ID: 1168348916

View in Genome Browser
Species Human (GRCh38)
Location 19:55664661-55664683
Sequence CATCTGTGTCAGGCAGGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 248}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168348911_1168348916 -8 Left 1168348911 19:55664646-55664668 CCCCAGACGGAGGCACATCTGTG 0: 1
1: 0
2: 2
3: 10
4: 119
Right 1168348916 19:55664661-55664683 CATCTGTGTCAGGCAGGACTTGG 0: 1
1: 0
2: 1
3: 22
4: 248
1168348913_1168348916 -10 Left 1168348913 19:55664648-55664670 CCAGACGGAGGCACATCTGTGTC 0: 1
1: 0
2: 2
3: 6
4: 81
Right 1168348916 19:55664661-55664683 CATCTGTGTCAGGCAGGACTTGG 0: 1
1: 0
2: 1
3: 22
4: 248
1168348912_1168348916 -9 Left 1168348912 19:55664647-55664669 CCCAGACGGAGGCACATCTGTGT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1168348916 19:55664661-55664683 CATCTGTGTCAGGCAGGACTTGG 0: 1
1: 0
2: 1
3: 22
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168348916 Original CRISPR CATCTGTGTCAGGCAGGACT TGG Intronic
901025422 1:6276520-6276542 CATCCGTGTCAGCCAGGCCCTGG + Intronic
901342384 1:8507023-8507045 CATCCTGGTCAGGCAGGACTGGG - Intronic
902079210 1:13809653-13809675 CATCTGTGTGAGGCTGGCCGTGG + Intronic
902261153 1:15225902-15225924 CCTCTGTGTCGGCAAGGACTTGG - Intergenic
902620556 1:17648401-17648423 CATCTCAGTCCGGCAGGAGTAGG + Intronic
902652214 1:17844317-17844339 CATCTGTGCTGGGCAGGGCTGGG - Intergenic
904304021 1:29575436-29575458 CAACTGTGCCAGGCAGGACTTGG + Intergenic
905914115 1:41673230-41673252 CAGCTGGGTCAGGAACGACTGGG + Intronic
906480196 1:46194574-46194596 CATCTGTCTTCAGCAGGACTGGG + Exonic
906967496 1:50472818-50472840 CATCTGTGTCTGCAAGGATTAGG - Intronic
907648134 1:56264692-56264714 CATCTGGGCAAGGCAGGCCTGGG + Intergenic
908553536 1:65233867-65233889 CAGCAGTGTGAGGCAGGACCGGG + Intergenic
908918196 1:69157651-69157673 CAGCTGTGACAGTCAGGACTGGG - Intergenic
909940508 1:81605594-81605616 CCACTGTCCCAGGCAGGACTTGG + Intronic
910220483 1:84885099-84885121 CATCTGCATCAGTCATGACTTGG + Intronic
910425159 1:87114282-87114304 CAGCTGTGACAGGCAGTAGTGGG + Intronic
910470523 1:87547708-87547730 CTGCTGTGACAGGCAGCACTGGG + Intergenic
911092529 1:94029397-94029419 CCTCTGTGGCAGGCAGACCTGGG + Intronic
912177983 1:107184153-107184175 CATCAGTACCAGGCATGACTTGG - Intronic
913391309 1:118315587-118315609 AATCTGTTGAAGGCAGGACTGGG + Intergenic
916644575 1:166770391-166770413 CGGCTGTGACAGGCAGGACTGGG + Intergenic
916824170 1:168428415-168428437 CATCTGTCTCTGGCAGATCTTGG - Intergenic
918097312 1:181345960-181345982 GCTCTGTCTCAGGCAGGACCAGG + Intergenic
918315023 1:183316321-183316343 CATTTATGTCAGGGAGGAGTTGG - Intronic
918462628 1:184792316-184792338 CATGTAGGTCAGGGAGGACTGGG - Exonic
919438499 1:197595327-197595349 CCTCTCTGTCATGCAGGTCTCGG - Exonic
922063864 1:222117195-222117217 CATCTGTCTCTGGAGGGACTGGG + Intergenic
923151806 1:231240663-231240685 CACCAGGGTCAGGCAGGTCTTGG + Intronic
923545187 1:234918695-234918717 CTTCTGGGTCAGGCAGGCTTGGG + Intergenic
1062817396 10:510526-510548 CAGCCGTGCCAGGCAGGCCTGGG + Intronic
1063605492 10:7519843-7519865 CATCTATGTCAGGGAGCCCTCGG - Intergenic
1063948969 10:11204726-11204748 CATGTGTGTCAGGCACCTCTTGG - Intronic
1067084712 10:43231644-43231666 CATCTGTGTCAGCCAGAGATGGG - Intronic
1067357909 10:45548347-45548369 AATGTGGGGCAGGCAGGACTCGG + Intronic
1067733424 10:48830441-48830463 CATGTGAGGCAGGCAGGAATTGG + Intronic
1067742719 10:48908074-48908096 CATCTTTGTCTGGCTGTACTAGG + Intronic
1067765486 10:49082849-49082871 CATCTGCTTCAGGGAGGCCTGGG - Intronic
1067787929 10:49264477-49264499 CATGTGTGGCAAGCAGGACCAGG + Intergenic
1069805334 10:71118914-71118936 CATCTATGTAAGACATGACTTGG + Intergenic
1070539688 10:77407170-77407192 CATGTGTGGGAAGCAGGACTGGG + Intronic
1070953030 10:80446076-80446098 CATCAGTATATGGCAGGACTTGG - Intergenic
1073254161 10:102140407-102140429 CTGCTGAGTCAGCCAGGACTGGG - Exonic
1073454573 10:103628780-103628802 CATCAGAGTCAGGAAGAACTGGG + Intronic
1074109226 10:110410743-110410765 CCTCTGTGTGAGACAGGAGTGGG + Intergenic
1075782047 10:125023425-125023447 CATCTGGTGCAGGCAGGGCTCGG + Intronic
1076402311 10:130192309-130192331 CCCCTGTGTCAGGGAGGGCTGGG + Intergenic
1077819855 11:5726789-5726811 CATCTGTGCCAGGCAGGCAGAGG - Intronic
1078126691 11:8572186-8572208 CCTCTCTGTCTGGCAGGAATAGG - Intronic
1079134589 11:17769256-17769278 ACTCTGTGCCAGGCAGAACTTGG + Intronic
1079390914 11:20021597-20021619 CATCCTTGTCAGCCAGAACTTGG + Intronic
1081804999 11:45885679-45885701 CACCTGTGTCTGGCAGGGCGCGG - Exonic
1082276084 11:50223039-50223061 CATTTGTGTCAGAGAAGACTGGG + Intergenic
1082932418 11:58622597-58622619 CCTCTGAGTCAGGCAGGGCGTGG + Intronic
1084203370 11:67576945-67576967 GGTCTGGGACAGGCAGGACTGGG + Intergenic
1084480649 11:69417955-69417977 CACCTGTGTGCTGCAGGACTGGG + Intergenic
1084568767 11:69946697-69946719 CATCCGTGTAAGACAGGACTTGG + Intergenic
1085478496 11:76803339-76803361 CATCTGTGACTGCCAGGCCTGGG - Intergenic
1086755481 11:90557208-90557230 CATCTGTGTCAGTCGTGAATTGG - Intergenic
1089085565 11:115814332-115814354 GAGCTGTGTCAGCCAAGACTTGG + Intergenic
1090266568 11:125356876-125356898 CAGCTGTGACAGGCAGAAGTGGG + Intronic
1090422616 11:126585896-126585918 CCTCTGTCTCAGGCAGCACAGGG - Intronic
1092784643 12:12016348-12016370 CCTCTGTCTCAGGAAGGGCTTGG - Intergenic
1093944381 12:25090651-25090673 CATTTGGGTCAGGCAGAGCTTGG - Intronic
1096233832 12:49912594-49912616 CGGCTGTGGGAGGCAGGACTGGG + Intergenic
1097573677 12:61363874-61363896 AATATGTGGCAGGCAGGATTTGG - Intergenic
1098111683 12:67128550-67128572 CATCTATATCAGTCAGGATTAGG - Intergenic
1100619527 12:96257774-96257796 CAACTGAGTCAGCCTGGACTTGG - Intronic
1101919717 12:108922646-108922668 AAGCTGTGTCAGGCAAGCCTGGG - Intronic
1103728519 12:123011094-123011116 CATGTGTGTTGGGCAGGACTGGG + Intronic
1104126191 12:125848403-125848425 CATCTCTGTCAGTGAGAACTGGG + Intergenic
1104246496 12:127047433-127047455 CATGTGTGTTTGGCAGCACTTGG + Intergenic
1104400487 12:128472112-128472134 CATCTGTGTCAAGAGGCACTGGG - Intronic
1104609510 12:130216829-130216851 CATCAGTGTGAGCCAGGAGTTGG - Intergenic
1104816302 12:131647550-131647572 AAACTGTGTCAGTCAGGGCTCGG + Intergenic
1105737610 13:23287418-23287440 CTTCTGTGTCATGCAGGTGTTGG - Intronic
1107930388 13:45302156-45302178 CATATTTGTCAGGCTGGTCTTGG - Intergenic
1109584129 13:64375620-64375642 CCTTTGTGTCATTCAGGACTTGG - Intergenic
1110706462 13:78605487-78605509 CAGGGGTGTCAGGAAGGACTAGG - Intergenic
1112262372 13:97888679-97888701 CATCTGTGTCTGGTGGGCCTGGG + Intergenic
1112606675 13:100913246-100913268 CATCTGCTACAGGCAGGAATTGG + Intergenic
1116740208 14:48745201-48745223 CAACTGTGTCAGGGAAGCCTGGG - Intergenic
1117613356 14:57506661-57506683 CCTCTGTGTTATGCAGTACTTGG + Intergenic
1117820406 14:59643419-59643441 CATCTTGGTCAGGCTGGTCTCGG + Intronic
1119759046 14:77138847-77138869 GCTCTGTGCCAGGCAGGACTAGG - Intronic
1119872394 14:78028733-78028755 CATCTGTGCCAGGCTGGTGTAGG + Intergenic
1122217706 14:100214713-100214735 CACCTGTGTTAGGCGGGGCTGGG - Intergenic
1122274784 14:100586029-100586051 CATCTGTGACACGCAGGGCGGGG - Intronic
1122900119 14:104778936-104778958 CATCTGTATGTGGCAGGGCTGGG - Intronic
1123816449 15:23984138-23984160 CATCTTTGTCATGCAAGCCTAGG - Intergenic
1123970455 15:25503707-25503729 CTTCTGAGTCAGTCGGGACTTGG - Intergenic
1124794192 15:32760967-32760989 CATCTTTGATAGTCAGGACTGGG - Intergenic
1125520880 15:40347280-40347302 CATCTGGGCCAGGCAGGGCATGG + Intergenic
1126572630 15:50168551-50168573 CTTTGGTGTCAGGCAGGAATGGG - Intronic
1127623255 15:60754738-60754760 CATCTGTATAAGAAAGGACTAGG - Intronic
1128072482 15:64806517-64806539 CACCCCTGTCAGGCTGGACTGGG - Intergenic
1129707912 15:77805155-77805177 CATCTCTTTCTGGCAGGATTAGG - Intronic
1129894588 15:79093959-79093981 CATCTGTGCCAGGCATGGGTGGG + Intergenic
1130091971 15:80828872-80828894 GATCTGTGTGAGCCAGGAGTGGG + Intronic
1130442812 15:83972685-83972707 CATGTTTGGCAGGCAGGAGTGGG - Intronic
1130975278 15:88769155-88769177 CAGATGTGTCCGGCAGGTCTCGG - Intergenic
1131457566 15:92595182-92595204 ATTCTGTGACAGGCAGGAGTGGG - Intergenic
1131530333 15:93185498-93185520 CATTTGTGTCTGGCAGGCCGGGG - Intergenic
1134136877 16:11682669-11682691 CATCTGTGTGGGCCAGGAGTTGG - Intronic
1134307282 16:13044297-13044319 CCTCTGTGGTAGGAAGGACTTGG + Intronic
1135640970 16:24119486-24119508 GAACTGGGGCAGGCAGGACTTGG + Intronic
1135978209 16:27125159-27125181 TATCTGAGTCAGGCAACACTGGG - Intergenic
1136480058 16:30535549-30535571 CATCTGTGTCAGCCAGCAAAGGG + Intronic
1138102578 16:54265596-54265618 CAATGGTGTCAGGCAGAACTGGG + Intronic
1142255969 16:89014139-89014161 CATCTGGATCTGGCAGGAGTGGG + Intergenic
1142978977 17:3660644-3660666 CAGCCGTCTCAGGCAGGACTGGG + Exonic
1143892712 17:10114951-10114973 CCTCTGTGGCTGGCAGGGCTGGG + Intronic
1144674761 17:17154690-17154712 CATCTGTGTCAGCAGGCACTTGG + Intronic
1144848695 17:18233313-18233335 CAGCTATTTCAGGCAGGGCTGGG - Intronic
1145005121 17:19333221-19333243 CATCTGTGTCTGTCAGCTCTTGG + Intronic
1145941871 17:28746964-28746986 CAGCTGCCTCAGTCAGGACTTGG - Intronic
1147163664 17:38582058-38582080 CTTCTGGCTCAGGCAGGACTAGG - Intronic
1147962681 17:44177533-44177555 CATGTGGGTGAGGCAAGACTTGG + Intronic
1147977905 17:44258524-44258546 CATCGGTGGGAGGCAGCACTAGG + Exonic
1148871572 17:50661543-50661565 CATCTGTCTCAGGAATGGCTTGG + Intronic
1150263031 17:63812180-63812202 CATCTGTGGCCACCAGGACTGGG - Exonic
1150300645 17:64044439-64044461 CTTCTGTGACAGTCAGGACCTGG + Intronic
1150474607 17:65465398-65465420 CAACTGTATCAGTCAGGATTAGG - Intergenic
1151746439 17:76014241-76014263 CATCTCTGTCTGGCCCGACTGGG - Intronic
1153776410 18:8458180-8458202 CATCTCTGCCAGGCAAGACCAGG - Intergenic
1155242040 18:23872947-23872969 CACCTGAGTCAGGCAGGCCCGGG + Intronic
1155315486 18:24566802-24566824 CATCTGTGCCTTGCAGGCCTTGG + Intergenic
1157629808 18:49083200-49083222 CATAGGTGGCAGGCAGGATTTGG + Intronic
1157940132 18:51919200-51919222 GACATGTGTAAGGCAGGACTGGG - Intergenic
1161126585 19:2561263-2561285 CATCTGTGGCTGTCACGACTGGG + Intronic
1161299701 19:3536863-3536885 CATCTGTGAAATGCAGGCCTGGG - Intronic
1162199139 19:9008660-9008682 CTCCTGTTTCAGGGAGGACTGGG - Intergenic
1163768672 19:19177813-19177835 CATCAGAGGCAGGCAGGGCTGGG + Intronic
1164927480 19:32141317-32141339 AGTCAGTGTCAGCCAGGACTGGG - Intergenic
1166355768 19:42226345-42226367 CAGCTGTGCCAGGCTGCACTGGG + Exonic
1166740523 19:45112173-45112195 CATGTCTGTCAGGCTGGTCTTGG + Intronic
1167912670 19:52716704-52716726 CATCTGTGTCAGGGAGCAGAGGG - Intronic
1168348916 19:55664661-55664683 CATCTGTGTCAGGCAGGACTTGG + Intronic
925285070 2:2710323-2710345 CATCTATGTCAGGGAGGCCTTGG + Intergenic
928095575 2:28402787-28402809 CCTCTTTGTCAGGCTGGACTGGG + Intronic
928214252 2:29348131-29348153 GATCTGTGTCAGGCTGGGCAGGG + Intronic
928435397 2:31251538-31251560 CAACTGAGTCAGGAGGGACTTGG + Intronic
929242965 2:39671299-39671321 TTTCTGTGTCAGGTAGAACTTGG - Intronic
930102557 2:47614587-47614609 TGTCTGAGTCAGGCTGGACTTGG + Intergenic
930303184 2:49643177-49643199 CAACTGTGTAAGGAAGGAATTGG - Intergenic
930703130 2:54479362-54479384 CTTCTGTGGAAGGTAGGACTTGG + Intronic
931954689 2:67408217-67408239 CATTTATTTCAGGCAGGAGTTGG + Intronic
937384344 2:121414045-121414067 CATCTGTGTCGGCTAGCACTTGG - Intronic
938295337 2:130174798-130174820 CCTCTGTGCCAGGCAGTGCTCGG + Intronic
938461283 2:131499047-131499069 CCTCTGTGCCAGGCAGTGCTCGG - Intergenic
938716950 2:134029650-134029672 CCTCTGTGTCTGGCAGCACTTGG - Intergenic
946261342 2:218493823-218493845 CAGCTCTGTCAGTCAGGTCTGGG - Intronic
946793053 2:223320856-223320878 CATCTTGGTCAGGCTGGTCTTGG + Intergenic
947328934 2:229007973-229007995 CATCTATGTGAGACAGGAATTGG - Intronic
947747073 2:232513326-232513348 CAGCTGTGTGAGGCAGGAGTGGG - Intergenic
1168908772 20:1428284-1428306 CATCTGTGTCATCTAGGAGTGGG - Intergenic
1169077719 20:2771727-2771749 CATCTGTGTCAGCCAGCAAAGGG + Intergenic
1169146511 20:3255970-3255992 CATCTGTGTCAGGTCTGTCTGGG + Intronic
1170403394 20:16011485-16011507 CATCTGCTCCTGGCAGGACTTGG - Intronic
1171392513 20:24810864-24810886 CATCTGCTCCAGGCATGACTTGG + Intergenic
1172273651 20:33668229-33668251 CAACTGAGTCAGGCTGGACTGGG + Exonic
1178602842 21:34009739-34009761 CACCTTTGTCAGCCAGGAGTCGG - Intergenic
1181028233 22:20137798-20137820 CCTGTGTGCCAGGCAGGGCTGGG + Intronic
1181475490 22:23165372-23165394 TCTCTGGGTCAGACAGGACTGGG - Intergenic
1183957266 22:41388334-41388356 CATATTTGTCAGGCTGGTCTTGG + Intronic
1184907008 22:47495024-47495046 CATTTGGGGCAGGCAGGGCTGGG - Intergenic
952274968 3:31867981-31868003 CATCTCTGTGAGGAGGGACTAGG - Intronic
953409121 3:42679319-42679341 CATCCATGTAAGACAGGACTTGG - Intergenic
953413407 3:42702447-42702469 CATCTGGGGCAGGCAGGACCAGG - Intronic
956002278 3:64742119-64742141 CATGTGTGTCAGTTAGGATTAGG + Intergenic
956830057 3:73038046-73038068 CACATGTGTCAGACAGGACCGGG - Intronic
956865593 3:73365870-73365892 CATCTGCATCGGGCTGGACTTGG + Intergenic
958114892 3:89202968-89202990 CTTCTGTGTAAGGCATGCCTAGG + Intronic
958705233 3:97645894-97645916 AATCTGTGTCAGGAAGGATTTGG + Intronic
964751651 3:160059284-160059306 CCTGTGTGCCAGGCAGGACCAGG + Intergenic
965456694 3:168910297-168910319 CTACTCGGTCAGGCAGGACTGGG - Intergenic
967993310 3:195147858-195147880 CACCTGTGTCAGGCACGACGTGG + Intronic
968038356 3:195567790-195567812 CACCTGTGTCTGGCAGGGGTTGG + Intergenic
969003344 4:4000255-4000277 GTTCTGTGGCAGGCAGGAGTGGG + Intergenic
970216741 4:13766872-13766894 CAGCTCTGCCAGGCAGGCCTTGG + Intergenic
972555902 4:40180946-40180968 CATCTTGGTCAGGCTGGTCTCGG - Intergenic
972575448 4:40347012-40347034 CATGTCAGTCAGGCAGGTCTCGG + Intronic
976551612 4:86402831-86402853 CATCTCTGTCAGTCAGCCCTGGG + Intronic
980425928 4:132628071-132628093 CATGTGTCAAAGGCAGGACTAGG + Intergenic
980889283 4:138796806-138796828 CATGTTGGTCAGGCAGGTCTTGG + Intergenic
983618807 4:169737660-169737682 CATCTGTTTCAGGGAGCTCTCGG + Exonic
986238184 5:5932153-5932175 CCTCGGTGTCAATCAGGACTGGG + Intergenic
986690081 5:10307019-10307041 CATGTGGGTCGGGCAGGCCTTGG - Intronic
987297030 5:16562373-16562395 TATCTGTGGTGGGCAGGACTAGG + Intronic
987342696 5:16952635-16952657 CTTCGGTGTCAGACAGAACTGGG + Intergenic
988615480 5:32770915-32770937 GACCTGTGTTAGTCAGGACTTGG + Intronic
990605260 5:57403424-57403446 CATCTGTGTGAGCTAGGACAGGG - Intergenic
992192991 5:74312448-74312470 CATCTGAATCAATCAGGACTTGG + Intergenic
993636425 5:90349791-90349813 TATCTGAGGCAGCCAGGACTTGG + Intergenic
994003274 5:94806504-94806526 TATGAGTCTCAGGCAGGACTGGG + Intronic
994216327 5:97142516-97142538 GATCTCTGTGAGGCAAGACTTGG + Exonic
995597516 5:113763903-113763925 CAGCTGGGTCAGCCAGGGCTTGG - Intergenic
995946212 5:117649732-117649754 CCTCTGTGGCAGGCTGTACTGGG + Intergenic
998525844 5:142842550-142842572 CCTGTGTGTCGGGAAGGACTAGG + Intronic
999399312 5:151252644-151252666 CATTTTTGTCCGGAAGGACTTGG + Intronic
1000259993 5:159578623-159578645 CATTTGTATCAGACAGGACTTGG + Intergenic
1003761978 6:9188691-9188713 CATCAGTGTCATGCAGCAATGGG + Intergenic
1005814916 6:29542660-29542682 CATCTGAGACAGGCAGGAGAGGG + Intergenic
1006175901 6:32121346-32121368 CATCTGTGGGAGGCAGGATGAGG + Exonic
1006393287 6:33771501-33771523 CATCTGCGGCAGGCAGGAGAGGG - Exonic
1008507845 6:52247850-52247872 CATCTGTGTCCAACTGGACTGGG + Intergenic
1009409117 6:63345334-63345356 CATCTGTGTCAGCTAAGATTGGG + Intergenic
1011005974 6:82646018-82646040 CATCTATTGCAGGCAGGTCTTGG + Intergenic
1011740527 6:90355213-90355235 CCTCTGGGTCAGGCAGATCTAGG - Intergenic
1016336428 6:143009970-143009992 CATCTGGGTCATGTAGGAGTTGG - Intergenic
1017066701 6:150535704-150535726 CATCTGACTCAGGTGGGACTAGG - Intergenic
1017696942 6:157025483-157025505 GATCTGTGGCAGCCAGGACTTGG - Intronic
1017789189 6:157780979-157781001 CAACTGTAGAAGGCAGGACTAGG - Intronic
1017942167 6:159062428-159062450 CATCTGTGTCAGAAAGGAAGTGG + Intergenic
1018359247 6:163049850-163049872 CATCTCTGTGAAGCACGACTTGG + Intronic
1021726790 7:23554900-23554922 AATCTGTTTCAGGCAGGCATTGG - Intergenic
1021836339 7:24679688-24679710 CATGTGTGTCAGGTAGGAGGGGG - Intronic
1022023107 7:26420511-26420533 CATTTGTCTCTGGCAGGACCTGG - Intergenic
1023712173 7:43006540-43006562 CATTTGTGTCTGGCAGGCCGGGG + Intergenic
1026315298 7:69222463-69222485 CATCATTGTCAGGCAGACCTTGG - Intergenic
1026766061 7:73160583-73160605 CATCTGGGTGTGGCTGGACTAGG + Intergenic
1027042536 7:74970279-74970301 CATCTGGGTGTGGCTGGACTAGG + Intronic
1027081107 7:75232078-75232100 CATCTGGGTGTGGCTGGACTAGG - Intergenic
1027137884 7:75638082-75638104 CCTGTGTGTCAGGCGGGTCTTGG - Intronic
1027367634 7:77474553-77474575 CATCTGTATCAGCCAGGATTTGG + Intergenic
1027828366 7:83146268-83146290 CATATGTGAGAGGCAGAACTAGG + Intronic
1028385279 7:90246352-90246374 CATTAGTGTGAGGCAGGACAGGG - Intronic
1028512740 7:91643119-91643141 CGGCTGTGTCAGGCAGGCATCGG - Intergenic
1033862463 7:145644665-145644687 CTTCTGAGTCAGGCAAGGCTAGG - Intergenic
1034678529 7:152910436-152910458 CTTTGGTGACAGGCAGGACTAGG + Intergenic
1035184286 7:157113727-157113749 CACCTGTGGCAGGAGGGACTTGG + Intergenic
1035566152 8:642863-642885 CACCTGTGGCAGGCAGTTCTGGG + Intronic
1037603372 8:20417605-20417627 CAGCTGTGTCTGGCAGGGGTCGG + Intergenic
1039864925 8:41491868-41491890 CCTCTGTGACAGGGAGGACGAGG + Intronic
1040799409 8:51324543-51324565 CATTTGTGTCATTCAGGTCTTGG - Intronic
1041548060 8:59068960-59068982 CATCTGAGTCAGGCACAAGTAGG + Intronic
1042404408 8:68387182-68387204 CTTCAGTGTCAGGCAGGAAGTGG + Intronic
1042830619 8:73024011-73024033 CAACTGTCTCAGGAAGGCCTTGG - Intronic
1044892975 8:96856857-96856879 CATCTGTGAAAGCAAGGACTAGG + Intronic
1045361044 8:101433481-101433503 CACCTGTGTCAGACAGGATGTGG - Intergenic
1045966232 8:108028080-108028102 CATCTGTTTCACCCAGGACTGGG + Intronic
1046374785 8:113362847-113362869 CATTTTTGTCAGGCAGGAATAGG - Intronic
1047311266 8:123694370-123694392 CATCTGGGTCAGGCCGGCCAAGG - Intronic
1047737788 8:127781560-127781582 CATGTTTGTCAGGCTGGTCTCGG - Intergenic
1048784198 8:138033261-138033283 CATTTGTTTCACGCTGGACTGGG - Intergenic
1048880858 8:138871333-138871355 CATCTGTAGGAGGCAGGACTGGG - Intronic
1048958502 8:139556466-139556488 CATCTGATTCAGGCAGGGGTAGG + Intergenic
1049211264 8:141387436-141387458 CACCTGTGCCAGGCATCACTGGG - Intergenic
1049907029 9:227615-227637 CATCTGTGTTAGGGTGGGCTAGG - Intronic
1053411934 9:37921356-37921378 CATCTCTTCCAGTCAGGACTGGG + Intronic
1055123542 9:72691847-72691869 CAACTGTGTCATGCTGAACTGGG + Intronic
1055950892 9:81728657-81728679 CATCTTGGTCAGGCTGGTCTTGG + Intergenic
1056681088 9:88719897-88719919 CATGAGTGTCAGGTAAGACTGGG - Intergenic
1056713038 9:89007135-89007157 CATCTGTGACAGCCAGGAGGAGG + Intergenic
1057613060 9:96563819-96563841 CTTTTGTTTCATGCAGGACTAGG - Intronic
1060079498 9:120629310-120629332 AATGTGTCTCAGGCAGGATTTGG - Intronic
1060198939 9:121640628-121640650 CATCAGAGTCAGGAGGGACTAGG + Intronic
1060334325 9:122706997-122707019 ACTATGTGCCAGGCAGGACTCGG + Intergenic
1060911955 9:127358277-127358299 TATCTCTGTGAGGCAGGACAAGG + Intronic
1061608959 9:131733445-131733467 CATCAGTGCCAGGAAGGAGTGGG - Intronic
1061804311 9:133129453-133129475 CTGCTGTGACAGGCAGGACCAGG + Intronic
1061904738 9:133690832-133690854 CATCTGGGCCAGGCTGGCCTAGG - Intronic
1062016378 9:134293289-134293311 CACCTGTGTGAGCCAGGCCTTGG + Intergenic
1187146919 X:16645478-16645500 GGACTCTGTCAGGCAGGACTGGG - Intronic
1189077175 X:37928560-37928582 CTACTGTGTAAGGCAGGAGTTGG - Intronic
1189214725 X:39313241-39313263 CATCTGTGTCAAGCACCACCTGG - Intergenic
1192560310 X:72123878-72123900 CATGTGTGGCAGGCAGGAAGGGG + Intergenic
1193525696 X:82585749-82585771 CAGATGTGTCAGGCAGAATTTGG + Intergenic
1197027460 X:121771140-121771162 CATGTGGGTCAGGCTGGTCTCGG + Intergenic
1198201856 X:134429411-134429433 CATATGTGCCAGGCACTACTAGG - Intergenic
1198278219 X:135117466-135117488 CAACTGTGCCAAGCAGTACTTGG - Intergenic
1198292743 X:135255050-135255072 CAACTGTGCCAAGCAGTACTTGG + Intronic
1201705752 Y:16934890-16934912 CATCTGTTTCAGACAGGATCAGG + Intergenic