ID: 1168344793

View in Genome Browser
Species Human (GRCh38)
Location 19:55644911-55644933
Sequence CCCTTCGAGTGTGACATCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168344790_1168344793 -6 Left 1168344790 19:55644894-55644916 CCCACTCGGAGGTAAAGCCCTTC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1168344793 19:55644911-55644933 CCCTTCGAGTGTGACATCTGTGG 0: 1
1: 0
2: 1
3: 10
4: 82
1168344791_1168344793 -7 Left 1168344791 19:55644895-55644917 CCACTCGGAGGTAAAGCCCTTCG 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1168344793 19:55644911-55644933 CCCTTCGAGTGTGACATCTGTGG 0: 1
1: 0
2: 1
3: 10
4: 82
1168344787_1168344793 14 Left 1168344787 19:55644874-55644896 CCTTCAGCGACACAGCATCACCC 0: 1
1: 0
2: 2
3: 13
4: 156
Right 1168344793 19:55644911-55644933 CCCTTCGAGTGTGACATCTGTGG 0: 1
1: 0
2: 1
3: 10
4: 82
1168344786_1168344793 18 Left 1168344786 19:55644870-55644892 CCTACCTTCAGCGACACAGCATC 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1168344793 19:55644911-55644933 CCCTTCGAGTGTGACATCTGTGG 0: 1
1: 0
2: 1
3: 10
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168344793 Original CRISPR CCCTTCGAGTGTGACATCTG TGG Exonic
900662094 1:3789870-3789892 CCCTTCATGTGTGAAATCTCTGG - Intronic
901081842 1:6588154-6588176 CCCTTCCAGTGCCACCTCTGTGG + Exonic
901238185 1:7678692-7678714 CCCATGGAGTGTCACCTCTGTGG - Intronic
910934460 1:92476093-92476115 CCCTTCGGCTGCGACCTCTGTGG - Exonic
912702681 1:111889859-111889881 TCCTTCAGGGGTGACATCTGAGG + Intronic
920824991 1:209416670-209416692 ACCTTTGACTGAGACATCTGGGG + Intergenic
921177603 1:212608084-212608106 CCCGCCGGGTGTGACCTCTGCGG - Intronic
924835279 1:247640748-247640770 GCCTCAGAGTGTGACATCTAGGG - Intergenic
1065730258 10:28703929-28703951 CCCTTCGAGTGGGACCCCTCTGG + Intergenic
1067016714 10:42761795-42761817 CCCATAGACGGTGACATCTGGGG - Intergenic
1068954849 10:62813427-62813449 CCCTTCGCCTGTGACTACTGTGG - Exonic
1071259452 10:83906901-83906923 CCCATCCAGTGTGGCATCTCAGG - Intergenic
1075265523 10:120997292-120997314 CCCTTGGAATGTGAGGTCTGGGG - Intergenic
1075738511 10:124679024-124679046 CCCTTCGTGTGTGGGTTCTGAGG - Intronic
1080217529 11:29862232-29862254 CCCTTCTTGCGTGACAGCTGTGG + Intergenic
1083365124 11:62137769-62137791 CCCTTAGAGTGGGACCTGTGTGG + Intronic
1083416773 11:62530898-62530920 ACCTTCGAGGCTCACATCTGGGG + Exonic
1087444234 11:98227423-98227445 CCCTTCTACTGTGAAAGCTGAGG + Intergenic
1088918869 11:114247206-114247228 CCCTACGAGTGTGAGTTCTGTGG + Exonic
1093336546 12:17912216-17912238 CCCATCCAGTGGGCCATCTGGGG - Intergenic
1097023236 12:56035242-56035264 CCTTTTGAGTGCAACATCTGTGG + Exonic
1104652433 12:130545679-130545701 GCCGTCGAGTGTCACGTCTGGGG + Intronic
1121051023 14:90819005-90819027 ACCTTCCAGTGTGGCAACTGAGG - Intergenic
1123737144 15:23196270-23196292 CCCTTGGAGTGTTTGATCTGCGG - Intergenic
1124288360 15:28424935-28424957 CCCTTGGAGTGTTTGATCTGCGG - Intergenic
1124294864 15:28492379-28492401 CCCTTGGAGTGTTTGATCTGCGG + Intergenic
1127727006 15:61760120-61760142 CCCTTTGAGGGTGCCATCTTTGG - Intergenic
1133683697 16:8145841-8145863 CCATTCGAGTTTGAAATCTTAGG - Intergenic
1136458888 16:30397905-30397927 CCCTACAAGTGTGGCATATGTGG + Exonic
1136477923 16:30524920-30524942 CCCTTCAGCTGTGGCATCTGCGG - Exonic
1136564250 16:31060745-31060767 CCCTTCTAGTTTCAAATCTGTGG + Intergenic
1137786231 16:51140003-51140025 CCCTTTAAGTGTAAGATCTGTGG - Exonic
1137786379 16:51140774-51140796 CCATTCAAGTGCAACATCTGCGG - Exonic
1147342934 17:39765863-39765885 CCTTTCGAGTGTAACATGTGTGG - Exonic
1147837436 17:43344511-43344533 CCCTTGGAATGTGGCAGCTGGGG - Intergenic
1151569797 17:74920642-74920664 CCGGACAAGTGTGACATCTGGGG - Exonic
1152919294 17:83057887-83057909 ACCTTCGACAGTGACATCAGGGG - Intergenic
1160454920 18:78993330-78993352 CCCTTCAAGTGCAACATCTGCGG + Exonic
1160588494 18:79926507-79926529 CCCATCGAGTGTGCGATCTGTGG - Intronic
1160616299 18:80132184-80132206 CCCTTTAAGTATGAAATCTGAGG - Intronic
1161045127 19:2130521-2130543 GGCTTGGTGTGTGACATCTGCGG + Exonic
1161396248 19:4046210-4046232 GCCTTCGAGGCTGACGTCTGGGG + Exonic
1162219057 19:9160642-9160664 CCCTACGAGTGTCACGACTGTGG + Exonic
1165610921 19:37151644-37151666 CCCTACAAGTGTGGCATCTGTGG - Exonic
1165614290 19:37185282-37185304 CCCTACAAGTGTGGCATCTGTGG - Exonic
1165684176 19:37803948-37803970 CCCTTTGAATGTGACAAATGTGG + Intronic
1166331533 19:42080602-42080624 CGCTTTGAGTGTGGCACCTGTGG + Exonic
1166596989 19:44058911-44058933 CGCTTCCAGGGTGACATCTAGGG + Intronic
1166633495 19:44428964-44428986 CCCTACGTGTGTGACGTGTGTGG - Exonic
1166633542 19:44429297-44429319 CCCTACCAGTGTGACAAGTGTGG - Exonic
1168344793 19:55644911-55644933 CCCTTCGAGTGTGACATCTGTGG + Exonic
1168468361 19:56621756-56621778 CCGTTTGAGTGTGACACCTGTGG + Exonic
1168644924 19:58053695-58053717 CCCTTCCAGTGTGCCGACTGTGG + Exonic
1168644995 19:58053959-58053981 CCCTTCCAGTGTAGCGTCTGCGG + Exonic
1168673802 19:58261825-58261847 CCCTATGAGTGTGACCTGTGTGG + Exonic
1168678295 19:58294994-58295016 CCCTACGAGTGTAACCACTGCGG + Exonic
1168684361 19:58338985-58339007 CCCTACGAGTGTGACGCGTGTGG + Exonic
926183420 2:10666843-10666865 CCATTCAAGTGTTACCTCTGGGG + Intronic
929426456 2:41849452-41849474 CCCTTGGAGTGTAGCATCTCAGG - Intergenic
930493496 2:52107825-52107847 CCCTCATAGTGTGACATCTTTGG + Intergenic
931900466 2:66782656-66782678 TCATTTGTGTGTGACATCTGAGG + Intergenic
947533020 2:230924727-230924749 CCCTGAGAGTGTGTCATCTCGGG + Intronic
947837661 2:233187418-233187440 CACCTCGAGTGTCACCTCTGAGG - Intronic
948504021 2:238415742-238415764 CCCATGTAGTGTGACCTCTGGGG - Intergenic
1170705725 20:18743173-18743195 CCATTCGAGTGAGACATCAGGGG + Intronic
1171368316 20:24642435-24642457 CCCTTCGAGTGTGGGCTGTGCGG - Intronic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1175465963 20:59191530-59191552 CCCTTCCCGTGTGCCACCTGCGG + Exonic
1183366753 22:37410956-37410978 CCCTTCTAGAGTCACCTCTGAGG - Intronic
956275549 3:67496417-67496439 TCCTTTGAATGTGGCATCTGTGG + Intronic
960933887 3:122883616-122883638 CCCTTGGAGGGTGTCATCTCTGG + Intergenic
974041284 4:56860009-56860031 ATCTGTGAGTGTGACATCTGTGG - Intergenic
985563335 5:602946-602968 CGCTTCGAATGTCACCTCTGAGG - Intergenic
986309724 5:6543212-6543234 CCCTCCCACTGTGACCTCTGTGG - Intergenic
989695625 5:44197119-44197141 CCCTATGAGTGAGACCTCTGTGG + Intergenic
992458028 5:76934126-76934148 ACCTTGGAGTGTGACATCCCTGG - Intergenic
997981079 5:138467632-138467654 CCCTTCGCCTGCGACATCTGTGG + Exonic
1002669075 5:180850635-180850657 CCCTATGAATGCGACATCTGTGG - Exonic
1005697949 6:28368745-28368767 CCTTATGAGTGTGACAACTGTGG + Exonic
1007093180 6:39197024-39197046 CCCTTCTTATGTGACTTCTGGGG - Intronic
1009534841 6:64868211-64868233 CCCTTTGAATGTGACAAGTGTGG + Intronic
1011995970 6:93588885-93588907 GCCTTGGAGTCTGACATCAGGGG + Intergenic
1016664537 6:146621241-146621263 CCCATGGATTGTGCCATCTGTGG + Intronic
1016904109 6:149132071-149132093 CCCTGGGAGTGTGACGTATGAGG + Intergenic
1019095227 6:169574531-169574553 GCTTTCGAGTGTGTCACCTGGGG - Intronic
1026846037 7:73699739-73699761 CCCTTCCAGAGGGACACCTGGGG + Exonic
1049554833 8:143276721-143276743 CCCTTCGCGTGTGGCGCCTGCGG + Exonic
1049880676 8:145060194-145060216 CCCTTGGAATGTGGCAGCTGGGG + Intergenic
1053073329 9:35113946-35113968 CCCTTTCACTGTGACATCTGGGG + Intronic
1060357045 9:122918940-122918962 CCTTTCCAGTGTAAAATCTGTGG - Exonic
1061477792 9:130880628-130880650 CCCTTGGAGTGAGGCATCTCAGG - Exonic
1061779845 9:132989121-132989143 CCCTTCGCCTGTGACATCTGCGG + Exonic
1200038336 X:153347475-153347497 CCCTTCGACTGCGACGACTGCGG + Exonic
1200425326 Y:3014231-3014253 CTCTTCTAGTGTGAAAACTGTGG - Intergenic