ID: 1168348917

View in Genome Browser
Species Human (GRCh38)
Location 19:55664662-55664684
Sequence ATCTGTGTCAGGCAGGACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168348913_1168348917 -9 Left 1168348913 19:55664648-55664670 CCAGACGGAGGCACATCTGTGTC 0: 1
1: 0
2: 2
3: 6
4: 81
Right 1168348917 19:55664662-55664684 ATCTGTGTCAGGCAGGACTTGGG 0: 1
1: 0
2: 2
3: 22
4: 192
1168348911_1168348917 -7 Left 1168348911 19:55664646-55664668 CCCCAGACGGAGGCACATCTGTG 0: 1
1: 0
2: 2
3: 10
4: 119
Right 1168348917 19:55664662-55664684 ATCTGTGTCAGGCAGGACTTGGG 0: 1
1: 0
2: 2
3: 22
4: 192
1168348912_1168348917 -8 Left 1168348912 19:55664647-55664669 CCCAGACGGAGGCACATCTGTGT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1168348917 19:55664662-55664684 ATCTGTGTCAGGCAGGACTTGGG 0: 1
1: 0
2: 2
3: 22
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168348917 Original CRISPR ATCTGTGTCAGGCAGGACTT GGG Intronic
901025423 1:6276521-6276543 ATCCGTGTCAGCCAGGCCCTGGG + Intronic
901342383 1:8507022-8507044 ATCCTGGTCAGGCAGGACTGGGG - Intronic
902072643 1:13753878-13753900 ATCTGTGTCAGGCACTATTCTGG + Intronic
910220484 1:84885100-84885122 ATCTGCATCAGTCATGACTTGGG + Intronic
910599452 1:89015308-89015330 CTCAGTGTCAAGCAGGACTAAGG + Exonic
914386665 1:147175930-147175952 ATCAGTGTTTGCCAGGACTTGGG + Intronic
915106047 1:153535777-153535799 TGCTGTGCCAGGCAGGCCTTGGG - Exonic
915458303 1:156054485-156054507 ATATTTGTCAGGCACGCCTTTGG - Intergenic
917284601 1:173411005-173411027 TTCTTTGACAGGAAGGACTTGGG + Intergenic
918315022 1:183316320-183316342 ATTTATGTCAGGGAGGAGTTGGG - Intronic
922131416 1:222783447-222783469 CTCTGTGTCAGGTATCACTTAGG + Intergenic
923151807 1:231240664-231240686 ACCAGGGTCAGGCAGGTCTTGGG + Intronic
1064448039 10:15413990-15414012 ATATGTGTTAGGCAGCACTTTGG + Intergenic
1066217305 10:33300345-33300367 ATCTGTGTCAGAAAGAACTCAGG + Intronic
1066438367 10:35414626-35414648 CTCTGTGGCAGGCAGGTCTAAGG - Intronic
1069458500 10:68572826-68572848 CTCTATATCAGGAAGGACTTGGG - Exonic
1071187925 10:83064893-83064915 ATCAGAGTCAGGCTGGAATTTGG + Intergenic
1072274963 10:93813927-93813949 ATCTGACTGAGGCAGGACCTTGG - Intergenic
1074847477 10:117410907-117410929 TTCTGTGTGTCGCAGGACTTGGG + Intergenic
1074861166 10:117511687-117511709 CTCTGTGTCAGGCGGGTCTCAGG + Intergenic
1075814393 10:125253697-125253719 CTCTCTGCCAGGCAGGAATTGGG + Intergenic
1076140022 10:128071205-128071227 ATTTGCGGCAGGCACGACTTGGG + Intronic
1076941027 10:133608884-133608906 ATCTCTGTCAGACAGTAATTTGG + Intergenic
1077431378 11:2517509-2517531 CTCTCTGTCTGGCAGGACTCAGG + Intronic
1079390915 11:20021598-20021620 ATCCTTGTCAGCCAGAACTTGGG + Intronic
1081483401 11:43508796-43508818 TGCTGTGACAGGCAGGACTGAGG - Intergenic
1082932419 11:58622598-58622620 CTCTGAGTCAGGCAGGGCGTGGG + Intronic
1084837054 11:71810063-71810085 ACGTGTGTCAGGCAAGACTCTGG + Intergenic
1086669380 11:89528287-89528309 CCATGTCTCAGGCAGGACTTTGG + Intergenic
1089013875 11:115151227-115151249 TTCTTTCTCAGGCAGGGCTTAGG - Intergenic
1089085566 11:115814333-115814355 AGCTGTGTCAGCCAAGACTTGGG + Intergenic
1091129154 11:133129430-133129452 AAATGTGTTAGGCAGAACTTAGG - Intronic
1091221406 11:133931788-133931810 GTCTGTGTCTGGCAGAACCTCGG - Exonic
1091984278 12:4895447-4895469 CTCTATGTCAGGAAGGACTTAGG + Intergenic
1092402178 12:8186041-8186063 ACCTGTGTCAGGCAAGACTCTGG - Intronic
1096864950 12:54556925-54556947 TTCTCTGGCAGGCAGGACCTGGG + Intronic
1098898305 12:76086832-76086854 ATTTATGTCAGGCACAACTTCGG + Intergenic
1102298723 12:111756318-111756340 CTCTGTGTCTGCCAGGCCTTTGG + Exonic
1103260709 12:119586017-119586039 CCCTGTGTCAGGCAGTATTTGGG - Intergenic
1103273594 12:119693577-119693599 ATGTGTTTCTGGCATGACTTGGG + Intronic
1103492614 12:121334325-121334347 CTCTGTGTCAGGCAGCACCTAGG - Intronic
1103728520 12:123011095-123011117 ATGTGTGTTGGGCAGGACTGGGG + Intronic
1104609509 12:130216828-130216850 ATCAGTGTGAGCCAGGAGTTGGG - Intergenic
1106826200 13:33523221-33523243 TTCTTTGTCAGGCAGAAGTTTGG + Intergenic
1106926377 13:34617601-34617623 AGCTGTGTAAGGCAGATCTTTGG - Intergenic
1110994774 13:82093452-82093474 GCCTGTGGCAGGCAGGAGTTTGG + Intergenic
1112606676 13:100913247-100913269 ATCTGCTACAGGCAGGAATTGGG + Intergenic
1117613357 14:57506662-57506684 CTCTGTGTTATGCAGTACTTGGG + Intergenic
1117758734 14:59003968-59003990 ATCTGTGTCTGGCAGCCTTTTGG - Intergenic
1117958260 14:61138927-61138949 TTCTCTGGCAGGCAGGAGTTGGG + Intergenic
1119544571 14:75462187-75462209 AGCTCTGAGAGGCAGGACTTGGG - Intronic
1122900112 14:104778895-104778917 ATCTGTCTCAGGCAGGTCTGTGG - Intronic
1123783697 15:23647981-23648003 TCCTGTGTCAGCCAGGACTCCGG - Intergenic
1125520881 15:40347281-40347303 ATCTGGGCCAGGCAGGGCATGGG + Intergenic
1125602310 15:40922467-40922489 AACTGTGGCAGGAAGGATTTAGG - Intergenic
1128420667 15:67488899-67488921 ATCTGTCTCAGACAGGTCTGTGG - Intronic
1130091972 15:80828873-80828895 ATCTGTGTGAGCCAGGAGTGGGG + Intronic
1130306492 15:82715153-82715175 CTCTGTGGAAGGCAGGGCTTTGG + Intergenic
1133842960 16:9427073-9427095 ATCTGTGGCTGCCAGGAGTTGGG - Intergenic
1134136876 16:11682668-11682690 ATCTGTGTGGGCCAGGAGTTGGG - Intronic
1134747030 16:16596376-16596398 GTCTGTGTCAGGCATTACCTTGG + Intergenic
1134998444 16:18757284-18757306 GTCTGTGTCAGGCATTACCTTGG - Intergenic
1135181521 16:20278665-20278687 ATCTGTGTAATGAAGGTCTTTGG + Intergenic
1136671625 16:31863667-31863689 TTCTGTGTCAGACATGTCTTAGG + Intergenic
1137975137 16:53024842-53024864 ATATGTGTCAGGCACTACTCTGG + Intergenic
1140862021 16:79026275-79026297 CCCTGTGGCAGGCAGGAGTTAGG - Intronic
1142677455 17:1522802-1522824 ATCTATGTCAGCTAGGACTGTGG + Intronic
1143118243 17:4592515-4592537 ATCTGTGCCAGGCTGGCCCTTGG + Intronic
1143875191 17:9985962-9985984 ATGTGTGTGTTGCAGGACTTAGG - Intronic
1143912923 17:10266862-10266884 GTCTTTGTCTGGCAGGCCTTGGG + Intergenic
1146555680 17:33821686-33821708 ATCTGTTTCAGGACTGACTTGGG - Intronic
1147962682 17:44177534-44177556 ATGTGGGTGAGGCAAGACTTGGG + Intronic
1152246188 17:79185765-79185787 CTCTGTGTCAGGCATGGCTTAGG - Intronic
1154327231 18:13400380-13400402 TTCTGTTTCTGGCAGGAATTTGG + Intronic
1155332728 18:24734177-24734199 TTCTGTGACAGGCAGGGCTGAGG + Intergenic
1156907140 18:42367367-42367389 ATGTGTGTGAGGCAGGAGTCTGG + Intergenic
1162503754 19:11069867-11069889 ATCTGGGGCAGGAAGCACTTGGG + Intergenic
1164504971 19:28852298-28852320 CTCTGTGTCAAGCAGGTCTATGG - Intergenic
1164772201 19:30818152-30818174 TTCTGTGACAGGTTGGACTTTGG - Intergenic
1164824359 19:31273565-31273587 ATCTGTTAGATGCAGGACTTTGG + Intergenic
1165418926 19:35713153-35713175 ATCTGTGGCAGCAAGGACCTTGG - Intronic
1166644402 19:44520351-44520373 CTCTGTGTCAGGCATGAATCTGG - Intronic
1167122789 19:47528904-47528926 AGCTGTGTGAGGCAGGGCCTTGG + Intronic
1168348917 19:55664662-55664684 ATCTGTGTCAGGCAGGACTTGGG + Intronic
925285071 2:2710324-2710346 ATCTATGTCAGGGAGGCCTTGGG + Intergenic
926463314 2:13160872-13160894 ACTTGTTTCTGGCAGGACTTTGG - Intergenic
926664913 2:15510636-15510658 TTTTGTGTCAGGCAGTCCTTGGG - Intronic
926951746 2:18250785-18250807 ACCTGTGTCAGGCTGGACCCTGG - Intronic
928214253 2:29348132-29348154 ATCTGTGTCAGGCTGGGCAGGGG + Intronic
928435398 2:31251539-31251561 AACTGAGTCAGGAGGGACTTGGG + Intronic
930369036 2:50480884-50480906 ATCAGTGTCAGGCATTACTATGG + Intronic
930703131 2:54479363-54479385 TTCTGTGGAAGGTAGGACTTGGG + Intronic
930917683 2:56713765-56713787 CTCATTGTCAGGCAGGACTCTGG + Intergenic
933892914 2:86788030-86788052 CTCTGTGTCATGTAGGACCTTGG - Intronic
935362239 2:102256186-102256208 ATCTGAGTCAGGTACTACTTTGG + Intergenic
935638294 2:105267281-105267303 CTCTGTGTCAGCCAGGACGAAGG - Exonic
935787388 2:106561207-106561229 ACGTGTGCCAGGGAGGACTTGGG + Intergenic
936652063 2:114439106-114439128 AGATGTGGCAGGCAGGAGTTAGG + Intergenic
937631439 2:124106529-124106551 ATCTGTGTCAGTGAGCGCTTTGG + Intronic
938614878 2:132987317-132987339 ATCTCTGCCAGGCAAGTCTTGGG + Intronic
938716949 2:134029649-134029671 CTCTGTGTCTGGCAGCACTTGGG - Intergenic
939590976 2:144063049-144063071 ATTTTTGTCAGGCAGGTCTATGG + Intronic
940664889 2:156596733-156596755 ATCTGTTTCAGTCAGGACTTCGG + Intronic
944848643 2:203694403-203694425 ATCTCTGTAAGGCAGAGCTTTGG + Intergenic
946245826 2:218386911-218386933 ATGTGAGTCATGCAGGACTTTGG + Intronic
946734955 2:222744791-222744813 AACTCTGTCATGCAGGACTATGG + Intergenic
947228351 2:227861174-227861196 ATGTGTCTCAGCCAGGATTTTGG - Intergenic
1169389605 20:5179004-5179026 ATGTCTGTCAGGTAGGAATTGGG + Intronic
1172273652 20:33668230-33668252 AACTGAGTCAGGCTGGACTGGGG + Exonic
1172277677 20:33688893-33688915 CTCTGGGGCGGGCAGGACTTTGG - Intergenic
1173422486 20:42914914-42914936 ATCTGTGTGAGGCAGGGGCTTGG + Intronic
1176133091 20:63505218-63505240 AGCTGTGTCGGGCAGTATTTTGG - Intergenic
1181475489 22:23165371-23165393 CTCTGGGTCAGACAGGACTGGGG - Intergenic
1182433656 22:30316160-30316182 ATCGGTGTCCCTCAGGACTTTGG - Intronic
1182757479 22:32691458-32691480 TTGTGTGTCTGGCAGGATTTAGG + Intronic
1184713115 22:46264668-46264690 CTTTGTCTCAGACAGGACTTTGG - Intergenic
949408324 3:3737632-3737654 ATTTGTGTCTGGCATGCCTTGGG + Intronic
950093235 3:10312146-10312168 ATCTGTGGAAGGCGGGACCTGGG - Intronic
950115345 3:10447213-10447235 ATCTGTGCCAGGCATGAGGTTGG + Intronic
950554379 3:13686312-13686334 AGGTGAGTCAGCCAGGACTTTGG + Intergenic
952712972 3:36450380-36450402 ATCTGTGTCAGGCTGCCTTTTGG - Intronic
953413406 3:42702446-42702468 ATCTGGGGCAGGCAGGACCAGGG - Intronic
955161134 3:56466934-56466956 ATCTGTGTAAAGAAGGAATTGGG - Intronic
955950554 3:64238641-64238663 CACTGTGTCAGGCAGGAGGTGGG + Intronic
956378181 3:68637748-68637770 CTCTGAGTCAGCCAGGACCTGGG - Intergenic
956533057 3:70242875-70242897 ATCTGTGCCAGGGAGGGGTTTGG + Intergenic
958141072 3:89562968-89562990 AGCTGTTTTAGGCAGGACTAAGG - Intergenic
958909057 3:99972827-99972849 ATCTGTCTGATGCAGGCCTTTGG + Intronic
959583906 3:108008347-108008369 ATCTGTGTCACTGAGGACTGTGG - Intergenic
960607283 3:119519940-119519962 ATCAGTAACAGGAAGGACTTTGG + Intronic
960804340 3:121568274-121568296 ATCTGTGTTAGCCAGGCCTTTGG + Intergenic
960868731 3:122228569-122228591 ATCTGTCTCTGGCTGGAATTAGG + Intronic
962098571 3:132317425-132317447 AGCTGTTTCTGGCAGGAGTTAGG - Exonic
963207185 3:142648866-142648888 ACCTGGGTCAGGCACCACTTTGG + Intronic
967816769 3:193805862-193805884 CTCTGTGTTAGAAAGGACTTTGG + Intergenic
968038357 3:195567791-195567813 ACCTGTGTCTGGCAGGGGTTGGG + Intergenic
968282153 3:197485111-197485133 ATCTGTGGCTGGCAGGACCCAGG - Intergenic
968736949 4:2302481-2302503 ACCAGTGTAAGGAAGGACTTGGG + Intronic
969003345 4:4000256-4000278 TTCTGTGGCAGGCAGGAGTGGGG + Intergenic
969456002 4:7299971-7299993 AGCTGTGACAGGCAGGAGTCAGG + Intronic
969778461 4:9377559-9377581 ACCTGTGTCAGGCAAGACTCTGG + Intergenic
973659490 4:53088362-53088384 GGCTCTGTCAGGCAGGGCTTAGG - Intronic
974233747 4:59152841-59152863 ATTTGTGTCAGTGAGGACTGAGG + Intergenic
974919475 4:68220729-68220751 ATCAGTAGCAGGCAGTACTTAGG + Intergenic
979088377 4:116444773-116444795 ATATGTGTTAGGCATGATTTTGG + Intergenic
979479274 4:121197237-121197259 TGCTGTGCCCGGCAGGACTTAGG - Intronic
982746072 4:159104300-159104322 AACTGTGTCAGGAAGGAGGTGGG - Intronic
984851428 4:184156463-184156485 ATATGGGTCAGGCAGGAATATGG - Intronic
986349465 5:6863937-6863959 ATTTGTGTAAGCCAGGATTTAGG + Intergenic
988167365 5:27611369-27611391 TTCTGTCTCAGGCAGTAATTAGG - Intergenic
989098736 5:37805287-37805309 ATCTGTATTTGTCAGGACTTTGG - Intergenic
992185240 5:74238035-74238057 ATCTGCCTCAGGTAGGTCTTTGG + Intergenic
992192992 5:74312449-74312471 ATCTGAATCAATCAGGACTTGGG + Intergenic
993872346 5:93267770-93267792 ATCTGTGTCAAGCAGGGGTGCGG - Intergenic
994216328 5:97142517-97142539 ATCTCTGTGAGGCAAGACTTGGG + Exonic
996177465 5:120377622-120377644 ATCTATGTAAGACATGACTTTGG + Intergenic
997001861 5:129771184-129771206 CTCTGTGTCAGGAAGGAGTTTGG + Intergenic
999399313 5:151252645-151252667 ATTTTTGTCCGGAAGGACTTGGG + Intronic
999839923 5:155413829-155413851 ATCTGCGGAAGGGAGGACTTGGG + Intergenic
1000824813 5:166031900-166031922 AGCTGAGTCAGGCAGGCATTTGG - Intergenic
1000935027 5:167297014-167297036 ATCTGTGGCAGGGAGGACCCAGG + Intronic
1003085633 6:3058599-3058621 AACTGTGTCAAGCAGGATTTTGG + Intergenic
1003990887 6:11485407-11485429 ATCTGTGACAGGCAGAATCTAGG + Intergenic
1007110363 6:39310133-39310155 TCCTGTGTCATGCAGGAGTTGGG + Intronic
1007114528 6:39334230-39334252 ATCTCTGTCAGTAAGGCCTTTGG + Exonic
1008303643 6:49873281-49873303 ATATGTGTCTGGAAGGAGTTAGG + Intronic
1008709119 6:54201762-54201784 CTCTGTGTCAGGCAGCATTCTGG - Intronic
1009990861 6:70841346-70841368 CTCTGTGTCTGGTAGGACTGTGG - Intronic
1013817767 6:114119245-114119267 ATCTGTGTAAGGAAAGACTTTGG - Intronic
1013854611 6:114556828-114556850 AACTGTATCAGTCAGGAGTTGGG + Intergenic
1015165695 6:130198033-130198055 TTCTCTGGCAGGCAGGACTGAGG - Intronic
1016005399 6:139084064-139084086 ATCTGAGACAGGCAGGACTGAGG + Intergenic
1017696941 6:157025482-157025504 ATCTGTGGCAGCCAGGACTTGGG - Intronic
1017942168 6:159062429-159062451 ATCTGTGTCAGAAAGGAAGTGGG + Intergenic
1018834189 6:167470980-167471002 ATCAGAGCCAGGCAGGACTGAGG + Intergenic
1019913805 7:4117795-4117817 ATCTGTGTAAGGGAAGAGTTAGG + Intronic
1020128733 7:5547697-5547719 CCCTGTGGCAGGCAGGAGTTTGG - Intronic
1020470527 7:8529328-8529350 CTCTGTGGCAGGCAGAATTTTGG - Intronic
1022023106 7:26420510-26420532 ATTTGTCTCTGGCAGGACCTGGG - Intergenic
1027137883 7:75638081-75638103 CTGTGTGTCAGGCGGGTCTTGGG - Intronic
1030779987 7:113588529-113588551 ATCTGTGGCAGGCATGAGGTGGG - Intergenic
1033403664 7:141051219-141051241 ATCTTTGTCATGCAAGCCTTGGG - Intergenic
1033824484 7:145172780-145172802 ATCTGTGGTAGACTGGACTTAGG + Intergenic
1034223948 7:149468494-149468516 ATCTGTTTCAGGCCGGACTCTGG - Intergenic
1034347014 7:150392496-150392518 AACTGTGTCAGTCAAGAGTTCGG + Intronic
1036275909 8:7351555-7351577 ACCTGTGTCAGGCAAGACTCTGG + Intergenic
1036345447 8:7958804-7958826 AGCTGTGTCAGGCAAGACTCTGG - Intergenic
1036840775 8:12119558-12119580 ACCTGTGTCAGGCAAGACTCTGG - Intergenic
1036862579 8:12365808-12365830 AGCTGTGTCAGGCAAGACTCTGG - Intergenic
1037607147 8:20447629-20447651 ATCTGGATCTGGAAGGACTTAGG - Intergenic
1038690633 8:29759864-29759886 TTCTGTGCCAGGCAGGCTTTGGG + Intergenic
1041290981 8:56308264-56308286 ATGTTTGTAAGCCAGGACTTGGG + Intronic
1042404409 8:68387183-68387205 TTCAGTGTCAGGCAGGAAGTGGG + Intronic
1046037460 8:108861518-108861540 GTGTGTGTGAGACAGGACTTTGG + Intergenic
1046374784 8:113362846-113362868 ATTTTTGTCAGGCAGGAATAGGG - Intronic
1048880857 8:138871332-138871354 ATCTGTAGGAGGCAGGACTGGGG - Intronic
1049088297 8:140494573-140494595 ATCTGAGTGAGGCAGGATTGTGG + Intergenic
1049383366 8:142328798-142328820 GTCTGTGACAGGGAGGCCTTTGG + Intronic
1049658311 8:143808575-143808597 ATCTGGGTCAGGCAGGGGTGAGG + Intronic
1051014329 9:12457484-12457506 ATCCATGTAAGGCAGGACATAGG + Intergenic
1051875931 9:21793590-21793612 AACTGTGGCAGATAGGACTTGGG - Intergenic
1052244797 9:26321463-26321485 ATCTCTGGCAGGAAGGACCTGGG - Intergenic
1052373011 9:27687299-27687321 ATTTTTCTCAGGCAGGAATTGGG - Intergenic
1053456311 9:38235529-38235551 AGCTGTGGCTAGCAGGACTTGGG + Intergenic
1056132988 9:83603575-83603597 ATTTGTGTCAGGGAGGACCCTGG + Intergenic
1062546635 9:137066507-137066529 CTCTGTGCCAGGCTGGAGTTTGG + Intronic
1185524304 X:765135-765157 ACCAGAGTCAGGCAGGAATTTGG - Intergenic
1189214724 X:39313240-39313262 ATCTGTGTCAAGCACCACCTGGG - Intergenic
1192320706 X:70088248-70088270 GTCTTTGTCACCCAGGACTTAGG - Intergenic
1192452376 X:71252451-71252473 ATGTGTGTGGGGAAGGACTTGGG - Intronic
1192640134 X:72853925-72853947 TTCTTTGTCAGGCAGCTCTTAGG - Intergenic
1192641577 X:72866880-72866902 TTCTTTGTCAGGCAGCTCTTAGG + Intergenic
1193382160 X:80827993-80828015 GTCTGTGTCAGCCATTACTTAGG - Intergenic
1198278218 X:135117465-135117487 AACTGTGCCAAGCAGTACTTGGG - Intergenic
1198292744 X:135255051-135255073 AACTGTGCCAAGCAGTACTTGGG + Intronic
1201863337 Y:18623569-18623591 ATCTCTGTCAGACAGTAATTTGG - Intergenic
1201869985 Y:18696809-18696831 ATCTCTGTCAGACAGTAATTTGG + Intergenic