ID: 1168348913

View in Genome Browser
Species Human (GRCh38)
Location 19:55664648-55664670
Sequence GACACAGATGTGCCTCCGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168348913_1168348919 7 Left 1168348913 19:55664648-55664670 CCAGACGGAGGCACATCTGTGTC No data
Right 1168348919 19:55664678-55664700 ACTTGGGCTAGGTCCCTCACTGG No data
1168348913_1168348916 -10 Left 1168348913 19:55664648-55664670 CCAGACGGAGGCACATCTGTGTC No data
Right 1168348916 19:55664661-55664683 CATCTGTGTCAGGCAGGACTTGG No data
1168348913_1168348918 -4 Left 1168348913 19:55664648-55664670 CCAGACGGAGGCACATCTGTGTC No data
Right 1168348918 19:55664667-55664689 TGTCAGGCAGGACTTGGGCTAGG No data
1168348913_1168348917 -9 Left 1168348913 19:55664648-55664670 CCAGACGGAGGCACATCTGTGTC No data
Right 1168348917 19:55664662-55664684 ATCTGTGTCAGGCAGGACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168348913 Original CRISPR GACACAGATGTGCCTCCGTC TGG (reversed) Intronic