ID: 1168342604

View in Genome Browser
Species Human (GRCh38)
Location 19:55634216-55634238
Sequence GTAACGCCAAGGCCATAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168342604_1168342614 20 Left 1168342604 19:55634216-55634238 CCCCTCTATGGCCTTGGCGTTAC No data
Right 1168342614 19:55634259-55634281 GGTACTCCATTTTCTTGCCATGG No data
1168342604_1168342608 -8 Left 1168342604 19:55634216-55634238 CCCCTCTATGGCCTTGGCGTTAC No data
Right 1168342608 19:55634231-55634253 GGCGTTACCACCTAACCAATAGG No data
1168342604_1168342609 -7 Left 1168342604 19:55634216-55634238 CCCCTCTATGGCCTTGGCGTTAC No data
Right 1168342609 19:55634232-55634254 GCGTTACCACCTAACCAATAGGG No data
1168342604_1168342611 -1 Left 1168342604 19:55634216-55634238 CCCCTCTATGGCCTTGGCGTTAC No data
Right 1168342611 19:55634238-55634260 CCACCTAACCAATAGGGATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168342604 Original CRISPR GTAACGCCAAGGCCATAGAG GGG (reversed) Intergenic
No off target data available for this crispr