ID: 1168351452

View in Genome Browser
Species Human (GRCh38)
Location 19:55678484-55678506
Sequence CTGGAAACACAAATGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 1, 2: 1, 3: 33, 4: 282}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168351452_1168351457 3 Left 1168351452 19:55678484-55678506 CCATGTCCCATTTGTGTTTCCAG 0: 1
1: 1
2: 1
3: 33
4: 282
Right 1168351457 19:55678510-55678532 TCCTCTTCCCCTCGCAGATGCGG 0: 1
1: 0
2: 0
3: 24
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168351452 Original CRISPR CTGGAAACACAAATGGGACA TGG (reversed) Intronic
900830403 1:4961245-4961267 CTGGACCCCCAAAGGGGACAGGG + Intergenic
905636017 1:39553027-39553049 TTGGAAACACAATAGGTACATGG + Intergenic
907268460 1:53276701-53276723 CTGCAAAGACAAATCGGACGAGG - Exonic
907907702 1:58799494-58799516 ATGGAGACACTACTGGGACAGGG + Intergenic
909258771 1:73459644-73459666 ATGAAAACAGAAATGGCACATGG + Intergenic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
911984055 1:104599619-104599641 ATGGAAAGAGAAATGGGAAAAGG - Intergenic
912630215 1:111240319-111240341 TTGGCAACAAGAATGGGACATGG + Intronic
913423394 1:118698774-118698796 CTGGAAAAAAAAATGCCACAAGG + Intergenic
916090445 1:161304864-161304886 CAGGAAAAACAAATGGGAAATGG - Exonic
916556738 1:165899962-165899984 CTGGAAAAGCAAATGGGGAATGG - Intronic
916675042 1:167058353-167058375 CTGGAAACACCAAGAGGACAGGG - Intronic
916682163 1:167114606-167114628 GTGGAGACCCAAATGGGTCAGGG - Intronic
917198145 1:172488117-172488139 ATGGAATCAAAAATGGGAGAGGG + Intergenic
917387913 1:174497533-174497555 CCAGAAAACCAAATGGGACAAGG - Intronic
918259711 1:182784534-182784556 ATAGAAACAGAAATGAGACATGG - Intergenic
918465832 1:184820573-184820595 GTGCATACACGAATGGGACATGG - Intronic
918646623 1:186913860-186913882 CTGCAACCACATGTGGGACAGGG - Intronic
919313724 1:195945852-195945874 CTGGAAATGCTAATGGGATAAGG + Intergenic
920372288 1:205486737-205486759 CTGGAAGAAGAAATGGAACAAGG - Intergenic
922808849 1:228404790-228404812 CTGGACACAGAAATGGGATTGGG - Intronic
1062907073 10:1186443-1186465 CAGGAGGCACCAATGGGACAAGG - Intronic
1063010734 10:2019791-2019813 CTAGAAATACAAATGAGCCAGGG - Intergenic
1063423810 10:5935832-5935854 CTGGAAACACCACAAGGACAGGG - Intronic
1063441644 10:6077799-6077821 TTGGCATCACAAATGGCACAAGG + Intergenic
1063498284 10:6530092-6530114 CTGGATATGCATATGGGACAGGG + Intronic
1063616256 10:7602960-7602982 TTGGTAAGACAAATAGGACACGG - Intronic
1064919701 10:20503183-20503205 CTGGCACAACAATTGGGACATGG + Intergenic
1065914287 10:30339632-30339654 CTGTAAGTACAAATGGGGCATGG + Intronic
1066754397 10:38696317-38696339 GTGGAAACACACAGGAGACAGGG + Intergenic
1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG + Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074860622 10:117507296-117507318 GTGGAATCAGAAATGGCACAGGG - Intergenic
1077866214 11:6223720-6223742 CTCGATGCACAAAAGGGACAAGG + Exonic
1078430146 11:11281989-11282011 CTGGGAACACATCTGGGATATGG + Intronic
1078469976 11:11578938-11578960 CTGGAAACCCAAAAGGGATGGGG + Intronic
1079395791 11:20062242-20062264 ATGGAACCAAAAAGGGGACAGGG - Intronic
1079549360 11:21674850-21674872 CGGGAAACACAAAGGGGTCAGGG - Intergenic
1079720572 11:23806909-23806931 CTGTTAACAGAAAAGGGACAGGG - Intergenic
1079966796 11:26989909-26989931 CTAGAAACCCAAAGGGGAGATGG - Intergenic
1081974967 11:47227822-47227844 CTTGATACACAAATGTGACAAGG - Intronic
1083428066 11:62599435-62599457 CTGGAAACCCTAAAGGGCCAAGG + Intronic
1086725791 11:90182285-90182307 CTGAAAAAATAAATGTGACATGG - Intronic
1086814828 11:91356877-91356899 TTGGAAAGACAACTGAGACAGGG - Intergenic
1087893138 11:103557736-103557758 ATGGAAATGAAAATGGGACAGGG + Intergenic
1089125556 11:116174199-116174221 AAGGAAACACAAATGGCAGAGGG - Intergenic
1090628776 11:128628078-128628100 CTTGACGCACAGATGGGACATGG - Intergenic
1090817987 11:130315185-130315207 GAGGAAGGACAAATGGGACAGGG - Intergenic
1091352605 11:134909120-134909142 CAGGAAACACAAATGAAAGATGG - Intergenic
1092913034 12:13164962-13164984 CTTGAAACACAAGAGGGAAACGG + Intergenic
1094201718 12:27801662-27801684 CTGGAAGCACCAATCTGACATGG - Exonic
1095710225 12:45280255-45280277 ATGGAAAGACAAAGTGGACATGG + Intronic
1096889302 12:54750669-54750691 CTGGAAAGACAAATAGGAGTAGG - Intergenic
1098862343 12:75724197-75724219 ATGGAAACACATATGGGGAAAGG - Intergenic
1099170572 12:79359225-79359247 CTGGAAACCCATATGGTAAAGGG + Intronic
1099400730 12:82200548-82200570 GTGGAAACAAAACAGGGACATGG - Intergenic
1099517521 12:83615959-83615981 CTGAAGGCACAAATGTGACATGG - Intergenic
1102228850 12:111248493-111248515 CTGGAAGCAGAAGTAGGACAAGG + Intronic
1102520423 12:113474698-113474720 CTGGAAACACACACCAGACAGGG - Intergenic
1102634488 12:114311304-114311326 CTGAAAAGACAAACAGGACATGG + Intergenic
1103713686 12:122930741-122930763 ATGGAAACACCATGGGGACAAGG + Intronic
1104280524 12:127372469-127372491 CTGGAAAAACACATGGGACTTGG - Intergenic
1106360343 13:29025587-29025609 CTGGAAGCACAATTAGGTCAGGG + Exonic
1108023027 13:46148323-46148345 CTCCAAACACAACTGGGACCTGG + Intronic
1108238285 13:48432241-48432263 CTGGAAATACAGATTGGAGAAGG - Intronic
1109493140 13:63130051-63130073 CTATAATCACAAATGGGACTAGG + Intergenic
1110143545 13:72160946-72160968 ATGAAAACACTCATGGGACATGG + Intergenic
1111597761 13:90433166-90433188 TTGAAAAAACAAATGGGAGAGGG - Intergenic
1113433298 13:110268723-110268745 CTCTTAACACAACTGGGACAAGG + Intronic
1113777360 13:112955395-112955417 CTGAACACAAAAATGGGCCATGG - Intronic
1114421210 14:22584798-22584820 TGGGAAACACAAATTGTACATGG + Intronic
1115368768 14:32588424-32588446 AGGCAGACACAAATGGGACAAGG - Intronic
1115879484 14:37899162-37899184 CAGGAAGCACAAATGCCACATGG - Intronic
1118087736 14:62437911-62437933 CTGGAACAACTAATGGGTCAAGG - Intergenic
1119249187 14:73137269-73137291 CAAGAAACACTAACGGGACATGG + Intronic
1120040773 14:79750462-79750484 CTAAATTCACAAATGGGACAAGG - Intronic
1120329883 14:83078714-83078736 TTGGAAACACAAATAGGAAAAGG + Intergenic
1123166917 14:106334475-106334497 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123169532 14:106359186-106359208 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123693678 15:22861144-22861166 CTGGAAAAACAAATTATACAGGG - Intronic
1125074306 15:35595237-35595259 CAGGAAACACAATGAGGACAAGG + Intergenic
1125929574 15:43590628-43590650 CTGGAGACAAAAAAGAGACAAGG + Intergenic
1125942741 15:43690460-43690482 CTGGAGACAAAAAAGAGACAAGG + Intergenic
1128128021 15:65207142-65207164 CTGGAGAGACAAATGTGATAGGG - Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128704352 15:69827829-69827851 CTGGGAACACAAATGGACCAAGG - Intergenic
1129615764 15:77097944-77097966 CTGGGAAAATAAATGGAACATGG - Intergenic
1130011767 15:80157874-80157896 CTGGAAGCAGAGATGGCACAAGG + Intronic
1131101303 15:89691980-89692002 CTGGAAACACAGCTGGAATATGG + Intronic
1132867763 16:2102380-2102402 CAGGAAACACAAAGCGGACATGG + Exonic
1133598541 16:7316834-7316856 CTGGAAAAACAAAGGGACCAGGG + Intronic
1134524015 16:14930734-14930756 CAGGAAACACAAAGCGGATATGG - Intronic
1134548888 16:15130201-15130223 CAGGAAACACAAAGCGTACATGG + Intronic
1134711608 16:16329219-16329241 CAGGAAACACAAAGCGTACATGG - Intergenic
1134719459 16:16372518-16372540 CAGGAAACACAAAGCGTACATGG - Intergenic
1134867649 16:17622546-17622568 ATAGAAACACAGATGGGAAATGG - Intergenic
1134947967 16:18339367-18339389 CAGGAAACACAAAGCGTACATGG + Intergenic
1134955221 16:18379474-18379496 CAGGAAACACAAAGCGGATATGG + Intergenic
1135385082 16:22031954-22031976 CTGGTAACAGAAATGGAAAATGG - Intronic
1136075407 16:27813774-27813796 CAGGAAACACGGAGGGGACAAGG + Intronic
1136610731 16:31363381-31363403 CTAGTGACAGAAATGGGACACGG - Intronic
1136728284 16:32380526-32380548 GTGGAAACACACAGGAGACAGGG - Intergenic
1137411779 16:48234737-48234759 CTGCCAACAGAAGTGGGACAGGG + Intronic
1140519618 16:75569866-75569888 CTGGAAAGGCAAATGGGACTTGG - Intronic
1140519807 16:75571451-75571473 ATGGAAAGGCAAATGGGACTTGG - Intronic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1140906168 16:79411104-79411126 GTGGAAACTAAAATGGGACAAGG - Intergenic
1141450195 16:84094257-84094279 CGGGACACAAAAATGGGAAAAGG + Intronic
1141821244 16:86447477-86447499 CTGGAAACAAGACAGGGACAAGG + Intergenic
1202998154 16_KI270728v1_random:137228-137250 GTGGAAACACACAGGAGACAGGG + Intergenic
1143332089 17:6144953-6144975 CTGGAAACAAGAATGGAAGATGG - Intergenic
1143718407 17:8792834-8792856 CTGGAAAGACAGATGGGACCAGG - Intergenic
1144877509 17:18409125-18409147 CTGGAAACACAGTTGTGAAAAGG - Intergenic
1145154717 17:20535277-20535299 CTGGAAACACAGCTGTGAAAAGG + Intergenic
1146977144 17:37123255-37123277 TGGAAAAGACAAATGGGACAAGG + Intronic
1148247447 17:46043304-46043326 CAGGAAAAAAAAAAGGGACAGGG + Intronic
1150008836 17:61486699-61486721 CTGGAATAACAAAAGGGAGAAGG + Intergenic
1151643267 17:75412050-75412072 CTGGGAATACAAATGTGAAAAGG - Intergenic
1151812693 17:76453577-76453599 CTGGAAACACCTAGAGGACAGGG - Exonic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1154062697 18:11077950-11077972 CTGGAAACAGCAATGGAAAAAGG + Intronic
1155545906 18:26914648-26914670 TAGGAGACACAGATGGGACACGG + Exonic
1155550685 18:26961939-26961961 CTGGAAATACAAAGGCGAAAGGG + Intronic
1157594902 18:48858581-48858603 CTAGAAAAATGAATGGGACAAGG + Intronic
1157902204 18:51529450-51529472 GAGGAAACACAAATGGCAAATGG + Intergenic
1157946383 18:51985259-51985281 TTTGAAACATAAATGGGATAAGG - Intergenic
1158296427 18:56002044-56002066 TTGGAAACAGCAATGTGACATGG + Intergenic
1158521062 18:58171563-58171585 CTGCAAACACCAATAAGACAGGG - Intronic
1159712144 18:71774059-71774081 CTGGAAACTAAAATGGGGGAGGG - Intronic
1160513738 18:79467022-79467044 CTGTAAACAGAACTGGGACCGGG - Intronic
1161517466 19:4704305-4704327 CTGGAAACATACAGGGGACAGGG + Intronic
1161581972 19:5086047-5086069 CCCGAAACGCAAATGGGACAGGG - Intronic
1162966410 19:14158281-14158303 CTGGGAACACAGAGGGTACAGGG + Intronic
1166111175 19:40623869-40623891 CTGGGAAGAGAAATGGGAAAGGG + Intronic
1166304348 19:41929108-41929130 GTGGAAACACAACCGGTACACGG + Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166477453 19:43140585-43140607 ATAGCAACACAAAAGGGACAAGG + Intronic
1166488881 19:43240066-43240088 ATAGCAACACAAAAGGGACAAGG + Intronic
1167343644 19:48931497-48931519 ATAGAAACACAAATGGGACCAGG - Intergenic
1168351452 19:55678484-55678506 CTGGAAACACAAATGGGACATGG - Intronic
925517130 2:4695402-4695424 CAGGAAACAAAAGTGGGAGAAGG + Intergenic
925775237 2:7328811-7328833 CAGGAAATACTAATAGGACAGGG + Intergenic
929162564 2:38847220-38847242 CTGGTAACAGAAATTGGAAAGGG + Intronic
930605948 2:53493179-53493201 CTGTAAACTCACATGGGAGAAGG - Intergenic
930951694 2:57150413-57150435 CTGTAAACCCAACTGGGACTGGG - Intergenic
932385532 2:71329108-71329130 CTGGCAACACAAAGGGGCCGAGG - Intronic
934105439 2:88691214-88691236 CAGGAAACTCACATGCGACACGG - Intergenic
934317690 2:91940561-91940583 GTGGAAACACACAGGAGACAGGG + Intergenic
938572054 2:132570040-132570062 CTGGAAGCAGAACTGGGACTGGG + Intronic
938626643 2:133116897-133116919 GTAGAAACACAACTGGTACAAGG + Intronic
939472490 2:142641567-142641589 CTGGAAATACTACTGGGAGAGGG + Intergenic
939741027 2:145906465-145906487 CAGGAAAAAAAAAAGGGACAGGG + Intergenic
940513451 2:154649195-154649217 CTGGCAAAACAAAGGGGAAAAGG - Intergenic
940518958 2:154718105-154718127 CAGGAAAAACTAATGGCACATGG + Intronic
941787601 2:169515354-169515376 CTGCACACTAAAATGGGACATGG + Intronic
941854371 2:170215322-170215344 CTGGAAACATTAACGGGAAATGG + Intronic
942210264 2:173663153-173663175 CAGGAGATAAAAATGGGACAGGG - Intergenic
944783113 2:203040284-203040306 CTGGAGGCAGAAATGTGACAAGG + Intronic
945640881 2:212428369-212428391 CTGGAAAAACCAATGAGGCAAGG - Intronic
946039464 2:216771378-216771400 TTGGAAGCACATATGTGACAGGG + Intergenic
946566637 2:220972678-220972700 TTGGAAACACAAATGAGATAAGG - Intergenic
1169202660 20:3720348-3720370 CTGGACACACAACTGAGGCAAGG - Intergenic
1170529892 20:17280774-17280796 CTAGAAAGACAAAAGGCACATGG - Intronic
1170621966 20:18003981-18004003 CTCGAGACACATATAGGACATGG + Intronic
1170699806 20:18693761-18693783 CTGGATACACAATGGGGATAAGG - Intronic
1171046999 20:21818224-21818246 GTGGAAAAATAAATGGAACAAGG + Intergenic
1171381919 20:24740279-24740301 TTTGAAACCCAAATGGGAAAAGG - Intergenic
1173949405 20:46978528-46978550 CTGGAATCAGATATTGGACAAGG + Intronic
1175253086 20:57621519-57621541 CAGGAAACACAATTGGGGAATGG - Intergenic
1175541131 20:59748301-59748323 CTGGGAAGACCAATGAGACAGGG - Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1178017963 21:28373618-28373640 ATGAAAACACAAATTGGAGAAGG - Intergenic
1180305859 22:11124230-11124252 GTGGAAACACACAGGAGACAGGG + Intergenic
1180544378 22:16486413-16486435 GTGGAAACACACAGGAGACAGGG + Intergenic
1182258252 22:29053520-29053542 CTGGCACCACACATGGGACCAGG - Intronic
1182916596 22:34038746-34038768 CTAGAAGCACAAATGGGTGAGGG - Intergenic
1183004014 22:34885234-34885256 TTGGAAACACATCTGGGATAAGG + Intergenic
1183607599 22:38875077-38875099 CCGGAAAGACAAATGGGAATTGG + Intergenic
949295624 3:2519171-2519193 CTTGAAACACAGTTGGTACAAGG - Intronic
950458743 3:13108461-13108483 GTGGAGATACAAATGGGACGTGG - Intergenic
951107604 3:18763178-18763200 ATGGAAACAACATTGGGACATGG + Intergenic
951203184 3:19897279-19897301 CTGGAAACTCACATAGGAGAGGG - Intronic
952533992 3:34291120-34291142 CTGGAGACTACAATGGGACATGG + Intergenic
953667897 3:44939181-44939203 AAGGAGACACAAAAGGGACATGG + Intronic
953917942 3:46932588-46932610 CTGGCCACACAAAGAGGACAAGG + Intronic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
955916822 3:63914884-63914906 CTTGAGGCACAAAAGGGACATGG + Intronic
957862053 3:85966078-85966100 CTCAAAATACAAATGGGAAATGG + Intronic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
959173744 3:102877278-102877300 TGGGGTACACAAATGGGACAAGG + Intergenic
959533725 3:107462295-107462317 CTGAAAACATAAGAGGGACAAGG + Intergenic
959898110 3:111627854-111627876 CTGGAAAAACCAATGTGACTAGG + Intronic
963091184 3:141485614-141485636 CTGAAAACAGCATTGGGACAAGG + Intergenic
963767230 3:149350283-149350305 TTGGAAACACCATTGGGAAAGGG - Intergenic
964518733 3:157541460-157541482 CTGGAAACATCCAGGGGACAGGG - Intergenic
964800458 3:160551456-160551478 CTGGAAGCACAAATAAGAAACGG + Intronic
965514716 3:169608548-169608570 CTGGAAACACAAATGGAGGGAGG - Intronic
965820997 3:172684424-172684446 CTGCAAACAAAAATTGGAAATGG + Intronic
966099710 3:176252382-176252404 CTGGAGACACAACATGGACAAGG - Intergenic
966396504 3:179509583-179509605 CTGCAAACCCAGGTGGGACAGGG - Intergenic
966625294 3:182009239-182009261 CTGGAAACATAAAAGGAAAAAGG + Intergenic
967045168 3:185730128-185730150 CTGGGAACACAAAGGGGAAAGGG - Intronic
967218865 3:187232520-187232542 CTGGAAAAACAAAGGGGAGAAGG - Intronic
967971977 3:195005924-195005946 CTGGAAGGAGAAGTGGGACAGGG + Intergenic
968294176 3:197560919-197560941 CTTGAAGCAAAAGTGGGACAGGG - Intronic
968939355 4:3630040-3630062 CTGGAAAGATAACTGGGTCATGG + Intergenic
970249703 4:14101415-14101437 CTGGAAATACAATTGGTGCAGGG + Intergenic
970339673 4:15092932-15092954 CTGAGATCAGAAATGGGACAAGG - Intergenic
972348483 4:38213378-38213400 CGGGAAATACAAATTGGAAAGGG + Intergenic
972703076 4:41513450-41513472 CCGGATACACAAATGGGGCAAGG - Intronic
975183785 4:71377690-71377712 GTGGAAACACAGATGAGAGAAGG - Intronic
978109966 4:104951580-104951602 TAGGAGACAAAAATGGGACAAGG + Intergenic
979139828 4:117157869-117157891 ATGGAGACAAAAATGGGAGATGG - Intergenic
980225816 4:129983932-129983954 TTTGAAACACAAAGGGGAAAAGG + Intergenic
980245057 4:130228346-130228368 ACGGAATCGCAAATGGGACAGGG - Intergenic
980899495 4:138891091-138891113 CTGGGAAAACACATGGGACGAGG - Intergenic
981793506 4:148568098-148568120 CTGGAAACATAAGGGGGAAAAGG - Intergenic
983098339 4:163593103-163593125 CTGGAAAGATAAATGGCACTGGG - Intronic
983739974 4:171118055-171118077 CTGGAAAGACAGATGTGACATGG + Intergenic
984172909 4:176382323-176382345 CTGGAAACACAATAGTGACAGGG + Intergenic
985147075 4:186904397-186904419 CTGGAAAAATAAATGGGAGTTGG - Intergenic
986602156 5:9483229-9483251 TTGGAAAGATAAATGGGAAAGGG - Intronic
986685421 5:10271861-10271883 CTGGCAACACGCAAGGGACATGG + Intergenic
987186852 5:15430433-15430455 CTGGAAAGTGAAGTGGGACAGGG + Intergenic
987592218 5:19944821-19944843 CTGGAAAGACAAATAGTACCAGG + Intronic
989783286 5:45296364-45296386 CTGAAAAACCATATGGGACAAGG + Intronic
991912465 5:71575258-71575280 CTGGAAAAACAAATAGAAAAGGG + Intergenic
993146632 5:84102243-84102265 TTGAAAACAGAAATGAGACAAGG + Intronic
993182282 5:84569849-84569871 CTGGATAAACAAATGTGGCATGG - Intergenic
993496096 5:88610739-88610761 GTGTAAACACAAATGAGAAAAGG - Intergenic
994246089 5:97478779-97478801 CTGCAAACACTCATTGGACATGG + Intergenic
994980724 5:106873273-106873295 CAGGAAATACAAATGTGATACGG - Intergenic
995491367 5:112695281-112695303 CTGGAACCACAAATATGTCAGGG - Intergenic
996493888 5:124130872-124130894 CTGCAAACACACATGGGACCAGG + Intergenic
996810059 5:127506729-127506751 CTGGAAACACCACTAGGCCAGGG + Intergenic
1000598243 5:163241105-163241127 TAGGAAACATAAATGGGGCAAGG - Intergenic
1000973573 5:167740629-167740651 GTGCAAACACAAATGGGGTACGG + Intronic
1001787635 5:174427196-174427218 CCGCAAACACAAAGGGGCCAGGG + Intergenic
1004259715 6:14097338-14097360 CATGAAACACACATGGGAAAAGG + Intergenic
1005533068 6:26727976-26727998 CTGGAAACTTAAGTGGGACATGG + Intergenic
1005537726 6:26773688-26773710 CTGGAAACTTAAGTGGGACATGG - Intergenic
1006303543 6:33206580-33206602 GTGGAGACACAAATGGGCTAGGG - Intronic
1008764991 6:54901256-54901278 CTGTAAACTCCAGTGGGACAGGG + Intronic
1009008597 6:57816101-57816123 CTGGAAACTTAAGTGGGACATGG - Intergenic
1009510295 6:64542585-64542607 TTGGAATGACAAAGGGGACAAGG - Intronic
1009512241 6:64567985-64568007 GTGGGAACACAAATGGAACATGG + Intronic
1013081979 6:106821201-106821223 CTCTAAAAACAAATGAGACATGG - Intergenic
1015974100 6:138772000-138772022 TTGTAAACACAAATGCTACAGGG + Intronic
1016882516 6:148924606-148924628 CTGGGGATACAATTGGGACAAGG - Intronic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018102799 6:160456329-160456351 CTGGAAACATGAAGGGGAGAGGG + Intergenic
1018301808 6:162410678-162410700 GTGGAATCACAAAAGGGGCATGG - Intronic
1019105976 6:169667424-169667446 TTGGAAACAAAAATGAAACAAGG + Intronic
1019331289 7:462058-462080 CTGGACCCACACATGGGAAAGGG + Intergenic
1022431846 7:30331818-30331840 ATGTTAACACAAATGGAACACGG - Intronic
1023087078 7:36581503-36581525 TTGGAAAAACAGATGGGAAATGG + Intronic
1023480745 7:40631388-40631410 CAGGAAAAACAAATGTCACATGG - Intronic
1023484342 7:40668718-40668740 CTGGAAACCCTAATAGGCCATGG + Intronic
1023909186 7:44541587-44541609 CTGGAGGCACAGATGGGACCAGG + Intergenic
1028225293 7:88244031-88244053 CAGGAAACAAAAATGGGATGAGG + Intergenic
1028763835 7:94527547-94527569 ATGCAAATACAAGTGGGACAAGG + Intronic
1028774269 7:94659828-94659850 CTGGAAACACAATTCTTACATGG - Intronic
1029862908 7:103593968-103593990 CTAGAAATGCAAATGGTACATGG - Intronic
1029956243 7:104643246-104643268 CAGGAAATAAAAAAGGGACATGG + Intronic
1031164803 7:118214985-118215007 CTGAAAACACAGCTGGGACATGG - Intronic
1031315382 7:120251472-120251494 CTGGAAACAGAAAGGAGAAAGGG - Intergenic
1032464394 7:132134760-132134782 ATGGAAATACAAATGAGACGGGG - Intronic
1032685203 7:134225539-134225561 GTGGAAATACAAATGTAACAAGG + Intronic
1035096817 7:156362482-156362504 CTGGAAACACAATAGAGCCACGG + Intergenic
1035487385 7:159236742-159236764 CTGGAAACACAAATCAGATGTGG + Intergenic
1035764475 8:2094979-2095001 TTTGAAACACAAATGCCACATGG + Intronic
1035785117 8:2253871-2253893 CTGGGAACACAAAGAGGAAAAGG - Intergenic
1035807694 8:2467845-2467867 CTGGGAACACAAAGAGGAAAAGG + Intergenic
1036575754 8:10026413-10026435 TTTGACACACAAATGGGAGATGG - Intergenic
1038886277 8:31666300-31666322 CAGGAAACACAAATCAGAGAGGG - Intronic
1039438986 8:37581595-37581617 TTTGAAACTCAAATGGGGCAAGG + Intergenic
1039665037 8:39517017-39517039 CTCCAAACACAGATGGGACTTGG - Intergenic
1042276671 8:67012285-67012307 CAGGACACATAAATGGGACATGG - Intronic
1042728083 8:71900909-71900931 TTAGATAAACAAATGGGACAGGG + Intronic
1045584607 8:103519021-103519043 CTGGAAAAACAAGTTGGAGAGGG - Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047757684 8:127931266-127931288 CTGGAAACATAAATGGAAAAGGG - Intergenic
1048707769 8:137173295-137173317 CTGGAGACACATATGGAAAAGGG - Intergenic
1049503130 8:142978725-142978747 CTGGAGAGACAGAGGGGACATGG + Intergenic
1049985937 9:951351-951373 CTGGAAACACAGACCAGACATGG + Intronic
1049988807 9:974249-974271 CTGCAAACAGAAATGGGACTCGG + Intergenic
1050120609 9:2303514-2303536 CTTGAAACAAAAATGGGTCATGG - Intergenic
1050249828 9:3733175-3733197 CTTGGAAAACAAATGGGTCACGG + Intergenic
1050644926 9:7709039-7709061 CTGGAAACAGTTATGAGACATGG + Intergenic
1053257120 9:36627015-36627037 CTGGGAACACAAAGAAGACAAGG + Intronic
1054451404 9:65405284-65405306 CTGGAAAGATAATTGGGTCATGG - Intergenic
1054924503 9:70576036-70576058 CTGGTAATACAAATGAGACATGG - Intronic
1055144603 9:72918027-72918049 CTGTAAATACAAATGGTTCATGG - Intronic
1055235539 9:74118248-74118270 CTGAAAAGACAAATGGCACTAGG - Intergenic
1055276887 9:74627494-74627516 TTGGAAATACAAATGAGATAAGG - Intronic
1055361609 9:75497014-75497036 CTGGAAAGAAATATGGGTCAAGG - Intergenic
1057317450 9:93978921-93978943 CAGGACACACAAGTGAGACAGGG + Intergenic
1057578078 9:96260232-96260254 TTGGATACCAAAATGGGACAAGG - Intronic
1059004473 9:110386042-110386064 CGGGAATCACAAAAGGAACAGGG + Exonic
1059108679 9:111534105-111534127 CTTGAGACAAAAATGGGAAAAGG - Intronic
1059443156 9:114322302-114322324 GTAGGAACACAAATGGGCCACGG + Intergenic
1060085207 9:120693007-120693029 CTGGAAAGACAAATAAGACCTGG - Intronic
1060507983 9:124212728-124212750 CAGGACACACACATGGGAGAAGG - Intergenic
1062092696 9:134686867-134686889 CTGGAACCACCTATGGGACATGG - Intronic
1062599807 9:137314678-137314700 CTGGCCACACAAAGGGGACGGGG - Intronic
1062727839 9:138087052-138087074 CCTGAAAGACAAATGGGCCAAGG + Intronic
1185514713 X:690844-690866 CTGAAAATACAGACGGGACACGG - Intergenic
1186071061 X:5821215-5821237 CTGGAAACACAAATGGCACACGG + Intergenic
1186187520 X:7036177-7036199 ATAGCAACACAAAAGGGACAAGG + Intergenic
1190024119 X:46907016-46907038 CTATAATCACAAATGAGACAGGG + Intergenic
1193144128 X:78059886-78059908 CTGGAAACAGAAATGGGTGTGGG - Intergenic
1194525606 X:94973305-94973327 CTGGACACAGAAATGGGCAAAGG - Intergenic
1195564522 X:106325358-106325380 CTGGAATCACAAAAAGCACAGGG + Intergenic
1195811724 X:108840626-108840648 GTGGAAACACAAACAGGAAAAGG + Intergenic
1197864972 X:131008026-131008048 CTGGAAAAAGACACGGGACAGGG + Intergenic
1199609538 X:149600943-149600965 TTGGCAACACAAATGGGAATGGG + Intronic
1199629578 X:149768411-149768433 TTGGCAACACAAATGGGAATGGG - Intergenic
1200092189 X:153641228-153641250 ATGGAGACCCAGATGGGACAGGG + Intergenic