ID: 1168345489

View in Genome Browser
Species Human (GRCh38)
Location 19:55648507-55648529
Sequence GCCCGCCCACGCGAGTGCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 44}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168345471_1168345489 21 Left 1168345471 19:55648463-55648485 CCGTACTGCGCACGCGCCCAGCC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1168345489 19:55648507-55648529 GCCCGCCCACGCGAGTGCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 44
1168345481_1168345489 -2 Left 1168345481 19:55648486-55648508 CCCACCACCGGGGGACGGTCCGC 0: 1
1: 0
2: 0
3: 0
4: 10
Right 1168345489 19:55648507-55648529 GCCCGCCCACGCGAGTGCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 44
1168345480_1168345489 -1 Left 1168345480 19:55648485-55648507 CCCCACCACCGGGGGACGGTCCG 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1168345489 19:55648507-55648529 GCCCGCCCACGCGAGTGCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 44
1168345468_1168345489 28 Left 1168345468 19:55648456-55648478 CCTTTCCCCGTACTGCGCACGCG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1168345489 19:55648507-55648529 GCCCGCCCACGCGAGTGCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 44
1168345479_1168345489 0 Left 1168345479 19:55648484-55648506 CCCCCACCACCGGGGGACGGTCC 0: 1
1: 0
2: 1
3: 8
4: 100
Right 1168345489 19:55648507-55648529 GCCCGCCCACGCGAGTGCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 44
1168345484_1168345489 -9 Left 1168345484 19:55648493-55648515 CCGGGGGACGGTCCGCCCGCCCA 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1168345489 19:55648507-55648529 GCCCGCCCACGCGAGTGCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 44
1168345470_1168345489 22 Left 1168345470 19:55648462-55648484 CCCGTACTGCGCACGCGCCCAGC 0: 1
1: 0
2: 0
3: 8
4: 43
Right 1168345489 19:55648507-55648529 GCCCGCCCACGCGAGTGCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 44
1168345482_1168345489 -3 Left 1168345482 19:55648487-55648509 CCACCACCGGGGGACGGTCCGCC 0: 1
1: 0
2: 0
3: 0
4: 46
Right 1168345489 19:55648507-55648529 GCCCGCCCACGCGAGTGCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 44
1168345469_1168345489 23 Left 1168345469 19:55648461-55648483 CCCCGTACTGCGCACGCGCCCAG 0: 1
1: 0
2: 0
3: 5
4: 38
Right 1168345489 19:55648507-55648529 GCCCGCCCACGCGAGTGCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 44
1168345476_1168345489 5 Left 1168345476 19:55648479-55648501 CCCAGCCCCCACCACCGGGGGAC 0: 1
1: 0
2: 3
3: 27
4: 248
Right 1168345489 19:55648507-55648529 GCCCGCCCACGCGAGTGCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 44
1168345477_1168345489 4 Left 1168345477 19:55648480-55648502 CCAGCCCCCACCACCGGGGGACG 0: 1
1: 0
2: 1
3: 16
4: 229
Right 1168345489 19:55648507-55648529 GCCCGCCCACGCGAGTGCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 44
1168345483_1168345489 -6 Left 1168345483 19:55648490-55648512 CCACCGGGGGACGGTCCGCCCGC 0: 1
1: 0
2: 0
3: 7
4: 60
Right 1168345489 19:55648507-55648529 GCCCGCCCACGCGAGTGCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168345489 Original CRISPR GCCCGCCCACGCGAGTGCGG GGG Exonic