ID: 1168349983

View in Genome Browser
Species Human (GRCh38)
Location 19:55670154-55670176
Sequence CCTTCCACGATGGGGCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 156}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168349983_1168349993 -6 Left 1168349983 19:55670154-55670176 CCCCTGAGCCCCATCGTGGAAGG 0: 1
1: 0
2: 0
3: 8
4: 156
Right 1168349993 19:55670171-55670193 GGAAGGAGACAGGCACAGCGGGG 0: 1
1: 0
2: 4
3: 62
4: 546
1168349983_1168349992 -7 Left 1168349983 19:55670154-55670176 CCCCTGAGCCCCATCGTGGAAGG 0: 1
1: 0
2: 0
3: 8
4: 156
Right 1168349992 19:55670170-55670192 TGGAAGGAGACAGGCACAGCGGG 0: 1
1: 0
2: 5
3: 53
4: 594
1168349983_1168349991 -8 Left 1168349983 19:55670154-55670176 CCCCTGAGCCCCATCGTGGAAGG 0: 1
1: 0
2: 0
3: 8
4: 156
Right 1168349991 19:55670169-55670191 GTGGAAGGAGACAGGCACAGCGG 0: 1
1: 2
2: 10
3: 125
4: 948
1168349983_1168349996 8 Left 1168349983 19:55670154-55670176 CCCCTGAGCCCCATCGTGGAAGG 0: 1
1: 0
2: 0
3: 8
4: 156
Right 1168349996 19:55670185-55670207 ACAGCGGGGGTGGCTCACACTGG 0: 1
1: 0
2: 0
3: 10
4: 230
1168349983_1168349998 19 Left 1168349983 19:55670154-55670176 CCCCTGAGCCCCATCGTGGAAGG 0: 1
1: 0
2: 0
3: 8
4: 156
Right 1168349998 19:55670196-55670218 GGCTCACACTGGCAGGTTTCAGG 0: 1
1: 0
2: 0
3: 12
4: 145
1168349983_1168349994 -5 Left 1168349983 19:55670154-55670176 CCCCTGAGCCCCATCGTGGAAGG 0: 1
1: 0
2: 0
3: 8
4: 156
Right 1168349994 19:55670172-55670194 GAAGGAGACAGGCACAGCGGGGG 0: 1
1: 0
2: 3
3: 59
4: 403
1168349983_1168349995 -2 Left 1168349983 19:55670154-55670176 CCCCTGAGCCCCATCGTGGAAGG 0: 1
1: 0
2: 0
3: 8
4: 156
Right 1168349995 19:55670175-55670197 GGAGACAGGCACAGCGGGGGTGG 0: 1
1: 0
2: 0
3: 58
4: 499
1168349983_1168349999 26 Left 1168349983 19:55670154-55670176 CCCCTGAGCCCCATCGTGGAAGG 0: 1
1: 0
2: 0
3: 8
4: 156
Right 1168349999 19:55670203-55670225 ACTGGCAGGTTTCAGGTTCTCGG 0: 1
1: 0
2: 0
3: 20
4: 170
1168349983_1168349997 12 Left 1168349983 19:55670154-55670176 CCCCTGAGCCCCATCGTGGAAGG 0: 1
1: 0
2: 0
3: 8
4: 156
Right 1168349997 19:55670189-55670211 CGGGGGTGGCTCACACTGGCAGG 0: 1
1: 0
2: 1
3: 12
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168349983 Original CRISPR CCTTCCACGATGGGGCTCAG GGG (reversed) Intronic
900080891 1:856556-856578 GCTTCCTCCCTGGGGCTCAGTGG + Intergenic
900192086 1:1356112-1356134 CCCACCACGAGGGGCCTCAGGGG - Intronic
901855172 1:12039733-12039755 ACTTCCACCATGGGAGTCAGGGG - Intergenic
902763216 1:18597919-18597941 CCTTCCAGAATTGGGCCCAGTGG + Intergenic
903045809 1:20563432-20563454 CCCCCCATGATGGGCCTCAGGGG + Intergenic
905297654 1:36964312-36964334 GCTGCCAGGCTGGGGCTCAGGGG - Intronic
912414551 1:109499123-109499145 CCAGCCATGATGGGGCTCAGAGG - Intronic
912559345 1:110538891-110538913 CTTTCCACCATAGGACTCAGGGG - Intergenic
915025457 1:152825864-152825886 CCTTTCTCCACGGGGCTCAGGGG - Intergenic
1062879316 10:965245-965267 TCTCCCACGGTGGTGCTCAGCGG + Intergenic
1063676350 10:8143633-8143655 CCTTCCAAGATGGTGCCCAAAGG + Intergenic
1064432809 10:15285792-15285814 CCTTCCAGAGTGGGGCTCAGTGG + Intronic
1064497100 10:15922130-15922152 CCTTACACTTTGGGGATCAGGGG + Intergenic
1065244255 10:23741666-23741688 ACTCCCAGGATGGGGGTCAGTGG + Intronic
1065351089 10:24796373-24796395 GCTTCCAGGTTGGGGCACAGTGG + Intergenic
1067740808 10:48895019-48895041 CCTACCACAATGCGGCTTAGAGG + Intronic
1068721994 10:60255883-60255905 CCTTCCTCACTGGGGCCCAGAGG + Intronic
1070685260 10:78475854-78475876 TCTCCCATGATGGGGCCCAGTGG - Intergenic
1077283938 11:1757655-1757677 CCACACACGATGGGGCCCAGAGG + Intronic
1077488915 11:2851519-2851541 CCTGCCAAGATGGTGCTCAGAGG - Intergenic
1080195382 11:29602341-29602363 CCTTCCACAATGAGACTCTGAGG + Intergenic
1083147330 11:60769101-60769123 CCTGGCAGGAGGGGGCTCAGAGG - Intronic
1083535559 11:63463836-63463858 GCTTCCAGTGTGGGGCTCAGAGG + Intronic
1085068639 11:73521431-73521453 CCTTCCACCCTTGGGCTCAGTGG - Intronic
1086922624 11:92604744-92604766 CATGCCAGGAAGGGGCTCAGAGG - Intronic
1088476881 11:110249832-110249854 CCTGCCAGGCTGGGGCACAGTGG - Intronic
1090502530 11:127275469-127275491 CCTTCCAGGCTGGGGGTCATGGG + Intergenic
1091668900 12:2438482-2438504 TCCTCCACGATGCAGCTCAGTGG - Intronic
1095743613 12:45633459-45633481 CCTCCCTCGATGGAGCCCAGAGG - Intergenic
1096402110 12:51315923-51315945 CCTTCCAAGATGGGGGTTATAGG - Intronic
1097322083 12:58236998-58237020 CCTCCCACCATAAGGCTCAGAGG - Intergenic
1102536796 12:113587850-113587872 CCTTTCTCGCTGGGGCTCAGCGG - Intergenic
1105239792 13:18598947-18598969 GCCTCCAGGATGGGGCTGAGCGG + Intergenic
1112721409 13:102250099-102250121 CCTTCCATGATGGTGCTTTGAGG - Intronic
1113731148 13:112642351-112642373 CTCTCCAAGATGGGACTCAGAGG - Intergenic
1114065170 14:19054027-19054049 GCCTCCAGGATGGGGCTGAGCGG + Intergenic
1114097093 14:19345975-19345997 GCCTCCAGGATGGGGCTGAGCGG - Intergenic
1115513107 14:34157867-34157889 GGTTCCAGGGTGGGGCTCAGTGG - Intronic
1118447174 14:65862500-65862522 ACTTCTGCGAAGGGGCTCAGAGG + Intergenic
1121219054 14:92272152-92272174 ACTTCCACCCTGAGGCTCAGTGG - Intergenic
1121630350 14:95417353-95417375 TCTTCCACGTTGCAGCTCAGAGG + Intronic
1122894490 14:104749606-104749628 CCTTCCCTGATGGGGCTCTGGGG - Intergenic
1123228446 15:17074672-17074694 CATTTCACCATGGGCCTCAGTGG + Intergenic
1123491453 15:20785140-20785162 GCCTCCAGGATGGGGCTGAGCGG - Intergenic
1123547955 15:21354231-21354253 GCCTCCAGGATGGGGCTGAGCGG - Intergenic
1126792490 15:52233854-52233876 CCTTCTGGGGTGGGGCTCAGAGG - Intronic
1129737889 15:77975986-77976008 CCTTCTCCGATGGGTCTCACAGG + Intergenic
1202956285 15_KI270727v1_random:81461-81483 GCCTCCAGGATGGGGCTGAGCGG - Intergenic
1133169223 16:3970774-3970796 CCAGCCAGGATGGGGCCCAGGGG - Intronic
1133833503 16:9345909-9345931 CCTTCCACAAAGGGGACCAGAGG + Intergenic
1139590180 16:67928989-67929011 CCTTCCAGCTTGAGGCTCAGTGG - Exonic
1141193681 16:81843114-81843136 TCTTGCATGGTGGGGCTCAGTGG - Intronic
1145270467 17:21402000-21402022 TCTTCGTCGATGGCGCTCAGAGG - Intronic
1145308677 17:21689397-21689419 TCTTCGTCGATGGCGCTCAGAGG - Intergenic
1145944266 17:28761181-28761203 CCTCCCATCAGGGGGCTCAGCGG + Intronic
1147129496 17:38398532-38398554 CCTTTCCCAATGGGGCACAGTGG - Intronic
1147229910 17:39010012-39010034 GCTTCCATGATGGGGCTTTGGGG - Intergenic
1147469768 17:40648255-40648277 CCCTCCAGGAGCGGGCTCAGCGG - Exonic
1148593667 17:48835465-48835487 CCTTCCCAGAAGGGACTCAGAGG - Intronic
1150607628 17:66707762-66707784 CCCTCCACTATGAGGGTCAGGGG - Intronic
1153444645 18:5157491-5157513 CCTCTCACCATGGGCCTCAGGGG + Intronic
1153508842 18:5831298-5831320 ACTTCCACTCTGGGCCTCAGAGG + Intergenic
1154449037 18:14459827-14459849 GCCTCCAGGATGGGGCTGAGCGG - Intergenic
1157469908 18:47981277-47981299 CCTTCCTCTATGAGGCTCAAAGG - Intergenic
1159943563 18:74426839-74426861 CATTTCAGGATGGGGCACAGGGG + Intergenic
1160888315 19:1362847-1362869 CCTTCCACGTAGATGCTCAGGGG - Intronic
1161708740 19:5835134-5835156 CCTTCAAAGCTGAGGCTCAGTGG - Intronic
1162605887 19:11707688-11707710 ACTTCCAAGATGTGGCCCAGGGG - Intergenic
1163371541 19:16903912-16903934 GCTTCCAAGACGGGGTTCAGGGG - Intronic
1166000567 19:39875288-39875310 TCCTCCTCCATGGGGCTCAGGGG - Intronic
1166003365 19:39891543-39891565 TCCTCCTCCATGGGGCTCAGGGG - Intronic
1166822999 19:45591946-45591968 CCTCCAAGGAAGGGGCTCAGGGG - Exonic
1168349983 19:55670154-55670176 CCTTCCACGATGGGGCTCAGGGG - Intronic
929443730 2:41986755-41986777 CTTTCTACGAGGTGGCTCAGAGG + Intergenic
931159844 2:59676859-59676881 CCTTTCCCTATGGGACTCAGTGG - Intergenic
932340071 2:70958077-70958099 CCCTCCCAGATGGGACTCAGAGG + Exonic
932682338 2:73836698-73836720 TCTTCCTCCCTGGGGCTCAGAGG + Intronic
933575660 2:84064072-84064094 CCTGCCATGATGGGGCTCCAGGG - Intergenic
936824240 2:116561347-116561369 ACTTCCAAAATGGGTCTCAGTGG - Intergenic
938482425 2:131673029-131673051 GCCTCCAGGATGGGGCTGAGCGG + Intergenic
943502980 2:188715209-188715231 CCTTCCAGGATGGAGTGCAGTGG - Intergenic
943920427 2:193699920-193699942 CCTGCCATGATGGGGCTCTGGGG - Intergenic
945065772 2:205946561-205946583 CCTGCCAGGATGGTGCTCGGAGG - Intergenic
946472789 2:219978266-219978288 CCTTCCACCATGGTGACCAGAGG - Intergenic
948243873 2:236462014-236462036 CCTTACAGGATGGGGCCCAAGGG - Intronic
1168935852 20:1664842-1664864 CCTTCCACGCAGGCACTCAGAGG + Intergenic
1168965079 20:1894195-1894217 CCTTCAGCTTTGGGGCTCAGAGG + Exonic
1171528455 20:25834764-25834786 CCATCCACGCTGGAGCGCAGTGG + Intronic
1171548371 20:26021122-26021144 CCATCCACGCTGGAGCGCAGTGG - Intergenic
1171566692 20:26199738-26199760 CCTTCCATCATGGTCCTCAGAGG + Intergenic
1171734111 20:28749980-28750002 CATTTCACCATGGGCCTCAGTGG - Intergenic
1171739274 20:28842588-28842610 TCTTCCACCATAGGGCTCATAGG - Intergenic
1171742300 20:28913021-28913043 CATTTCACCATGGGCCTCAGTGG - Intergenic
1171757997 20:29133841-29133863 TCTTCCACCATAGGGCTCATAGG - Intergenic
1171763233 20:29232372-29232394 CATTTCACCATGGGCCTCAGTGG + Intergenic
1172027655 20:31960075-31960097 GCTTCCTCGAAGGTGCTCAGGGG + Intergenic
1172510971 20:35500806-35500828 TCTTCCAGGATGGGCCTCAAAGG - Intronic
1173646302 20:44635197-44635219 CCTTCCTCGCTGGGGAACAGGGG + Intronic
1174212369 20:48890112-48890134 CCTTCCTCCATGGGCTTCAGGGG + Intergenic
1175988184 20:62774676-62774698 CCTTCCAGGCAGGGGCTGAGGGG + Intergenic
1176127355 20:63482002-63482024 CCTCCCACCGTGGGACTCAGTGG + Intergenic
1176196228 20:63837332-63837354 CCTTCCAGGATGGGACATAGTGG + Intergenic
1176325247 21:5391019-5391041 CATTTCACCATGGGCCTCAGTGG + Intergenic
1176482803 21:7321435-7321457 CATTTCACCATGGGCCTCAGTGG + Intergenic
1176761957 21:10807477-10807499 CATTTCACCATGGGCCTCAGTGG + Intergenic
1176763117 21:12980374-12980396 CTTACCACTATGGGCCTCAGTGG + Intergenic
1177188301 21:17821597-17821619 CCTCCAACGCTGGGGATCAGTGG + Intergenic
1179382202 21:40910245-40910267 GCTGCCACGATGGCTCTCAGTGG + Intergenic
1180131612 21:45830345-45830367 CCTCCCATGGAGGGGCTCAGAGG - Intronic
1180483660 22:15776647-15776669 GCCTCCAGGATGGGGCTGAGCGG + Intergenic
1181729264 22:24832824-24832846 CCTTCCCTCATGGAGCTCAGAGG - Intronic
1182469910 22:30542243-30542265 CCTTCAGCTTTGGGGCTCAGAGG + Intronic
1182537435 22:31015503-31015525 GCTTCCATGATGGGGAACAGTGG - Intergenic
1183280056 22:36927275-36927297 CCTTCCCGAATGGAGCTCAGGGG + Intronic
1183650772 22:39152290-39152312 CCCTCCACGCTGGGGCTGAAGGG - Intronic
1184743378 22:46442221-46442243 CCCTCCAGGACGGGGCTCTGGGG + Intronic
1184978716 22:48081230-48081252 CATTCCACGTTGTGGCTCTGGGG - Intergenic
950833436 3:15897629-15897651 CCTTCCGTGATGGAGCACAGTGG + Intergenic
968654525 4:1772790-1772812 CCTTCCATCAGGGGGCCCAGAGG - Intergenic
975529411 4:75385480-75385502 CCTTTCATGTTGGGTCTCAGTGG + Intergenic
978149966 4:105422001-105422023 CCTTCCATGATGGAGTGCAGTGG - Intronic
981844086 4:149146548-149146570 CCTTCCTCGATCTGTCTCAGGGG - Intergenic
983212984 4:164977576-164977598 CCTTCCTCGCGGGGGCTCGGTGG - Exonic
984401180 4:179267148-179267170 CCTTCCAGGCTGGAGCACAGTGG + Intergenic
985922541 5:2990058-2990080 GCATCCCCGTTGGGGCTCAGTGG - Intergenic
988496879 5:31752841-31752863 CCAACCACTATGGGGTTCAGAGG - Intronic
989283278 5:39669340-39669362 ACTTCCACTCTGGGACTCAGGGG - Intergenic
999621749 5:153481027-153481049 TTTTCCACGATGTAGCTCAGTGG - Intergenic
1013631855 6:111993478-111993500 CCTGCCACGTGGGGGCTGAGAGG + Intergenic
1016105551 6:140157977-140157999 CCTTCCAGGATGGAGTGCAGTGG + Intergenic
1018129545 6:160715965-160715987 CCTTCCTCAGTGGGGCCCAGTGG - Intronic
1020098813 7:5382935-5382957 CCACCCAGGTTGGGGCTCAGTGG + Intronic
1021869623 7:24991616-24991638 CCTTCTTCAATGGGGCTCAAGGG - Intergenic
1021950227 7:25767002-25767024 CCTGCCATGACCGGGCTCAGAGG + Intergenic
1022647477 7:32244826-32244848 TCCTCAAAGATGGGGCTCAGAGG + Intronic
1025499629 7:61269436-61269458 CCTTCCACAATAGGACTCAAAGG - Intergenic
1025514479 7:61615645-61615667 CCTTCCACAATAGGACTCAAAGG - Intergenic
1025538826 7:62044485-62044507 CCTTCCACAATAGGACTCAAAGG - Intergenic
1025610132 7:63070793-63070815 CCTACTGGGATGGGGCTCAGCGG + Intergenic
1029658607 7:101944182-101944204 CCTTCCAGAAAGGGGCGCAGTGG + Intronic
1035524377 8:300906-300928 GCTTCCTCCCTGGGGCTCAGTGG - Intergenic
1035783347 8:2245540-2245562 CTTTGCACGCTGGGACTCAGAGG - Intergenic
1035808776 8:2474046-2474068 CTTTGCACGCTGGGACTCAGAGG + Intergenic
1036993441 8:13627088-13627110 CCTTCCTGGGTGGGACTCAGGGG - Intergenic
1039081043 8:33734213-33734235 CCTTCCAGGTTGGAGATCAGAGG + Intergenic
1041094019 8:54331473-54331495 CCTTCCTCTAGGGTGCTCAGAGG - Intergenic
1044830263 8:96240702-96240724 GGTTCCCCGATGAGGCTCAGAGG + Intronic
1049807764 8:144548599-144548621 CCTTCCTCGCTGGGGCCCTGTGG + Intronic
1053302659 9:36962899-36962921 CATGCCACGCTGGGGCTCACAGG + Intronic
1057941568 9:99289624-99289646 CCCTCCAGGATGGGGCTGAGAGG - Intergenic
1058966988 9:110048088-110048110 ACTCCCCCGATGGGGTTCAGAGG - Intronic
1060853879 9:126899581-126899603 CTTTCCACTATGGGGCTCTAGGG - Intergenic
1061090122 9:128421458-128421480 CCTGCCACGTTGGGCCCCAGTGG - Intronic
1062227474 9:135461023-135461045 CCTTCCACGCCGATGCTCAGAGG - Intergenic
1062230303 9:135478919-135478941 CCTTCCACGAGTGGGCGCTGAGG + Intergenic
1062439784 9:136564517-136564539 GCTTCCAGGAAGGGGCACAGCGG + Intergenic
1203420591 Un_KI270371v1:240-262 CCTTCCACAATAGGACTCAAAGG - Intergenic
1203358741 Un_KI270442v1:192357-192379 CATTTCACCATGGGCCTCAGTGG + Intergenic
1203373154 Un_KI270442v1:332529-332551 TTTTCCACCATGGGGCTCAAAGG - Intergenic
1203402566 Un_KI270519v1:125824-125846 CATTTCACCATGGGCCTCAGTGG + Intergenic
1203409959 Un_KI270587v1:2861-2883 TCTTCCACCATAGGGCTCATAGG + Intergenic
1187795556 X:23000063-23000085 TCTTCCACTCTGGGGCCCAGTGG - Exonic
1189922892 X:45920792-45920814 TCATCCAGGATGGAGCTCAGTGG + Intergenic
1191259833 X:58304987-58305009 GCTTCCACTATAGGCCTCAGTGG - Intergenic
1198764245 X:140064704-140064726 CCTTCCTCCATGGGACTCACTGG + Intergenic