGCCCCACCCCCAGGG + Intronic
949382288 3:3459762-3459784 CACCCCAACCCCCACCCCCAAGG - Intergenic
949799244 3:7884826-7884848 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
951302592 3:21017108-21017130 CTCAAGAAGCCCCATTCCTAGGG - Intergenic
951325937 3:21301928-21301950 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
952024159 3:29058197-29058219 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
952425931 3:33174432-33174454 TACAAGAATCACCACCCTCAGGG + Intronic
952984797 3:38769779-38769801 CTCAGGAAGCCCCATCCCCAGGG - Intronic
953385016 3:42501560-42501582 CACAAGAAGACGCGCTCCCAGGG + Intronic
953716617 3:45321482-45321504 GACACGAGGTCCCACCCCCAGGG - Intergenic
954819234 3:53310819-53310841 CAAAGGAAGTCCCACCTCCAGGG - Intronic
954866580 3:53735100-53735122 GACAACAAGCCCCACTTCCAAGG + Intronic
955634871 3:61016654-61016676 CACAAGAACCCTCAGCTCCATGG + Intronic
956164628 3:66387087-66387109 CAGGAGAAGCCCTAGCCCCAGGG + Intronic
958787341 3:98612593-98612615 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
959009659 3:101060778-101060800 CTCAGGAAGCCCCATCCCTAAGG - Intergenic
959727439 3:109560349-109560371 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
960557344 3:119043830-119043852 TTCAAGAAGCCCCATCCCTAGGG + Intronic
960639155 3:119810255-119810277 CACAAGCATGCCCACACCCACGG - Intronic
960764436 3:121110702-121110724 CATAAGAAGATCAACCCCCAAGG - Intronic
961137919 3:124529135-124529157 GACAAGAATCCCTACCCTCATGG - Intronic
962012984 3:131411291-131411313 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
962191947 3:133319796-133319818 CACAGGAAGCCCCATCCCTAGGG + Intronic
962862093 3:139413942-139413964 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
962983921 3:140517538-140517560 CTCAAGAAGCCACATCCCTAGGG - Intronic
963014468 3:140809029-140809051 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
963023507 3:140896578-140896600 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
963373801 3:144437610-144437632 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
963522442 3:146372537-146372559 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
964457600 3:156885503-156885525 CTCAGGAAGCCCCATCCCTAGGG - Intronic
965282415 3:166770923-166770945 CAGAAAAGGCCCCACCCTCAAGG + Intergenic
966092819 3:176160336-176160358 CACAGGAAGCCCCATCCCTAGGG + Intergenic
966560123 3:181310379-181310401 CACTACAAGCTCCACCTCCAGGG - Intergenic
967040607 3:185688972-185688994 CACAAGAATGGCCACCCCCAGGG + Intronic
967371693 3:188753555-188753577 CACAACAAGCCAAAACCCCAAGG - Intronic
968073609 3:195803520-195803542 AAAAAGAAGCCCCACCTCCCTGG - Intronic
969165564 4:5307847-5307869 CTCAGGAAGCCCCATCCCTAGGG - Intronic
969901402 4:10353969-10353991 CTCAGGAAGCCCCACCTCTAGGG - Intergenic
970391027 4:15614159-15614181 CTCAGGAAGCCCCATCCCTAGGG - Intronic
971048429 4:22831793-22831815 TACATGATGCCCCACCCCCGGGG + Intergenic
971576463 4:28280920-28280942 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
972780036 4:42279423-42279445 TACAATAACCCCCACTCCCAAGG - Intergenic
973675969 4:53263468-53263490 CTCAGGAAGCCCCATCCCTAGGG - Intronic
974686840 4:65242154-65242176 CACGTGAAGCCCCACCTTCAAGG - Intergenic
974965822 4:68759830-68759852 CACCAGAACCCTCAACCCCATGG - Intergenic
975509866 4:75181804-75181826 CTCAGGAAGCCACATCCCCAGGG + Intergenic
975951105 4:79772257-79772279 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
978469233 4:109044596-109044618 CACATGAAGCCACAGCACCATGG + Intronic
980087699 4:128409058-128409080 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
980536290 4:134127572-134127594 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
981442455 4:144798808-144798830 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
981796462 4:148600731-148600753 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
982451126 4:155553018-155553040 CTCAGGAAGCCCCATCCCCAGGG + Intergenic
982829833 4:160045096-160045118 CTCAGGAAGCCCCAACCCTAGGG + Intergenic
983469258 4:168136623-168136645 CTCAGGAAGCTCCGCCCCCATGG + Intronic
983845506 4:172513630-172513652 CTCAGGAAGCCCCATCCCTAGGG - Intronic
983894468 4:173067649-173067671 CCCAGGAAGCCCCATCCCTAGGG - Intergenic
984309726 4:178041690-178041712 CACTACAAGCCCCACCTCCCGGG - Intergenic
985355844 4:189117582-189117604 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
985958667 5:3283299-3283321 CACAGGCAGGACCACCCCCAGGG + Intergenic
987434830 5:17882616-17882638 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
987901981 5:24023887-24023909 CACAGGAAGCCCCATCCCTAGGG + Intronic
988652302 5:33166300-33166322 CCCAGGAAGCCCCATCCCTAGGG - Intergenic
988929620 5:36024327-36024349 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
989727528 5:44604317-44604339 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
990892928 5:60666788-60666810 TACAAGAAGCACAACCCACATGG + Intronic
991003662 5:61807101-61807123 CACAAGCAGCCCCTCTGCCAGGG + Intergenic
991214733 5:64149070-64149092 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
993438586 5:87926628-87926650 AACAAGAAGCCCTACCCAAAGGG + Intergenic
993680721 5:90874351-90874373 CGCAAGAAGACCCACCCCTACGG + Intronic
994034094 5:95178596-95178618 CTCAGGAAGCCCCATCCCTAGGG + Intronic
994778083 5:104061033-104061055 CTCAGGAAGCCCCATCCCTAAGG - Intergenic
994870913 5:105350127-105350149 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
995753129 5:115474407-115474429 CTCAAGCAGCCCCACCCTCATGG + Intergenic
996631933 5:125643197-125643219 CACAGGAAGCCCCATCCCTAGGG + Intergenic
996694846 5:126382912-126382934 CTCAGGAAGCCCCATCCCTAGGG - Intronic
997376879 5:133403705-133403727 CTCCAGAAGACCCACCTCCACGG - Intronic
998391363 5:141788940-141788962 CACAAGACGCCTCCACCCCAGGG + Intergenic
999108714 5:149096070-149096092 CTCAAGAAGCCCCATCCCTAAGG + Intergenic
1000377728 5:160598990-160599012 CACATGGAGCCCCACTCACAAGG - Intronic
1000800447 5:165719890-165719912 CAGAAGATACCCTACCCCCAAGG - Intergenic
1001921800 5:175606398-175606420 CAAAAGAAGTCCAATCCCCAAGG + Intergenic
1004096634 6:12561144-12561166 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
1004230740 6:13831025-13831047 CACACCACACCCCACCCCCAGGG + Intergenic
1005229546 6:23684486-23684508 CTCAGTTAGCCCCACCCCCATGG + Intergenic
1006019612 6:31110339-31110361 CACAAGCTGCCCAACTCCCAGGG + Intergenic
1006896743 6:37476058-37476080 CACCAGCACCCCTACCCCCAGGG - Intronic
1006956933 6:37882281-37882303 CACACGAAGCCCCTCCCCGTAGG + Intronic
1007608168 6:43131195-43131217 CCTAGGAAGCCACACCCCCAAGG - Intronic
1008042209 6:46814767-46814789 CTCAAGAAGCCCCATTCCTAGGG - Intronic
1009589203 6:65643839-65643861 CTCAAGAAGCCCTATCCCTAGGG + Intronic
1010055349 6:71558080-71558102 CTTAGGAAGCCCCATCCCCAGGG - Intergenic
1011032104 6:82934552-82934574 CACAACTTGCCCCACCCCCATGG - Intronic
1011748636 6:90433505-90433527 CACAAGAAGCCACACCAGCCTGG + Intergenic
1011923885 6:92617798-92617820 CTCAGGAAGCCCCACCCCTAAGG - Intergenic
1012965712 6:105670325-105670347 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
1013946366 6:115727802-115727824 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
1014439250 6:121455068-121455090 CACAACAAGCTCCACCTCCCGGG + Intergenic
1015476319 6:133662124-133662146 CAGAGAAAGACCCACCCCCATGG - Intergenic
1016485046 6:144528514-144528536 CTCAGGAAGCCCCATCCCTAGGG - Intronic
1016497022 6:144675176-144675198 CTCAGGAAGCCCCATCCCTAGGG - Intronic
1016720249 6:147288187-147288209 GACAAAAATCCCTACCCCCAGGG - Intronic
1017902314 6:158728975-158728997 CACAGAAAGCCCCACCTCCCAGG - Intronic
1018168672 6:161126517-161126539 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
1018489356 6:164275744-164275766 CACAAGAAAACCCGCCCCCATGG - Intergenic
1018570630 6:165205954-165205976 GATAAGCAGCCCCAGCCCCATGG + Intergenic
1018755359 6:166843690-166843712 CTCAGGAAGCCCCATCCCTAGGG + Intronic
1018781697 6:167073741-167073763 CACAGGAAGCCCTATCCCTAGGG - Intergenic
1019123385 6:169823446-169823468 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
1019431376 7:1001353-1001375 CACAGGACTCCCCACCCACAGGG - Intronic
1019431435 7:1001559-1001581 CACAGGACTCCCCACCCACAGGG - Intronic
1019431519 7:1001827-1001849 CACAGGACTCCCCACCCACAGGG - Intronic
1019431667 7:1002337-1002359 CACAGGACTCCCCACCCACAGGG - Intronic
1020013319 7:4817895-4817917 CACAAGAGCCCCCACCCAGACGG - Intronic
1020332277 7:7032024-7032046 AACAGGAAGCCCCATCCCTAGGG - Intergenic
1021323713 7:19241909-19241931 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
1021941845 7:25686143-25686165 CACCAGCAGCACCACTCCCAAGG - Intergenic
1022838604 7:34140947-34140969 CAGAAAGAGACCCACCCCCATGG + Intronic
1023890808 7:44390750-44390772 CATGAGAAGCCCTACCCACAGGG + Intronic
1024174834 7:46828165-46828187 CACAGGAAGCCCCATCCCAAAGG + Intergenic
1024327968 7:48127242-48127264 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
1024460616 7:49655985-49656007 CACAACAACCCCCACCTGCAAGG + Intergenic
1025777697 7:64573669-64573691 CACTAGAACCTCCACCTCCAGGG + Intergenic
1025872281 7:65446292-65446314 GACAAAAATCCCTACCCCCATGG - Intergenic
1029112862 7:98222551-98222573 CACCAGGGCCCCCACCCCCAGGG + Intronic
1029207901 7:98879719-98879741 CACCAGAAGCCCCAGCCCTCTGG - Intronic
1029327876 7:99825147-99825169 CTTAAGAAGCCCCATCCCTATGG - Intergenic
1029378372 7:100196354-100196376 CACGGCAAGCCCCACCCCCCGGG + Intronic
1032137294 7:129291676-129291698 CACTGGAAGCCCCACCTCCCAGG + Intronic
1032143668 7:129358314-129358336 CACAGGAAGCCCCGCCTCCCGGG - Intronic
1032524431 7:132568990-132569012 CCAAGGAAGCCCCAGCCCCAGGG + Intronic
1033157822 7:138971644-138971666 CACAACAAAACCCACCCCCTAGG + Intronic
1033961505 7:146919405-146919427 CTCAGGAAGCCCCATCCCTAAGG - Intronic
1034019585 7:147627088-147627110 CTCAGGAAGCCCCATCCCTAGGG + Intronic
1035204368 7:157285344-157285366 CACTGCAAGCTCCACCCCCAGGG - Intergenic
1035355568 7:158274304-158274326 CACAAGGAGCCGCAGCCACAGGG + Intronic
1035526123 8:314707-314729 CACCTGCAGCCACACCCCCAGGG - Intergenic
1035832354 8:2710615-2710637 AACCAGAAGGCCCATCCCCATGG - Intergenic
1036392396 8:8334993-8335015 CACTGCAAGCCCCACCTCCAGGG - Intronic
1037069257 8:14623057-14623079 CAAAACAAGCACCACCCTCATGG + Intronic
1039000915 8:32979450-32979472 CTCAGGAAGCCACACCCCTAGGG - Intergenic
1039838736 8:41278609-41278631 CCCAAGCCGCTCCACCCCCAGGG + Intronic
1039958301 8:42224041-42224063 CACAGGAATCCCCAACCCCTGGG + Intergenic
1040555194 8:48471955-48471977 GCCAAGAAGCCCCAGCCACAAGG - Intergenic
1040655348 8:49501009-49501031 TACAACAGGCCCCAGCCCCATGG - Intergenic
1041150409 8:54926382-54926404 CTCAGGAAGCCCCATTCCCAGGG + Intergenic
1041763571 8:61393625-61393647 CTCAGGAAGCCCCATCCCTAGGG - Intronic
1041829935 8:62143154-62143176 CACAGCAACCCCCACCCTCAAGG + Intergenic
1041872301 8:62648806-62648828 CATAAGAAGCCCCAGCACCTTGG - Intronic
1041897220 8:62938670-62938692 CTTAGGAAGCCCCACCCCTACGG + Intronic
1042366520 8:67943335-67943357 CACAGCAACCTCCACCCCCAGGG + Intergenic
1042608072 8:70566232-70566254 CTCAGGAAGCCCCACTCCTAGGG + Intergenic
1043104315 8:76089249-76089271 CTCAAGAAGCCCCATCCCTAGGG - Intergenic
1043876346 8:85491176-85491198 CATAAGAAGCCCCATTCCTAGGG - Intergenic
1043987892 8:86715466-86715488 CTAAAGAAGCCCCATCCCTAGGG + Intronic
1047519323 8:125582472-125582494 CACAAGAAGCTCCACTCAGATGG - Intergenic
1047901801 8:129431280-129431302 CTCAGGAAGCCCCATCCCTAGGG - Intergenic
1047937422 8:129796610-129796632 CTTAAGAAGCCCCATCCCTAGGG - Intergenic
1048496199 8:134938165-134938187 CACTACAAGCTCCACCCCCCGGG + Intergenic
1049532402 8:143160841-143160863 CACCAGAAGCCGCAGCCCCAGGG + Intergenic
1051427504 9:16948317-16948339 CACCAGAAGCTCCACCTCCTGGG + Intergenic
1051881253 9:21841699-21841721 CTCAGGAAGCCCCATCCCTAGGG + Intronic
1051885587 9:21889612-21889634 CTCAGGAAGCCCCATCCCTAGGG - Intronic
1053200141 9:36146791-36146813 CTCAGGCAGCCCCACCCCCATGG + Intronic
1056112183 9:83406918-83406940 CGCAAAATGCCCCACCACCATGG + Intronic
1056948144 9:91018234-91018256 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
1058784477 9:108373964-108373986 CTCAGGAAGCCCCATCCCTACGG - Intergenic
1060540898 9:124429400-124429422 CATAAGAAGCCCCACCCATTGGG + Intergenic
1061225827 9:129280556-129280578 AACAGGAAGCCCCCTCCCCAAGG - Intergenic
1061268575 9:129523103-129523125 CACACAAGGCCCCACCCTCATGG + Intergenic
1061513064 9:131072560-131072582 CACAAAAGCCCCCACCCCCAGGG - Intronic
1061612565 9:131756903-131756925 CACTAGAACCCCCACCTCCTGGG - Intergenic
1061860095 9:133463642-133463664 CACAAGGATGCCCACTCCCACGG - Intronic
1062001078 9:134215986-134216008 CACAAGGAGCCCCACGGCCCTGG - Intergenic
1062332215 9:136049791-136049813 CAGCAGATGCCCTACCCCCAGGG - Exonic
1186226096 X:7400459-7400481 CACAGCAACCCCCACCTCCAGGG - Intergenic
1186514534 X:10156784-10156806 GACAGGACGCCCCACCCTCAGGG - Intergenic
1188475444 X:30586993-30587015 CTTGGGAAGCCCCACCCCCATGG + Intergenic
1189170107 X:38900894-38900916 TCCAGGCAGCCCCACCCCCATGG - Intergenic
1190268908 X:48847245-48847267 CACAACAACCCCCACCTCCTGGG - Intergenic
1190944701 X:55080355-55080377 CACTAGAACCTCCACCTCCAGGG + Intergenic
1190964490 X:55285672-55285694 CACTAGAACCTCCACCTCCAGGG + Intronic
1192118287 X:68432191-68432213 CACAAGGGGCCCAGCCCCCAGGG - Intronic
1192168270 X:68839442-68839464 AAGAACAAGCCCCACCCCCAGGG - Intronic
1192368372 X:70493950-70493972 CAGAAGTAGCCCCAACTCCAGGG - Intronic
1193203164 X:78715815-78715837 CTCAGGAGGCCCCATCCCCAGGG + Intergenic
1193255457 X:79343119-79343141 CTCAGGAAGCCCCATCCCTAAGG + Intergenic
1193556594 X:82961245-82961267 CTCAGGAAGCTCCACCCCTAGGG + Intergenic
1193706187 X:84823278-84823300 CTCAGGAAGCTCCACCCCTATGG + Intergenic
1193740766 X:85214897-85214919 CTCAAGAAGCTCCACTCCCATGG + Intergenic
1193924184 X:87464997-87465019 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
1193937193 X:87637253-87637275 CTCAGGAAGCCCCATCCCTAGGG + Intronic
1194149123 X:90301374-90301396 CACTACAAGCTCCACCTCCAGGG - Intergenic
1194438985 X:93906148-93906170 GTCAAGAAGCCCCATCCCTAGGG - Intergenic
1194468267 X:94258602-94258624 CTCAGGAAGCCCCATCCCTAGGG + Intergenic
1194967428 X:100304341-100304363 CTCAGGAATCCCCATCCCCAGGG + Intronic
1195228594 X:102823390-102823412 CTCAAGAAGCCCCACCCCTATGG + Intergenic
1196829619 X:119765860-119765882 CTCGAGCAGCCCCATCCCCATGG - Intergenic
1198972999 X:142302551-142302573 CTGAAGTAGCCCCACTCCCATGG + Intergenic
1199586938 X:149424333-149424355 CTCAGGCAGCCCCACCCCAAGGG + Intergenic
1200074927 X:153546168-153546190 CTCCACCAGCCCCACCCCCAGGG - Intronic
1200495494 Y:3878106-3878128 CACTACAAGCTCCACCTCCAGGG - Intergenic