ID: 1168348919

View in Genome Browser
Species Human (GRCh38)
Location 19:55664678-55664700
Sequence ACTTGGGCTAGGTCCCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168348912_1168348919 8 Left 1168348912 19:55664647-55664669 CCCAGACGGAGGCACATCTGTGT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1168348919 19:55664678-55664700 ACTTGGGCTAGGTCCCTCACTGG 0: 1
1: 0
2: 1
3: 5
4: 81
1168348911_1168348919 9 Left 1168348911 19:55664646-55664668 CCCCAGACGGAGGCACATCTGTG 0: 1
1: 0
2: 2
3: 10
4: 119
Right 1168348919 19:55664678-55664700 ACTTGGGCTAGGTCCCTCACTGG 0: 1
1: 0
2: 1
3: 5
4: 81
1168348913_1168348919 7 Left 1168348913 19:55664648-55664670 CCAGACGGAGGCACATCTGTGTC 0: 1
1: 0
2: 2
3: 6
4: 81
Right 1168348919 19:55664678-55664700 ACTTGGGCTAGGTCCCTCACTGG 0: 1
1: 0
2: 1
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168348919 Original CRISPR ACTTGGGCTAGGTCCCTCAC TGG Intronic
902433809 1:16384049-16384071 ACTTGGGGTGTGTCCCTCTCTGG + Intronic
904539894 1:31225751-31225773 TCTTGGGCTATGCCCCTCTCAGG + Intronic
907950573 1:59179310-59179332 ACTTGTGTTATGTGCCTCACTGG + Intergenic
920187138 1:204166732-204166754 ACTTTGGCTTTGTCCCTGACTGG + Intergenic
921361181 1:214332410-214332432 ACTGGGGCAAGATCCCTCCCAGG + Intronic
1064342076 10:14496363-14496385 GCTGGGGCTCTGTCCCTCACTGG - Intergenic
1067164863 10:43857233-43857255 CCTTGGGCTGGGTCCATCACTGG - Intergenic
1067758394 10:49024561-49024583 CCTTGGGCCAGTTCCATCACTGG + Intronic
1079400651 11:20103945-20103967 ACTTGGGTGAGGTCACACACTGG + Intronic
1081594767 11:44451700-44451722 ACCTGGGCTAGGCCCATCACAGG + Intergenic
1083305855 11:61761614-61761636 GCCTGGCCGAGGTCCCTCACTGG + Intronic
1084417950 11:69044308-69044330 ATCTGGGCTGTGTCCCTCACCGG - Intergenic
1088536504 11:110867516-110867538 AATTTTGCTAGGTCCCGCACCGG + Intergenic
1090523632 11:127505441-127505463 ACTTGGGCTAGGTATTTCACAGG - Intergenic
1093221807 12:16430390-16430412 ACTTGTGCTAGATCCATCAGAGG + Intronic
1096071643 12:48778657-48778679 ACTTGTCCTGGGTCACTCACAGG - Intronic
1102592022 12:113963675-113963697 ACTTGAGCCAGGTCTCTCCCAGG - Intronic
1110561446 13:76914455-76914477 ACATGGGCTAGGTACAGCACAGG - Intergenic
1112765502 13:102737719-102737741 ACTTGCGCTATCACCCTCACTGG + Exonic
1113268782 13:108649281-108649303 ACTAGGGCCAGGTCCTACACTGG + Intronic
1113335441 13:109372325-109372347 ACTGGGGCCAGGTCCCCCGCGGG + Intergenic
1114612168 14:24050044-24050066 ACATGGGCTAGATCATTCACTGG - Intergenic
1118735392 14:68697250-68697272 CCTTGGGCCTGGTCCCTAACTGG - Intronic
1122388934 14:101367456-101367478 ACTTGAACTGGGTCCCCCACCGG + Intergenic
1125574684 15:40747214-40747236 AGCAGGGCTAGGTCCCTCCCTGG - Intronic
1127981623 15:64039371-64039393 ACCTTGGCTATGTCACTCACTGG + Intronic
1132975009 16:2706752-2706774 ACTTGGGGTAGGGCCCTCTGAGG + Intronic
1136928239 16:34395161-34395183 ACATGGGCTAGGTCCCCCCTGGG - Intergenic
1136976335 16:35016643-35016665 ACATGGGCTAGGTCCCCCCTGGG + Intergenic
1137780028 16:51089966-51089988 ACTTGTGATAGGTCACTCCCTGG - Intergenic
1139024945 16:62805184-62805206 AGTTGGGCAAGGTCCCTGGCTGG + Intergenic
1149200536 17:54180948-54180970 ACATGGACCAGGTCCTTCACTGG - Intergenic
1151027514 17:70696075-70696097 ACTTTGGCCAGGTCCATCAGAGG - Intergenic
1152351516 17:79786252-79786274 ACTTGGGCAGGGCCCCACACAGG - Exonic
1163332008 19:16645375-16645397 ATCTTGGCTGGGTCCCTCACAGG - Exonic
1163466177 19:17469817-17469839 ACTTGGGCTAGGCCCGGAACTGG + Intronic
1164598306 19:29544795-29544817 ACATGGGCCAGGTCCTTCAAAGG - Intronic
1164643492 19:29842972-29842994 ACTTGCGCAAGGTCCCACATGGG + Intergenic
1168078602 19:53993403-53993425 ATATGGCCCAGGTCCCTCACGGG + Intronic
1168348919 19:55664678-55664700 ACTTGGGCTAGGTCCCTCACTGG + Intronic
925823747 2:7825781-7825803 ACAGGGGCCAGGACCCTCACTGG + Intergenic
941181407 2:162263585-162263607 ACTTGGGTTTGGATCCTCACTGG - Intergenic
945914232 2:215685774-215685796 CATAGGGCAAGGTCCCTCACAGG - Intergenic
946105822 2:217368483-217368505 ACTTGGGCCAAGTACCTCAGAGG - Intronic
946806214 2:223473614-223473636 ACTTGAGCAAGGTAGCTCACTGG + Intergenic
1178275312 21:31231460-31231482 AATTGGGCTGGGGTCCTCACAGG - Intronic
1181170085 22:21003122-21003144 ACTTTGGCCAGGTCTCCCACAGG + Intergenic
1183292648 22:37012320-37012342 ATTTGGCCGAGGGCCCTCACTGG - Intronic
950638729 3:14334146-14334168 ACTTCGGCCAGGTACCCCACAGG + Intergenic
952031150 3:29144188-29144210 ACTAGGTCTTGGTTCCTCACTGG + Intergenic
953022026 3:39120756-39120778 ACAGGGGATAGGTCCCTCAGAGG + Intronic
953180545 3:40590471-40590493 ACTTAGGCTCAGTCCCTCTCGGG - Intergenic
953503013 3:43456093-43456115 ACTTGGGCTGGCTCCCACCCTGG + Intronic
953756700 3:45652749-45652771 ACTTTGGTTAGTTTCCTCACAGG + Intronic
961468751 3:127098086-127098108 CATAGGGCTAGGTGCCTCACTGG + Intergenic
962341690 3:134591021-134591043 TCTTGGTCTCTGTCCCTCACTGG + Intergenic
969135399 4:5025059-5025081 ACTTGGGCCAGGTCCTCCCCAGG + Intergenic
982072372 4:151706529-151706551 ACATGGGCTATGTCCCTTTCCGG + Intronic
990630388 5:57662402-57662424 ACTGGTGCCAGGGCCCTCACTGG + Intergenic
997264677 5:132488282-132488304 ACATGTGCTAGGACCCACACAGG + Intronic
997423563 5:133787680-133787702 ACTTGGGCCAGGCCCATCAGAGG + Intergenic
998696560 5:144647156-144647178 ACTTAGCCTTGGTCACTCACTGG + Intergenic
999257492 5:150217719-150217741 CCCTGGGCTAGGTCCCTCCATGG - Intronic
999453157 5:151693733-151693755 ACTTGGTCAAGGTCCCACAGTGG + Intergenic
1000301701 5:159962493-159962515 ACCAGTGCGAGGTCCCTCACAGG - Intronic
1001279928 5:170379376-170379398 ACTTGGCCTGTGTCCCTCCCTGG - Intronic
1004442280 6:15664947-15664969 ACTTGTGCTACTTACCTCACTGG - Intergenic
1007735611 6:43980450-43980472 ATTTGGGCTGGGTCCCAAACAGG - Intergenic
1013209612 6:107974700-107974722 ACCAGAGCTTGGTCCCTCACAGG - Intergenic
1019407058 7:889373-889395 ACTTGGGCTATGTGCTTCCCTGG + Intronic
1021146841 7:17099654-17099676 ACTTTGGCAAGGTCACTAACAGG - Intergenic
1022536141 7:31099813-31099835 GCCTGGGCTAGGTCTCACACAGG - Intronic
1026856490 7:73758607-73758629 ACTTGGTCAAGGTCCCACAGTGG + Intergenic
1029487448 7:100852364-100852386 ACCTGGGCCAGGTGCGTCACGGG - Intronic
1031121728 7:117729855-117729877 ACTTCAGCTGGGTCTCTCACAGG + Intronic
1033597444 7:142867560-142867582 AGGTGGGCCAGGTCTCTCACAGG - Intronic
1035169361 7:157009254-157009276 ACTTGGGCCAGGTCCCCCACTGG - Intronic
1035353273 7:158261411-158261433 GCTTGGGCTGGGTCCCTGCCAGG - Intronic
1038347544 8:26746094-26746116 ACTGGGGCTGGGTCTCTCATTGG + Intergenic
1039359217 8:36857377-36857399 ACTGAGGCTGTGTCCCTCACAGG + Intronic
1041125010 8:54627847-54627869 AATTGGGCAAGCTCCCTCATAGG - Exonic
1047013237 8:120695146-120695168 GATTGGGCTAAGTCCCTCACAGG + Intronic
1052834550 9:33240769-33240791 ACTTGGGGCAGGGCCCTCTCAGG + Intronic
1055733411 9:79302739-79302761 ACTTGGCCACTGTCCCTCACTGG + Intergenic
1060269163 9:122128776-122128798 AGATGGCCTGGGTCCCTCACAGG - Intergenic
1060748302 9:126152152-126152174 CCTTAGGTTAGGTGCCTCACTGG + Intergenic
1062209733 9:135357044-135357066 CCCTGGGCTAGGTCCCTCCCCGG - Intergenic
1198058564 X:133020588-133020610 GCATGGGGTAGGTCCCTCTCTGG + Intergenic