ID: 1168348918

View in Genome Browser
Species Human (GRCh38)
Location 19:55664667-55664689
Sequence TGTCAGGCAGGACTTGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 293}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168348911_1168348918 -2 Left 1168348911 19:55664646-55664668 CCCCAGACGGAGGCACATCTGTG 0: 1
1: 0
2: 2
3: 10
4: 119
Right 1168348918 19:55664667-55664689 TGTCAGGCAGGACTTGGGCTAGG 0: 1
1: 0
2: 1
3: 29
4: 293
1168348912_1168348918 -3 Left 1168348912 19:55664647-55664669 CCCAGACGGAGGCACATCTGTGT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1168348918 19:55664667-55664689 TGTCAGGCAGGACTTGGGCTAGG 0: 1
1: 0
2: 1
3: 29
4: 293
1168348913_1168348918 -4 Left 1168348913 19:55664648-55664670 CCAGACGGAGGCACATCTGTGTC 0: 1
1: 0
2: 2
3: 6
4: 81
Right 1168348918 19:55664667-55664689 TGTCAGGCAGGACTTGGGCTAGG 0: 1
1: 0
2: 1
3: 29
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168348918 Original CRISPR TGTCAGGCAGGACTTGGGCT AGG Intronic
900965850 1:5957974-5957996 TGTGAAGCAGGCCCTGGGCTGGG - Intronic
901235927 1:7667588-7667610 TGTCAGACAGGCCCTGGGCTGGG + Intronic
903011752 1:20336238-20336260 TGTCAGGAAGGACTTCCGCAGGG - Intronic
903539573 1:24089498-24089520 TCTCAGGCTGGCCTGGGGCTGGG + Intronic
903658698 1:24964146-24964168 TCCCAGGCAGGACAGGGGCTGGG + Intronic
904014551 1:27409738-27409760 AGGCAAGGAGGACTTGGGCTTGG + Exonic
904304022 1:29575442-29575464 TGCCAGGCAGGACTTGGCCCTGG + Intergenic
904456179 1:30649556-30649578 TGTCTGGCAGGAAATGGGCAGGG - Intergenic
906320789 1:44813968-44813990 GGCCGGGCAGGGCTTGGGCTGGG + Exonic
906471863 1:46137751-46137773 TGTGTGCCAGGCCTTGGGCTGGG - Intronic
906492573 1:46279555-46279577 TCTCAGGCAGAAATTGGGCTGGG + Exonic
908907167 1:69029190-69029212 TGTGAGGCAGTACCTGTGCTGGG - Intergenic
911651294 1:100391820-100391842 TGTCAGCCAGGCTGTGGGCTGGG + Intronic
912725697 1:112057337-112057359 TGTCAGGCAGGAGTTGGAGGAGG - Intergenic
916548714 1:165829451-165829473 TGCCAGGCAGGCATTGTGCTAGG - Intronic
919564134 1:199162242-199162264 TGTCAGTAAGGATTGGGGCTTGG + Intergenic
919833615 1:201558931-201558953 TGAGAGGCAGGAGTTGGGGTGGG + Intergenic
920186006 1:204159897-204159919 TGCCTGGCAGGACTGGGTCTTGG + Intronic
920987404 1:210903401-210903423 TCTCTGGCAGGACTTGGGAAGGG + Intronic
922592174 1:226785463-226785485 GGGCAGTCAGGGCTTGGGCTTGG + Intergenic
922791768 1:228314836-228314858 TGCCATGCAGGACTTGGCCGTGG + Intronic
922803234 1:228373468-228373490 AGTCAGGCAGGATCTGGGGTTGG - Intronic
922807378 1:228397408-228397430 TGTCAGGCAGAAGTGGGCCTTGG - Intronic
923086600 1:230707481-230707503 TGGCAGGCAGGAGCTGGGCATGG + Intronic
923151811 1:231240669-231240691 GGTCAGGCAGGTCTTGGGGGTGG + Intronic
923219228 1:231878122-231878144 TATCAGGCAGGTGCTGGGCTCGG + Intronic
923766140 1:236893854-236893876 TGGCAGGCAGCACATGGCCTGGG + Intronic
924009170 1:239645235-239645257 TGTCTGGCAGGGCTTGGGCAGGG - Intronic
924536611 1:244940682-244940704 TATCAGGCAGCACTTTGTCTGGG - Intergenic
1063965028 10:11339950-11339972 AGGCACGCAGGACATGGGCTTGG + Intergenic
1064148625 10:12844496-12844518 TGTCAGGCAGGCCCTGTCCTAGG + Intergenic
1064352600 10:14590191-14590213 TGTCAGAGAGGTCTTGAGCTTGG - Intronic
1064828774 10:19437922-19437944 TGTAAGGAAGGACTTGGAATGGG - Intronic
1066688392 10:38002909-38002931 TTCCAGGTAGGCCTTGGGCTAGG + Intergenic
1067781212 10:49208882-49208904 AGTCAGGGAGGACTGAGGCTGGG - Intergenic
1069724920 10:70571406-70571428 TGTCAGGCGGGACTTGACCTTGG + Intergenic
1069786554 10:70991948-70991970 TGTCAAGCCGGTCTTGGACTCGG + Intergenic
1069987370 10:72293558-72293580 AGTCAGGCTGGAGTTGGCCTTGG + Intergenic
1070058142 10:72954768-72954790 TGTCAGGCAGGACTGGGAAAGGG + Exonic
1070745176 10:78929488-78929510 TTTTGGGCAGGTCTTGGGCTGGG - Intergenic
1070782846 10:79147520-79147542 TGTGTGCCAGGACCTGGGCTAGG + Intronic
1071252206 10:83830444-83830466 TGTCAGGCAGGACCGGAGCAGGG - Intergenic
1071304764 10:84289048-84289070 AGTCTGGCATGCCTTGGGCTTGG + Intergenic
1072444722 10:95489094-95489116 AGTTTGGCTGGACTTGGGCTGGG - Intronic
1072523681 10:96252978-96253000 TGGCAGGCAGGCCTCAGGCTTGG + Intronic
1072552265 10:96487983-96488005 TCCCAGGCAGGACGTGAGCTGGG - Intronic
1073056553 10:100706951-100706973 TCTCAGGCTGGACTGGGGGTGGG - Intergenic
1073186853 10:101620175-101620197 TTGCCGGCAGGACTTGGGGTTGG - Intronic
1074979150 10:118605441-118605463 AGTCAGGCAGGGCTTGCTCTGGG - Intergenic
1075728496 10:124622848-124622870 TGTCAGGGAGGGCCTGGGGTGGG - Exonic
1075967085 10:126622399-126622421 TGTCATGGAGTACCTGGGCTTGG - Intronic
1076056775 10:127381863-127381885 TGTCATGCCAGACTTGTGCTAGG - Intronic
1076253920 10:129005020-129005042 TGTCAGGCAGGAGATAGGCTGGG + Intergenic
1076583837 10:131532271-131532293 TGACAGGCAGGGCTGGGGATGGG - Intergenic
1076619627 10:131778947-131778969 GGTCAGGCAGGGGTAGGGCTGGG - Intergenic
1077315286 11:1916935-1916957 TGGCAGGCAGGACAGAGGCTAGG - Intergenic
1078600233 11:12724114-12724136 TGGAAGGCTAGACTTGGGCTTGG - Intronic
1079604050 11:22343372-22343394 CGCCAGGCGGGACTGGGGCTCGG + Intronic
1079714272 11:23725259-23725281 TGCCACACTGGACTTGGGCTTGG - Intergenic
1081837412 11:46167426-46167448 TATGAGGCAGGACTTGGCATTGG + Intergenic
1081856709 11:46308547-46308569 ACTCAGGCAGGACCTCGGCTAGG - Intronic
1082260786 11:50075093-50075115 TGTGAGGCAAGAGTTGGGCTGGG + Intergenic
1082261230 11:50077441-50077463 TGGGAGGCAGGAGTTGGGCCTGG + Intergenic
1082774517 11:57235260-57235282 TGTGAGGCAGGGAATGGGCTGGG - Exonic
1083157515 11:60833733-60833755 TGTCAGCCAGGACCTCAGCTGGG + Intergenic
1083614843 11:64021261-64021283 TGGGAGGCAGGACCTGGGCCGGG + Intronic
1084014360 11:66369869-66369891 TGTCAGCCAGGCTTTGGCCTAGG + Intronic
1084512838 11:69616829-69616851 TGTGAGGCAGGGCCTGGGTTTGG - Intergenic
1084652698 11:70498521-70498543 TGTCAGGCAGGATTTGGGGTGGG - Intronic
1089616552 11:119698089-119698111 TGTCAGGCAGGGCAGGGCCTGGG - Intronic
1090863733 11:130676739-130676761 GGCCAGGCAGGGCTGGGGCTGGG - Intronic
1091935652 12:4432606-4432628 TGTCAGGGAGGACATGTGCTGGG - Intronic
1093937766 12:25019468-25019490 TGTCAGAGAGGAGTTTGGCTGGG - Intergenic
1096460471 12:51819230-51819252 TCTCAGGAAGGAATTGGGCAAGG + Intergenic
1096578842 12:52571507-52571529 TTTGAGGCAGGAGTTGGGCAGGG - Intronic
1100036461 12:90258410-90258432 TTACAGGCTGGACTTGGCCTGGG + Intergenic
1101363295 12:104047885-104047907 TGTCAGGCAGGATTTGACCAGGG - Intronic
1103030649 12:117609425-117609447 TGGCAGGCTGGATTTGGCCTTGG - Intronic
1103260706 12:119586012-119586034 TGTCAGGCAGTATTTGGGTTGGG - Intergenic
1103449801 12:121020650-121020672 AGTCCTGCAGGACTTGGCCTTGG + Exonic
1103736051 12:123061517-123061539 CGTCAGGCATGGCTTGGGCAGGG + Intronic
1104072252 12:125356023-125356045 TGCCAGGCTGGAGTTGGGGTAGG + Intronic
1104657994 12:130588154-130588176 GAGGAGGCAGGACTTGGGCTGGG - Intronic
1109100750 13:58181149-58181171 TGTCATTCATGACTAGGGCTTGG + Intergenic
1110391773 13:74982858-74982880 TGTCAGCTAGGACTTCTGCTGGG + Intergenic
1111145187 13:84169851-84169873 TGTCAGTCAGAGTTTGGGCTGGG - Intergenic
1111342020 13:86898938-86898960 TGCCATGCAGGACATGGGCATGG + Intergenic
1111485528 13:88894591-88894613 TGTCAGGCATGACTTCACCTGGG + Intergenic
1111748995 13:92303817-92303839 TTTGTGGCAGGATTTGGGCTGGG + Intronic
1112386690 13:98946434-98946456 TGTCAGGCTGGCCTGGGGCAGGG - Intronic
1113652316 13:112042765-112042787 TTTCAGGCAGGGCTGGGGCAAGG - Intergenic
1113783324 13:112988843-112988865 GCTCAGGGAGGACTTGGGCGTGG - Intronic
1113783366 13:112989028-112989050 GCTCAGGGAGGACTTGGGCGTGG - Intronic
1115772197 14:36676263-36676285 TGTAAGGCGACACTTGGGCTGGG - Exonic
1116123531 14:40752447-40752469 TGTCAGGCAGGGGTTGGGTGAGG - Intergenic
1117309876 14:54510344-54510366 AGCCAGGAAGGGCTTGGGCTTGG + Intronic
1119406320 14:74401813-74401835 TGTGAGGCAAGGCCTGGGCTTGG + Intergenic
1119718303 14:76874246-76874268 TGTATGCCAGGCCTTGGGCTTGG - Intergenic
1120953659 14:90063133-90063155 TGTTAGGCATAACTTGGGTTTGG + Intronic
1121555929 14:94837067-94837089 TGGCAGGTTGAACTTGGGCTTGG + Intergenic
1122178346 14:99937249-99937271 TGTCAGGCAGGAGCTGGACAGGG - Intronic
1122200517 14:100119820-100119842 TGTGAGGCAGAACTTAGGCCAGG + Intronic
1122266997 14:100551208-100551230 TGTGAGGAAGGACATGGGCCCGG + Intronic
1122795812 14:104205679-104205701 TGTCCGGGAGGGCTGGGGCTGGG + Intergenic
1122854779 14:104554804-104554826 AGCCAGGCAGGGCTCGGGCTGGG + Intronic
1124787230 15:32692853-32692875 TGTCAGGCAGTACAGGGGCTTGG - Intronic
1125834144 15:42736000-42736022 GGTGAAGCAGGTCTTGGGCTTGG + Exonic
1127969286 15:63946092-63946114 TGGCAGGCAGGCCCTGGGCTGGG - Intronic
1128025921 15:64436635-64436657 TGTTAGGGAGGAAATGGGCTGGG - Intronic
1128072476 15:64806511-64806533 TGTCAGGCTGGACTGGGGGCTGG - Intergenic
1129341903 15:74891686-74891708 TGTCAGCCTGGATTTGGCCTTGG - Intronic
1129951578 15:79596726-79596748 GGTCAGGCAGGACTGTGGCCTGG - Intergenic
1132201337 15:99956570-99956592 TGCTAGGCAGGACATAGGCTGGG - Intergenic
1132203198 15:99969163-99969185 TGTCAGTCAGAACTTCCGCTAGG - Intergenic
1133730287 16:8572815-8572837 TGTTAGGAAGAACTTGGGATTGG + Intronic
1133792826 16:9022326-9022348 TACCAGGAAGGACTTGGGCTTGG + Intergenic
1133911667 16:10071744-10071766 TGGCAGGCAGGGCTGGTGCTTGG - Intronic
1134017381 16:10898593-10898615 TGTGTGCCAGGCCTTGGGCTGGG - Intronic
1134187004 16:12092238-12092260 TGTCAGGCAGGATTTGGGGGAGG - Intronic
1136398008 16:30003535-30003557 TGTCAGGCCTGAGTTGGACTTGG + Intronic
1136459318 16:30399855-30399877 TATCCACCAGGACTTGGGCTTGG - Exonic
1137560172 16:49497286-49497308 TGTCTGTCAGGCCCTGGGCTGGG + Intronic
1139777363 16:69324801-69324823 TTTGAGGCAGAGCTTGGGCTGGG - Exonic
1139891181 16:70254110-70254132 AGTCAGGGAGGACTTGGGTTCGG - Intronic
1141019250 16:80479610-80479632 TGGCAGGCAGGGTTTGGGGTAGG - Intergenic
1141863859 16:86736364-86736386 TGTCAGGGTGGGCTGGGGCTGGG - Intergenic
1141993544 16:87623234-87623256 TGTCAGCCAGGCCTTGGGGGAGG - Intronic
1142195927 16:88739283-88739305 TGACAGGCCGGCCTGGGGCTGGG + Intronic
1142311703 16:89317911-89317933 TTTCAGGCAGGGCTTGGCCTGGG - Intronic
1142884445 17:2903957-2903979 TCGCTGGCAGGACTTGGGCTGGG + Intronic
1145866402 17:28244710-28244732 TCTCAGGCTGGCCTTGGGTTTGG - Intergenic
1146404695 17:32527154-32527176 TGCAAGGCAGGATTTGGCCTGGG + Intronic
1146645407 17:34573880-34573902 TGACTGGTAGGGCTTGGGCTGGG - Intergenic
1146866251 17:36337512-36337534 TGACTGGGAGAACTTGGGCTGGG - Intronic
1147069121 17:37938124-37938146 TGACTGGGAGAACTTGGGCTGGG - Intergenic
1147080647 17:38017661-38017683 TGACTGGGAGAACTTGGGCTGGG - Intronic
1147096592 17:38141621-38141643 TGACTGGGAGAACTTGGGCTGGG - Intergenic
1148808382 17:50275550-50275572 CGTCAGGGTGGTCTTGGGCTGGG - Intronic
1148989328 17:51651821-51651843 GGGCAGGCAGGATTTGTGCTGGG + Intronic
1149988477 17:61366670-61366692 TGTCAGGTAGGACTTGAGAATGG - Intronic
1151997333 17:77618291-77618313 TGTAAAGCAGGAAGTGGGCTAGG - Intergenic
1152035568 17:77870175-77870197 TGTCCGGCAGCCCCTGGGCTGGG + Intergenic
1152583824 17:81180428-81180450 TGTGGGGCAGGACTGGGCCTCGG - Intergenic
1153545227 18:6197931-6197953 GGTCAGACAGAACTGGGGCTGGG + Intronic
1154351940 18:13590622-13590644 TGTCAGCCAGAACTTGGTTTTGG - Intronic
1155040244 18:22059331-22059353 TGTCATGCAGGAGTAGGGGTAGG - Intergenic
1157197172 18:45629017-45629039 TGGGTGGCAGGACTTAGGCTTGG + Intronic
1157331232 18:46705223-46705245 TGTAGGGCAGGACCAGGGCTTGG + Intronic
1158437515 18:57443679-57443701 TGTCAGGCATTAGATGGGCTGGG - Intronic
1160550422 18:79691449-79691471 TCCCAGGCAGGACTCGGGCTGGG + Intronic
1160785098 19:896641-896663 TATCAGGCAGGAGTCAGGCTGGG + Exonic
1160811266 19:1013943-1013965 TCTCGGGGAGGACTTGGGCTGGG - Intronic
1162954914 19:14092200-14092222 TGGGAGGAAAGACTTGGGCTTGG + Exonic
1163402207 19:17101007-17101029 GGTCAGGAAGGATGTGGGCTGGG + Intronic
1163677624 19:18663191-18663213 TCGCAGGCAGGGCTGGGGCTTGG + Intronic
1165389351 19:35529474-35529496 TGTGAGCCAGAACCTGGGCTGGG + Intergenic
1166381032 19:42355508-42355530 GGTGGGACAGGACTTGGGCTTGG + Intronic
1166702269 19:44888958-44888980 TGGTAGGCAGGAATTGGGGTGGG - Exonic
1166975400 19:46602392-46602414 GGTGGGGGAGGACTTGGGCTTGG + Intronic
1167158849 19:47755064-47755086 TTCCAGGCAGGGCTCGGGCTGGG + Intronic
1168348918 19:55664667-55664689 TGTCAGGCAGGACTTGGGCTAGG + Intronic
925769086 2:7265089-7265111 TCTCAGGCCGGGCTTGGGCATGG - Intergenic
926253932 2:11173687-11173709 TGACAGGCTGGTTTTGGGCTAGG + Intronic
929585379 2:43110732-43110754 TGGCAGGCAGCACTTGCACTGGG + Intergenic
929979604 2:46666212-46666234 TGTCCAGCAGCCCTTGGGCTGGG - Intergenic
932660163 2:73644616-73644638 TGTCAAGCAGGAGTTGGCCTAGG + Intergenic
932666732 2:73704297-73704319 TGTCAAGCAGGAGTTGGCCTAGG + Intergenic
933768776 2:85729810-85729832 TCCCAGGCAGGATGTGGGCTGGG + Intergenic
934474380 2:94583962-94583984 ACTTAGGGAGGACTTGGGCTTGG + Intergenic
934654706 2:96111126-96111148 TGTGTGGCAGGACCTGTGCTGGG - Intergenic
937079496 2:119130209-119130231 AATCAGGCAGGAGTGGGGCTGGG + Intergenic
937261772 2:120591279-120591301 TGGGTGGCAGGACCTGGGCTGGG - Intergenic
938114453 2:128593900-128593922 TGACTGGCAGGACATGGGCCAGG - Intergenic
938286468 2:130121500-130121522 CCTCAGGCAGGCCCTGGGCTCGG - Intronic
938429132 2:131217366-131217388 CCTCAGGCAGGCCCTGGGCTCGG + Intronic
938982905 2:136543523-136543545 TGTATGGCAGGCCTTGTGCTAGG + Intergenic
939713134 2:145548683-145548705 TGACAGGCAGGGCTTGGTTTTGG + Intergenic
939981292 2:148784812-148784834 TGTCAGGCAGGAATTGTTCATGG - Exonic
941614789 2:167707098-167707120 TGTCAACCAGGAGGTGGGCTGGG - Intergenic
941778190 2:169415345-169415367 TGTCAGCCAGGACGTTAGCTGGG + Intergenic
942108803 2:172659782-172659804 AGTCATGCAGGGCTTGGGGTAGG - Intergenic
942250230 2:174040968-174040990 TGTCAGGCTGAGCTTGGACTGGG - Intergenic
945471306 2:210230447-210230469 GGCCAGGAAGGCCTTGGGCTTGG - Intergenic
945858998 2:215099330-215099352 TTGCAGTCAGGATTTGGGCTAGG - Intronic
946128487 2:217585646-217585668 TGTCAGGCAAAATCTGGGCTGGG + Intronic
948156902 2:235790765-235790787 TGTCAGGCAGGCCCTGGCCCCGG + Intronic
948852933 2:240717266-240717288 TGTCTGGCAGGAGAGGGGCTGGG + Exonic
1168802203 20:650819-650841 TGCCAGGCAGGCCTTGTGCCGGG + Intronic
1169876204 20:10299639-10299661 TGTCAGCCAGGCATTGTGCTAGG + Intronic
1171394656 20:24824210-24824232 TGACTGGCAGGTCTTGGGCCAGG - Intergenic
1172050050 20:32110203-32110225 TCTGAGGCAGCGCTTGGGCTGGG - Intronic
1172615381 20:36279991-36280013 TGTCAGGTAGGACCTCAGCTGGG + Intergenic
1173222686 20:41142449-41142471 TGTCAGGCAGGTGTTGGGGAGGG + Intronic
1173422015 20:42909741-42909763 CCTCAGGCAGGAGATGGGCTGGG + Intronic
1176215321 20:63945042-63945064 AATCAGGCAGGAATGGGGCTGGG + Intronic
1180012413 21:45059483-45059505 GGTCAGGCAAGACTTCTGCTTGG - Intergenic
1181103696 22:20558723-20558745 AGTCAGCCAGGATTTGTGCTGGG + Intronic
1181439133 22:22926809-22926831 GGCCAGGCAGGACTAGGTCTGGG - Intergenic
1182263027 22:29089521-29089543 TGACAGGCAGGACCTAGGCAGGG - Intronic
1182309056 22:29391842-29391864 TTTCAGCCAGGCCCTGGGCTGGG + Intronic
1182741345 22:32570198-32570220 TGTCCTGCAGGACTTGGGAGGGG + Intronic
1183355972 22:37359684-37359706 GGTCAGGCAGTACTGGGCCTTGG - Intergenic
1183405505 22:37628718-37628740 TGTCAGGTAGCACTTCGGTTTGG + Intronic
1184179094 22:42807301-42807323 TGTCCCGCAGGACCTGGCCTTGG - Intronic
1184261618 22:43320668-43320690 TTACAAGCAGGACTTGGGCGTGG - Intronic
1184533969 22:45073868-45073890 TGGCAGGCAGGAGCTGTGCTGGG + Intergenic
1185233800 22:49699653-49699675 TGGCCGGCATGACTGGGGCTGGG + Intergenic
949942577 3:9166077-9166099 TGTCAGGGAAGGCTTGGGTTTGG - Intronic
950542230 3:13619463-13619485 TGTCACGCAAGGCATGGGCTGGG + Intronic
950723163 3:14898924-14898946 TGTCAGGCAGGTGTTGGGGAAGG + Intronic
950740124 3:15044117-15044139 TGTGAGGCTGGATTGGGGCTGGG + Exonic
951258024 3:20473594-20473616 TGTCAGGCAACTGTTGGGCTTGG + Intergenic
952496331 3:33919032-33919054 TGGCAGGCAGAATTTGGCCTTGG - Intergenic
953174414 3:40536582-40536604 TGGCAGGCAGCACTTGGGACTGG - Exonic
954313417 3:49787190-49787212 TGTGTGTCAGGACTTGTGCTAGG - Intergenic
954440449 3:50518917-50518939 TGGAAGTCAGGACCTGGGCTAGG + Intergenic
955003396 3:54947697-54947719 TATCAGTCAGGACTCGGTCTTGG + Intronic
955522539 3:59788676-59788698 TGTGAGCCAGGCCCTGGGCTGGG - Intronic
957323068 3:78657135-78657157 TGGCAGCCAGCACTGGGGCTGGG - Exonic
961497498 3:127304995-127305017 TGGCAGGCAGGCTTTGGGCTGGG + Intergenic
961743331 3:129047147-129047169 GCTCAGGGAGGACTTGGGCGCGG + Intergenic
962748531 3:138415966-138415988 TGACAGCCTGAACTTGGGCTGGG - Intergenic
962901455 3:139765495-139765517 TGGCAGGCCGGACTTGGACAAGG - Intergenic
963047288 3:141112081-141112103 TGTCAGTCAGAACCTGGGCTAGG + Intronic
965014582 3:163140469-163140491 TGTCAGGCAGTACTTGTTGTAGG - Intergenic
967513973 3:190345217-190345239 AGGCAGGCAGGATTTTGGCTCGG + Intronic
968691508 4:1992606-1992628 TGTCAGGAAGGCCTGGGGCTGGG - Intronic
968982144 4:3856012-3856034 TCCCAGGCAGGGGTTGGGCTGGG - Intergenic
969506947 4:7594033-7594055 TGTCTGCCAGGACCTGGGCTAGG + Intronic
969509797 4:7611321-7611343 TCTCAGCCAGGACTTGAGCCTGG - Intronic
971089754 4:23327674-23327696 TGTACGGCAGGACTTATGCTAGG - Intergenic
972730282 4:41788105-41788127 CGTGAGGCAGGGCTCGGGCTGGG + Intergenic
973757572 4:54091010-54091032 TGCCAGGCTCTACTTGGGCTTGG - Intronic
973808220 4:54545875-54545897 TGTCAGGCATAGCTTGGGCCTGG - Intergenic
973880846 4:55269693-55269715 TGACAGGCAGGAGTTGGGTGTGG - Intergenic
975608682 4:76182130-76182152 TACCAGGCAGGGCTAGGGCTAGG - Intronic
976848515 4:89517606-89517628 TGTCAGCATGGACTTGGACTTGG + Intergenic
981095629 4:140776687-140776709 TTTGAGGCAGGCCTTGTGCTGGG + Intergenic
983982159 4:174011401-174011423 TGTATGGAAGGATTTGGGCTGGG - Intergenic
985495935 5:205942-205964 TGTCAGGTTGGATTTGGTCTAGG - Exonic
988934349 5:36067286-36067308 TTCCAGGGAGGTCTTGGGCTTGG - Intronic
992232947 5:74681510-74681532 ACTCAGGGTGGACTTGGGCTTGG - Intronic
995403675 5:111769482-111769504 TTTGAGGCAGCACTTGAGCTAGG + Intronic
995869894 5:116733859-116733881 TGCCAAGCGGGGCTTGGGCTTGG + Intergenic
998132418 5:139658099-139658121 GGTCAGGCAGGAGAGGGGCTGGG - Intronic
998160304 5:139809340-139809362 GGTCAGACAGGACTGGGGCTGGG - Intronic
1000107979 5:158078857-158078879 TGTCATGCCTGGCTTGGGCTGGG + Intergenic
1000997846 5:167976711-167976733 AGTCAGGCAATATTTGGGCTTGG + Intronic
1002199777 5:177521215-177521237 TAGCAGGCAGACCTTGGGCTGGG - Intronic
1004737237 6:18419693-18419715 TGGCAGGGAGGAGTTGGGATGGG + Intronic
1005583135 6:27251707-27251729 TGTCCGCCAAGACTTAGGCTGGG - Intronic
1005824971 6:29627341-29627363 TGACTGGCAGGAGATGGGCTGGG - Intronic
1007751216 6:44073132-44073154 AGTCAGCCAGGTCCTGGGCTAGG - Intergenic
1008206967 6:48672148-48672170 TGTCAGGAAGGAATGGGGATAGG - Intergenic
1008615142 6:53219148-53219170 TGACAGACAGCACTTGGACTAGG + Intergenic
1009499105 6:64389502-64389524 TGACAGGCAAGATTTGGCCTAGG - Intronic
1014537942 6:122638752-122638774 TGCCAGGCAGGTCTTGGTCCTGG + Intronic
1017122301 6:151036001-151036023 ACTCAGGGAGGACTTGGACTTGG - Intronic
1017716545 6:157217425-157217447 TGTCTGGCAGGATTAGGGCCCGG + Intergenic
1017959666 6:159210719-159210741 TGTCAGGCAGCACCGGGCCTGGG + Intronic
1017985275 6:159438161-159438183 TGTCAGCCATCACTGGGGCTGGG + Intergenic
1018380630 6:163255268-163255290 TCTCAGGCTGGTCCTGGGCTTGG - Intronic
1018414175 6:163587004-163587026 TTCCAGGCAGGTCTGGGGCTTGG - Intergenic
1019830218 7:3320680-3320702 TGTCAAGCAGGACTTATTCTGGG - Intronic
1022639809 7:32171064-32171086 TGTCAGTCAGGAGGTGGGGTGGG - Intronic
1023572166 7:41583415-41583437 AGCCTGGCAGGACTTGGGTTTGG + Intergenic
1025176205 7:56803704-56803726 TGTGAGGCAGGATTTGGGCCTGG + Intergenic
1025227623 7:57178472-57178494 TGTATGTCAGGACTTGCGCTAGG - Intergenic
1025695588 7:63772718-63772740 TGTGAGGCAGAATTTGGGCCTGG - Intergenic
1025912449 7:65839549-65839571 TGTGAGGCAGGAGGTGGGCCTGG - Intergenic
1025912694 7:65840776-65840798 TGTGAGGCAGGAGCTGGGCCTGG - Intergenic
1026872462 7:73861338-73861360 GGACAGGCAGGGCTTGGGCCCGG - Intronic
1027137880 7:75638076-75638098 TGTCAGGCGGGTCTTGGGAGGGG - Intronic
1027188377 7:75984743-75984765 AGACAGGCAGGACTTGGGGTAGG - Intronic
1028446852 7:90934219-90934241 AGTCAGGCGGGACTTAGGCCAGG + Intronic
1029476647 7:100789016-100789038 TGCAAGGAAGGACTTGGGCTGGG + Intronic
1030955595 7:115848183-115848205 TGTCAACCAGGACCTGGGCTTGG - Intergenic
1034217955 7:149422357-149422379 TGGCAGGCGGGGCTGGGGCTCGG + Intergenic
1035144037 7:156795184-156795206 AGTCAATCTGGACTTGGGCTGGG - Intronic
1035175110 7:157044919-157044941 TGTCAGGCAGGAAATGGGGCTGG - Intergenic
1035459839 7:159031887-159031909 GGTCAGGCAGGACCCGCGCTCGG + Intronic
1038855313 8:31324847-31324869 TGTCATTCAGGACATGGGCATGG - Intergenic
1042405979 8:68406093-68406115 TGTGAAGCAGGATTTGGCCTGGG + Intronic
1042454007 8:68978564-68978586 TGGCAGGCAGGAGTGGGGGTTGG - Intergenic
1045327742 8:101129151-101129173 TCTCATGCAGAACTTGGGATTGG + Intergenic
1047035485 8:120933826-120933848 TGTCTGGCAGGCCTTTAGCTGGG + Intergenic
1047054677 8:121150942-121150964 TGTAAGCCATGACTTGGACTTGG - Intergenic
1048530171 8:135240813-135240835 TGTAGGGCAGCAGTTGGGCTGGG - Intergenic
1049183456 8:141235563-141235585 AGCCAGGCTGGCCTTGGGCTTGG + Intronic
1051064576 9:13087272-13087294 TGTCAGGCAGGACTTTTGTCAGG + Intergenic
1051585342 9:18721356-18721378 TGTCAAGCATCACTTGAGCTGGG - Intronic
1052466274 9:28833872-28833894 GATCAGGCAGACCTTGGGCTGGG - Intergenic
1053397647 9:37788735-37788757 TTTCAGCCAGGAATTGAGCTGGG + Intronic
1053683692 9:40502144-40502166 ACTTAGGGAGGACTTGGGCTTGG - Intergenic
1053933672 9:43130457-43130479 ACTTAGGGAGGACTTGGGCTTGG - Intergenic
1054280024 9:63122782-63122804 ACTTAGGGAGGACTTGGGCTTGG + Intergenic
1054296793 9:63337636-63337658 ACTTAGGGAGGACTTGGGCTTGG - Intergenic
1054394810 9:64642142-64642164 ACTTAGGGAGGACTTGGGCTTGG - Intergenic
1054429458 9:65147342-65147364 ACTTAGGGAGGACTTGGGCTTGG - Intergenic
1054500924 9:65874189-65874211 ACTTAGGGAGGACTTGGGCTTGG + Intergenic
1054761929 9:69012146-69012168 TGTGAAGAAAGACTTGGGCTTGG + Intergenic
1054874730 9:70083728-70083750 TGATAGGCTGGACTTTGGCTTGG - Intronic
1055353369 9:75412392-75412414 AGTCAGGCAGGGGTGGGGCTGGG + Intergenic
1056142067 9:83691683-83691705 TGTCTGTCAGGACTTTGGTTTGG - Intronic
1056953873 9:91067074-91067096 TGGCAGGCAGCACTTGAGCAAGG + Intergenic
1057182646 9:93038182-93038204 TGTCAGGGAGGGACTGGGCTGGG + Intergenic
1057310812 9:93941918-93941940 TGGAAAGCAGGTCTTGGGCTGGG + Intergenic
1059514609 9:114881319-114881341 TGTGGGGCAGGAGTTGGGTTAGG + Intergenic
1060355838 9:122906095-122906117 TGTCAGGCAGGTCCTGTGTTAGG + Intergenic
1060532811 9:124358157-124358179 TCTCAGGCTGGATTTGGGCCTGG - Intronic
1061486183 9:130921590-130921612 AGTCAATCAGGATTTGGGCTGGG - Intronic
1062566463 9:137165972-137165994 TGTCAGGCAGGGAGTGGGGTGGG + Intronic
1189803706 X:44715180-44715202 TGGCAGGCAGGTGTTGTGCTGGG - Intergenic
1190050915 X:47147650-47147672 TGTGAGCCAGGACCTGTGCTAGG + Intronic
1190136612 X:47804563-47804585 AGGCAAGGAGGACTTGGGCTTGG - Intergenic
1190477186 X:50839932-50839954 GATCAGGCAGGACTAGAGCTGGG + Intergenic
1190632491 X:52401296-52401318 TGTCAGGCAGGAGCTGGCCAAGG + Intergenic
1190962380 X:55265212-55265234 TGTAAGGCTGTCCTTGGGCTGGG - Intronic
1191720148 X:64222472-64222494 TGGCAGGCAGGGCTAGGGGTGGG + Intergenic
1194720557 X:97335418-97335440 TGTGAGGTAGGGCTTGGGGTAGG + Intronic
1195462610 X:105144718-105144740 TGGGAGGCAGGACTTGGGGATGG - Intronic
1201467172 Y:14295342-14295364 TGGCAGGCAAGATTTGGCCTGGG + Intergenic
1202380940 Y:24276319-24276341 TGGGAGGCAGGAGCTGGGCTGGG + Intergenic
1202489845 Y:25393807-25393829 TGGGAGGCAGGAGCTGGGCTGGG - Intergenic