ID: 1168352515

View in Genome Browser
Species Human (GRCh38)
Location 19:55684832-55684854
Sequence ATGCCAGGCGATGCCCATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168352508_1168352515 25 Left 1168352508 19:55684784-55684806 CCATGTTACTTTAGATTTTAGTT 0: 1
1: 0
2: 2
3: 30
4: 462
Right 1168352515 19:55684832-55684854 ATGCCAGGCGATGCCCATGGCGG 0: 1
1: 0
2: 0
3: 8
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168352515 Original CRISPR ATGCCAGGCGATGCCCATGG CGG Intronic
902756575 1:18552964-18552986 ATTTCAGGCCATGCACATGGAGG - Intergenic
903889369 1:26559163-26559185 ATGTCAGGAGGTGCCCAGGGTGG + Intronic
922533390 1:226361799-226361821 AAGCCAGGCTATGCACAGGGAGG + Intronic
1063605897 10:7522628-7522650 GTGCCAGGCGGTGCCCTGGGCGG - Intergenic
1066523218 10:36246121-36246143 ATGCCTGGCAATGCCCAGTGAGG + Intergenic
1077146756 11:1049992-1050014 AGGACACGCGAGGCCCATGGGGG - Intergenic
1082657935 11:55874048-55874070 ATGCCAGGTGATGCTGATGCAGG + Intergenic
1083164075 11:60872914-60872936 ATGCCAGGCCCTGCACCTGGTGG - Intronic
1085635704 11:78157989-78158011 ATGCCAGGCGTTGCTGAGGGAGG - Intergenic
1091991679 12:4960812-4960834 ATGGCTGGTGATGCCCAAGGCGG - Intergenic
1092210264 12:6641315-6641337 GTGACAGGCTGTGCCCATGGGGG - Intronic
1101889755 12:108702676-108702698 ATGCCAGACGAGACACATGGTGG + Intronic
1106924557 13:34600466-34600488 TTGCCAGGCAATGACCCTGGAGG + Intergenic
1108363929 13:49691655-49691677 TTGCCAGGTGCCGCCCATGGAGG + Intergenic
1110131789 13:72019728-72019750 ATGCCAGAAAATGCCCAAGGGGG + Intergenic
1110442134 13:75537799-75537821 GTCCCAGACGCTGCCCATGGAGG - Exonic
1112321891 13:98415485-98415507 GTGGCAGGCTTTGCCCATGGGGG + Intronic
1113219146 13:108078724-108078746 CTACCAGGCAATGACCATGGTGG + Intergenic
1114671654 14:24414937-24414959 ATCCCAGGGGATGCCCAGGTAGG - Exonic
1116061569 14:39930923-39930945 ATGGCATGGGATGCCCATGGAGG + Intergenic
1119910048 14:78341345-78341367 CTCCCAGGTGATGCCCATGCTGG + Intronic
1202848586 14_GL000225v1_random:1601-1623 CTGCCAGGCGAGGCCTCTGGGGG - Intergenic
1125542513 15:40478265-40478287 AAGCCAGGAGATGGCCATGGGGG - Intergenic
1126547713 15:49890850-49890872 ATGCCAGGCCACTCCCATGTGGG + Intronic
1129974870 15:79813513-79813535 ATGCCCAGCTATGCCCTTGGTGG - Intergenic
1132501873 16:288078-288100 GTGCCAGGCGAGGCCCTTGGCGG - Exonic
1132825636 16:1903967-1903989 ATGCCAGGCAGGGCCCACGGTGG - Intergenic
1141302546 16:82830814-82830836 GAGCCAGGCTATGCCCAGGGTGG - Intronic
1144765629 17:17730991-17731013 AGGGCAGGCGATGCCCAAGGAGG + Intronic
1146516435 17:33493391-33493413 AAGACAGGGGATGCCCTTGGGGG - Intronic
1147258906 17:39197432-39197454 CTCCCAGGAGATCCCCATGGAGG - Exonic
1147315709 17:39619124-39619146 GTGCCAGCTGGTGCCCATGGGGG - Intergenic
1148801453 17:50229204-50229226 ATGCCAGGCCATCCCCATGTAGG + Intergenic
1150852317 17:68715204-68715226 ATGCCAGCGGATGCCCATAAAGG + Intergenic
1152644210 17:81461329-81461351 CTGCAAGGCGTTGCTCATGGGGG + Exonic
1152935466 17:83134221-83134243 GTGCCGGGCGATGCTCAGGGCGG + Intergenic
1152935488 17:83134325-83134347 GTGCCGGGCGATGCTCAGGGCGG + Intergenic
1152935555 17:83134689-83134711 GTGCCAGGCGATGCTCAGGGCGG + Intergenic
1152935612 17:83135001-83135023 GTGCCGGGCGATGCTCAGGGCGG + Intergenic
1152935631 17:83135105-83135127 GTGCCGGGCGATGCTCAGGGCGG + Intergenic
1152935678 17:83135365-83135387 GTGCCGGGCGATGCTCAGGGCGG + Intergenic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1160120814 18:76129198-76129220 ATGCCATGCCATGCCCACAGAGG - Intergenic
1161618825 19:5287564-5287586 ATGCCAGCCCATGCCCTGGGCGG + Intronic
1162022469 19:7874110-7874132 AGGCCAGGGGAGGCCGATGGGGG - Intronic
1162158628 19:8696419-8696441 ATGCCAGGGGCATCCCATGGTGG + Intergenic
1163090530 19:15016520-15016542 ATGCCAGGCGATGTGCCAGGTGG - Intronic
1164374352 19:27672406-27672428 ATCCCAGGCTTTGCACATGGAGG - Intergenic
1165831086 19:38730776-38730798 ATGCCAGGCAAGGCCTAGGGAGG + Exonic
1166975753 19:46604146-46604168 AGACCAGGCAATGCCCAGGGAGG - Intronic
1168243317 19:55097889-55097911 GTGCCAGGCGAGGAGCATGGTGG - Intronic
1168352515 19:55684832-55684854 ATGCCAGGCGATGCCCATGGCGG + Intronic
925193858 2:1907868-1907890 ATGCCAGGTAAGCCCCATGGAGG + Intronic
925350411 2:3197471-3197493 ATGCCAGGCGAAGGCCGTGTGGG - Intronic
929182610 2:39059709-39059731 ATGCCATGTGATGCCCTTGGTGG + Intronic
930847293 2:55919426-55919448 ATCCCAGGCGATTCCCATACAGG + Intronic
932459566 2:71873498-71873520 ATGCCAGTCCACGCCCATGCAGG + Intergenic
935030691 2:99318620-99318642 ATGCAAGGAGATGCACTTGGAGG - Intronic
935101230 2:99997949-99997971 AGGGCTGGGGATGCCCATGGGGG - Intronic
937329731 2:121019022-121019044 AGGCGAGGCGATGCCCGTGCAGG - Intergenic
1172007488 20:31827366-31827388 ATGCCAGGCAATGCTCTAGGTGG + Intronic
1174873714 20:54206481-54206503 AGAACAGGCGATGCCCGTGGCGG + Intergenic
1176103348 20:63374517-63374539 TTTCCAGGCAATGCCCAGGGAGG - Intronic
1176286463 21:5021668-5021690 AAGCCAGGTGAGGCCCAGGGGGG - Intergenic
1178595725 21:33950585-33950607 ATGTCAGGCACTGCCCCTGGCGG - Intergenic
1179870718 21:44241807-44241829 AAGCCAGGTGAGGCCCAGGGGGG + Intergenic
1180969470 22:19807628-19807650 ATGCCAGGCTCTGTCCAAGGTGG - Intronic
1181633692 22:24164574-24164596 ATGCCAGGCTGTGTCCAGGGTGG - Intronic
1182299610 22:29330305-29330327 ATGCCAGGGGGTGGCCCTGGTGG - Intronic
1183244972 22:36686457-36686479 ATGCCAGCTGATACCCTTGGGGG - Intronic
1183990992 22:41597017-41597039 ATGCCAGGCCCTGCCCTGGGAGG + Intergenic
1184758837 22:46533542-46533564 ATGCCAGGCGGAGCCCTTGGCGG + Intronic
1184864994 22:47197357-47197379 TTGCCAGGCGCTGCCCACGTGGG - Intergenic
961321815 3:126082294-126082316 ATGCCAGAAGATGCCAGTGGAGG + Intronic
961440989 3:126953060-126953082 ATGGCAGGTGATGCCCAAGACGG - Intronic
972070030 4:35007296-35007318 ATGCCAGTAGATGCCAATGAAGG - Intergenic
990990480 5:61678781-61678803 GTGCCAGGTGAGGCCCAGGGAGG + Intronic
993152176 5:84174740-84174762 ATGCCACGGCAGGCCCATGGTGG - Intronic
994310184 5:98260037-98260059 AGCTCAGCCGATGCCCATGGAGG - Intergenic
1016941223 6:149484153-149484175 AGGCCAGGCAATGCCAATCGTGG - Intronic
1023172044 7:37399184-37399206 CTGCCAGGAAATGCCCATGAGGG + Intronic
1023183695 7:37511875-37511897 ATGCCAGGAGACCCCCCTGGAGG - Intergenic
1024506616 7:50167494-50167516 ATGCCAGGCTATGCCTGGGGAGG + Intergenic
1024675940 7:51638053-51638075 CCTCCAGGCGATGCCCATGCAGG - Intergenic
1028077960 7:86537880-86537902 ATGCCAGGGGATCCACTTGGTGG + Intergenic
1036696961 8:10981339-10981361 GTTCCAGGTGAGGCCCATGGAGG + Intronic
1038004249 8:23416529-23416551 ACTCCAGGAGGTGCCCATGGTGG + Intronic
1040315115 8:46256932-46256954 ATGCCAGGAGTTGGCCAAGGAGG + Intergenic
1047457389 8:125028434-125028456 CTGCAAGGCAATTCCCATGGTGG + Intronic
1056601679 9:88051805-88051827 ACTCCAGGCTATGACCATGGGGG + Intergenic
1057276173 9:93677010-93677032 ATGTCTGGGGCTGCCCATGGGGG - Intronic
1057386493 9:94609809-94609831 GTGGGAGGTGATGCCCATGGAGG - Intronic
1057842816 9:98500258-98500280 ATGGCAGGGGGTGCCCCTGGGGG + Intronic
1060218885 9:121754191-121754213 CTGCCAGGGTGTGCCCATGGTGG - Intronic
1203784478 EBV:119842-119864 ATGCCAATCCATGCCAATGGGGG - Intergenic
1196706976 X:118725466-118725488 ATGCCAAGCAGTGCCCATGATGG + Intergenic
1200978568 Y:9239937-9239959 ATGCCATGAGATGCCCATCCCGG + Intergenic
1201177783 Y:11320643-11320665 ATTCTAGGCTCTGCCCATGGGGG - Intergenic