ID: 1168345227

View in Genome Browser
Species Human (GRCh38)
Location 19:55647566-55647588
Sequence CTGTTAACTCACCTGCAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2401
Summary {0: 1, 1: 1, 2: 21, 3: 272, 4: 2106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168345227_1168345234 3 Left 1168345227 19:55647566-55647588 CCATTTTGCAGGTGAGTTAACAG 0: 1
1: 1
2: 21
3: 272
4: 2106
Right 1168345234 19:55647592-55647614 GGGGAGGAGCAGGAACAGTCAGG 0: 1
1: 0
2: 5
3: 43
4: 604
1168345227_1168345233 -7 Left 1168345227 19:55647566-55647588 CCATTTTGCAGGTGAGTTAACAG 0: 1
1: 1
2: 21
3: 272
4: 2106
Right 1168345233 19:55647582-55647604 TTAACAGGCTGGGGAGGAGCAGG 0: 1
1: 0
2: 0
3: 30
4: 373
1168345227_1168345235 8 Left 1168345227 19:55647566-55647588 CCATTTTGCAGGTGAGTTAACAG 0: 1
1: 1
2: 21
3: 272
4: 2106
Right 1168345235 19:55647597-55647619 GGAGCAGGAACAGTCAGGACTGG 0: 1
1: 0
2: 0
3: 32
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168345227 Original CRISPR CTGTTAACTCACCTGCAAAA TGG (reversed) Intronic
Too many off-targets to display for this crispr