ID: 1168348913

View in Genome Browser
Species Human (GRCh38)
Location 19:55664648-55664670
Sequence GACACAGATGTGCCTCCGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168348913_1168348918 -4 Left 1168348913 19:55664648-55664670 CCAGACGGAGGCACATCTGTGTC 0: 1
1: 0
2: 2
3: 6
4: 81
Right 1168348918 19:55664667-55664689 TGTCAGGCAGGACTTGGGCTAGG 0: 1
1: 0
2: 1
3: 29
4: 293
1168348913_1168348916 -10 Left 1168348913 19:55664648-55664670 CCAGACGGAGGCACATCTGTGTC 0: 1
1: 0
2: 2
3: 6
4: 81
Right 1168348916 19:55664661-55664683 CATCTGTGTCAGGCAGGACTTGG 0: 1
1: 0
2: 1
3: 22
4: 248
1168348913_1168348917 -9 Left 1168348913 19:55664648-55664670 CCAGACGGAGGCACATCTGTGTC 0: 1
1: 0
2: 2
3: 6
4: 81
Right 1168348917 19:55664662-55664684 ATCTGTGTCAGGCAGGACTTGGG 0: 1
1: 0
2: 2
3: 22
4: 192
1168348913_1168348919 7 Left 1168348913 19:55664648-55664670 CCAGACGGAGGCACATCTGTGTC 0: 1
1: 0
2: 2
3: 6
4: 81
Right 1168348919 19:55664678-55664700 ACTTGGGCTAGGTCCCTCACTGG 0: 1
1: 0
2: 1
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168348913 Original CRISPR GACACAGATGTGCCTCCGTC TGG (reversed) Intronic
900575931 1:3382444-3382466 GACACAGCTGTGCCCCAGGCAGG - Intronic
900583497 1:3421052-3421074 GGCACAGTTGTGCTTCCATCGGG + Intronic
910424283 1:87103274-87103296 GAAACAGGTGTGCCTCCCACAGG + Intronic
916812080 1:168314503-168314525 GACACATAGGTGCATCCGTGTGG + Intergenic
919780630 1:201218583-201218605 GTCACAGCTGTGGCTCCCTCAGG + Exonic
923234620 1:232020514-232020536 TACAAAGATCTGCCTCCTTCAGG - Intronic
923566278 1:235078973-235078995 GCCACAGGTGTGTCTCCTTCAGG - Intergenic
1069751933 10:70750416-70750438 GGCAGAGATGTGCCCCAGTCAGG - Intronic
1073434948 10:103510691-103510713 GACACAGATGTTTCTCAGGCAGG - Intronic
1074899969 10:117807603-117807625 CACACAGATGTGGCTACCTCTGG + Intergenic
1076449175 10:130544455-130544477 GACACTGATGTCACTCCTTCAGG + Intergenic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1083256021 11:61495997-61496019 AACACAGAGGGGCCTCCCTCTGG + Intergenic
1083946979 11:65929151-65929173 GACACAGACGTGAATCCGACAGG - Intergenic
1086436961 11:86791174-86791196 GACACAGATTTGCCTTCATCTGG + Intronic
1089647889 11:119892167-119892189 GGCTCTGATGTGCCTCCCTCTGG + Intergenic
1089745565 11:120614461-120614483 GAGACAGAGGTGCCTGCATCTGG + Intronic
1094851094 12:34382719-34382741 GAAGCAGAGGTGCCCCCGTCAGG - Intergenic
1096240436 12:49956937-49956959 GACTCAGATCTGCCTCTGCCTGG - Exonic
1102483376 12:113239423-113239445 TACACAGCTGTGCCTCTTTCTGG + Intronic
1103210073 12:119159160-119159182 GGGACTGATGTGCCTCCTTCTGG - Exonic
1104654066 12:130560126-130560148 AACACATTTTTGCCTCCGTCTGG - Intronic
1105802696 13:23922654-23922676 GACACAATTGTGCCCCAGTCTGG - Intergenic
1107458052 13:40573256-40573278 GACACAGATGTGCCCACATCTGG - Intronic
1113416385 13:110131646-110131668 GACACCGTTGTGCCTGGGTCCGG - Intergenic
1116756275 14:48952600-48952622 GACACAGAAGTGACTCCTTTAGG - Intergenic
1119379512 14:74219561-74219583 GACACAGAGGGGGCTCCGTTTGG + Intergenic
1119693500 14:76694897-76694919 CACACAGATGTACCACAGTCGGG + Intergenic
1128090817 15:64917493-64917515 CACACAGACGTGCCTCTGTGAGG - Exonic
1129553118 15:76474885-76474907 GAAACAGATGAGTCTCCTTCTGG - Intronic
1136685404 16:31991247-31991269 GATACAGACGTGCCTGCGTGGGG + Intergenic
1140476210 16:75240334-75240356 GACACAGATGTCCCGCAGCCAGG + Intronic
1141532700 16:84657805-84657827 GACACAGTGGTGGCTCCGCCGGG - Exonic
1143976978 17:10837309-10837331 GACAAAGACGTGGCTCAGTCAGG - Intronic
1145367625 17:22278196-22278218 GGCCCAGCTGTGCCTCCATCAGG - Intergenic
1150244901 17:63667037-63667059 GACAGAGAGGTGCCTGCTTCTGG - Exonic
1150820397 17:68430004-68430026 GGTACAGATGTTCCTCTGTCCGG + Exonic
1152242534 17:79167927-79167949 GACAAAGATGGGCCTCCCCCAGG + Intronic
1152828315 17:82481272-82481294 GACACAGATCTGCCTGGCTCTGG - Intronic
1155873910 18:31061434-31061456 CTCACTGATGTGCCTCCGTATGG - Exonic
1159966597 18:74601106-74601128 GACACTGATGTGTCTGCTTCGGG + Intronic
1160160521 18:76466829-76466851 GACACAGAAGTCCCTCCACCAGG + Intronic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1161133912 19:2608519-2608541 GGCACAGGTGTGCCTGCATCTGG - Intronic
1163042114 19:14610293-14610315 CACACAGATGTGCCTCAAACAGG + Exonic
1166528757 19:43529803-43529825 GACCCAGAGGTGACTCAGTCTGG + Intronic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
1168666785 19:58210362-58210384 GATACAGATGTGCCTGCCTGTGG - Intronic
925532481 2:4880092-4880114 GACACAGCTCTGCCTCTCTCAGG + Intergenic
929758728 2:44788811-44788833 GAATCAGATGTGCCTGCATCTGG - Intergenic
933172010 2:79135178-79135200 AGCACAGATGTGCCTTCCTCAGG + Intergenic
934675784 2:96248813-96248835 GAGACAGCTGTGAGTCCGTCTGG - Exonic
935193109 2:100794056-100794078 GACACAGCTGTGACTCCTGCCGG - Intergenic
935720728 2:105976673-105976695 CACACAGTTGTGCCACTGTCAGG + Intergenic
935856411 2:107279295-107279317 GACACAGATGTGCCTCATCATGG + Intergenic
938225419 2:129611702-129611724 GACACAGATGTGCATCTGGCGGG - Intergenic
943585841 2:189739027-189739049 TACACAGATGTACCTCTGTCTGG + Intronic
946681348 2:222220189-222220211 GACAGCTTTGTGCCTCCGTCGGG - Exonic
948782634 2:240332180-240332202 GGCACAGATGTGCAGCCATCTGG + Intergenic
1169624661 20:7551069-7551091 ACCAAAGATGTGCCTCCTTCAGG + Intergenic
1172274771 20:33673638-33673660 GAGACAGCTTTGCCTCCCTCTGG + Intronic
1175925532 20:62469524-62469546 GTCTCAGACGTGGCTCCGTCGGG - Intronic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1178334774 21:31732959-31732981 GAGAAAGATGCGCCTCCGACAGG + Intergenic
1179353279 21:40633690-40633712 TGCTCAGATGGGCCTCCGTCAGG + Intronic
1180100246 21:45580578-45580600 GAGGCAGCTGTGTCTCCGTCAGG - Intergenic
1180248398 21:46563490-46563512 GACAGACATGTGCCTCCTGCAGG + Intronic
957527519 3:81396034-81396056 GTCACAGAAGAGTCTCCGTCTGG + Intergenic
958942653 3:100332736-100332758 GACACAGCTGTTCCTCCACCAGG + Intergenic
968597212 4:1491717-1491739 GACTCAGCTGTGCCACCATCAGG + Intergenic
982488092 4:155993302-155993324 TACACAGATGTGCTTTCATCCGG + Intergenic
992008429 5:72502409-72502431 GACACAGATCTCCCTCTGACAGG - Intronic
994991702 5:107004798-107004820 GACACAGTGGTGCCTCACTCCGG - Intergenic
1000071883 5:157748063-157748085 GACACTGATGTGCCTTTGCCGGG + Intronic
1001276603 5:170355792-170355814 GACACAGAAGGGACTCCGTGGGG + Intronic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1015693810 6:135957137-135957159 GAGACAGGTGTGCCTGGGTCCGG + Intronic
1020046755 7:5046198-5046220 GACCCAGATCCGCCTCCCTCGGG - Exonic
1020204552 7:6104932-6104954 GACAATGACGTGCCTCCATCCGG - Exonic
1022515432 7:30972153-30972175 GACCCAGATGTGCCTGCGTCAGG + Intronic
1029696500 7:102217153-102217175 GACACAGATGGCCCTGCTTCAGG - Intronic
1034752888 7:153587367-153587389 GGCACAGATGTGCCTCTGGCTGG + Intergenic
1040586693 8:48750121-48750143 GACTCAGATCTGCCTCTGCCTGG - Intergenic
1055085472 9:72309248-72309270 AAAACAGATGTGCCCCCGTGAGG - Intergenic
1055289391 9:74767125-74767147 GTCACAGATGTTCCTCAGTAAGG + Intronic
1185801799 X:3017801-3017823 GACTCAGATGTGCCACAGTAAGG - Intronic
1186547377 X:10464655-10464677 GAGACAGATGTGCAGCAGTCGGG + Intronic
1188916634 X:35919756-35919778 AAAACAGATGTGGATCCGTCCGG - Exonic
1200247337 X:154533195-154533217 GCCACAGATGTGCAGCCCTCAGG + Intronic
1200247410 X:154533520-154533542 GTCACAGATGGGCCTGCGACAGG + Intronic