ID: 1168354940

View in Genome Browser
Species Human (GRCh38)
Location 19:55695067-55695089
Sequence CTTTGCCTGCACATGCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 320}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168354933_1168354940 14 Left 1168354933 19:55695030-55695052 CCAGAGGAGGTGCCTCACGGGGC 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1168354940 19:55695067-55695089 CTTTGCCTGCACATGCTGGATGG 0: 1
1: 0
2: 2
3: 28
4: 320
1168354929_1168354940 17 Left 1168354929 19:55695027-55695049 CCACCAGAGGAGGTGCCTCACGG 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1168354940 19:55695067-55695089 CTTTGCCTGCACATGCTGGATGG 0: 1
1: 0
2: 2
3: 28
4: 320
1168354936_1168354940 2 Left 1168354936 19:55695042-55695064 CCTCACGGGGCAGGGACACTTCG 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1168354940 19:55695067-55695089 CTTTGCCTGCACATGCTGGATGG 0: 1
1: 0
2: 2
3: 28
4: 320
1168354927_1168354940 27 Left 1168354927 19:55695017-55695039 CCTGTGGGTTCCACCAGAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 161
Right 1168354940 19:55695067-55695089 CTTTGCCTGCACATGCTGGATGG 0: 1
1: 0
2: 2
3: 28
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168354940 Original CRISPR CTTTGCCTGCACATGCTGGA TGG Intronic
902207923 1:14883259-14883281 CTTTTCTTGCCCAGGCTGGAGGG - Intronic
903058432 1:20653017-20653039 CTCTGCCTGCAGGTGGTGGAAGG - Intronic
903650757 1:24920695-24920717 TTTTGCCTTCACACGCTGGGTGG + Intronic
904575363 1:31501945-31501967 ATTTGCCTGCACATGAAGGCTGG + Intergenic
905350178 1:37340117-37340139 CTGTGTCTTCACATGGTGGAAGG - Intergenic
905870689 1:41402717-41402739 CTTTGCCTTCACTCTCTGGAGGG - Intergenic
906555292 1:46706494-46706516 CTTTGCCTTTTCATGCTGAACGG + Intronic
907276526 1:53319834-53319856 CTTTGCCAGCACCTGCTAGTGGG - Intronic
907725743 1:57018866-57018888 TTTTGTTTGCAAATGCTGGAGGG - Intronic
908089597 1:60671819-60671841 CTGTGTCTTCACATGGTGGAAGG - Intergenic
910113738 1:83709958-83709980 ATTACCCTGCACAGGCTGGAAGG + Intergenic
910625050 1:89297632-89297654 CTGTATCTGCACATGATGGAAGG - Intergenic
911156140 1:94638611-94638633 CTGTGCCCTCACATGATGGAAGG - Intergenic
911724151 1:101224027-101224049 CTATGTCTTCACATGGTGGAAGG - Intergenic
912021763 1:105114965-105114987 CTTTTCCTGTAAATGCTGGGTGG - Intergenic
913085114 1:115429737-115429759 CTGTGCCCTCACATGATGGAAGG + Intergenic
913163578 1:116166444-116166466 CTGTGCCTGCCTAGGCTGGAGGG - Intergenic
913188176 1:116389285-116389307 CTTTGGCTGTACATGCTGTTTGG - Intronic
913211088 1:116583057-116583079 CTCTGCCTGCACCTGCTGGCTGG + Intronic
913649206 1:120894441-120894463 CTGTGCCCTCACATGGTGGAAGG - Intergenic
915663100 1:157419976-157419998 CTGTGTCTTCACATGATGGAAGG - Intergenic
916993366 1:170268535-170268557 CTGTGTCTTCACATGATGGAAGG - Intergenic
918491605 1:185087312-185087334 CTGTGTCAGAACATGCTGGAAGG + Intronic
918631208 1:186720516-186720538 CTATTCCTTCACATGGTGGAAGG - Intergenic
918806924 1:189060016-189060038 CATTCCTTGAACATGCTGGAGGG + Intergenic
918994858 1:191744175-191744197 CCTTGTCTTCACATGGTGGAAGG + Intergenic
919593128 1:199528979-199529001 CCGTGCCTTCACATGCTGGAAGG + Intergenic
920028397 1:203018819-203018841 CTTTGTCCTCACATGGTGGAAGG + Intronic
920208486 1:204311071-204311093 CTTTTCCTGCACCGGCTGGGAGG - Intronic
920568463 1:206996280-206996302 CTTTGTCTTCACATGATGGAAGG - Intergenic
920756527 1:208739076-208739098 CTTTTCCTGTAAATGCTGGGCGG - Intergenic
920980542 1:210830280-210830302 CTATGCCTGCATATGGTGAAGGG - Intronic
921489092 1:215752576-215752598 CTTTACCTACACATTCTAGAAGG - Intronic
922396376 1:225205328-225205350 CTTTGTCCTCACATGGTGGAAGG - Intronic
922801349 1:228366095-228366117 CTGTGCCTGCACATCCTCGATGG - Exonic
924047537 1:240047274-240047296 CTGTGTCTTCACATGGTGGAAGG - Intronic
924192379 1:241567365-241567387 CTGTGTCTTCACATGCTGGAAGG + Intronic
924226873 1:241929112-241929134 CTGTACCTGCAAATGGTGGAGGG - Intergenic
1063023557 10:2155023-2155045 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1063727242 10:8651373-8651395 CTTTGTCTGCAGATGATGGTAGG - Intergenic
1064694128 10:17948872-17948894 AAGTGCCTGCAAATGCTGGATGG + Intergenic
1064847139 10:19667972-19667994 CTGTGTCTTCACATGATGGAAGG + Intronic
1066613733 10:37276277-37276299 CTTTTCCTGTAAATGCTGGGCGG + Intronic
1068793173 10:61049211-61049233 CTTTTCCTCTTCATGCTGGATGG + Intergenic
1071310495 10:84339151-84339173 TTTTGCCTGCACATGCTTTAGGG + Intronic
1071487889 10:86114801-86114823 CTGTGCCTGCTAATGCTGGGAGG - Intronic
1071549150 10:86552861-86552883 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1071899150 10:90100383-90100405 CTGTGCCCTCACATGGTGGAAGG + Intergenic
1075064417 10:119279880-119279902 CCTGGTTTGCACATGCTGGAGGG + Intronic
1075651448 10:124130293-124130315 CTCTCCCTCCACATGCTGGAAGG + Intergenic
1076517700 10:131057450-131057472 CTTCTCCTTCACCTGCTGGAGGG + Intergenic
1079730717 11:23935689-23935711 CTTTTCCTGTAAATGCTGGGTGG + Intergenic
1080224336 11:29943726-29943748 CTTTGCTTGCAAATGGTGGCTGG - Intergenic
1082260739 11:50074851-50074873 CTTGGCCTGGACATGCTGACTGG + Intergenic
1082904596 11:58292325-58292347 CTGTGCGTGCAGATGCTGGGCGG - Intergenic
1083145165 11:60752707-60752729 CTGTGTCTTCACATGATGGAAGG + Intergenic
1084495540 11:69501109-69501131 CTCAGCCAGCACCTGCTGGATGG + Intergenic
1084575806 11:69987170-69987192 TTTTGCCTGCTCTGGCTGGAGGG - Intergenic
1084674378 11:70625528-70625550 CTTTGCCTTCACCTCCTGGGAGG - Intronic
1084693088 11:70738296-70738318 CTTTCCCTGCACATTGTTGATGG - Intronic
1085987619 11:81806011-81806033 CTTTGCCTGAGCCTCCTGGAGGG - Intergenic
1087022127 11:93614335-93614357 CTGTGACTGCACATGGTGAAAGG + Intergenic
1087087009 11:94230071-94230093 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1089188111 11:116634828-116634850 CTGTGACTTCACATGGTGGAAGG + Intergenic
1089639538 11:119838708-119838730 CTGTGTCCTCACATGCTGGAAGG + Intergenic
1090283868 11:125481753-125481775 CTTTGCCCCTGCATGCTGGAAGG - Intronic
1091289674 11:134430959-134430981 CTTTCCCTGCATGTGCTGGGTGG - Intergenic
1093128178 12:15355473-15355495 CATTGCATTTACATGCTGGAAGG - Intronic
1094219714 12:27978850-27978872 CTTGGCCTGCCCATGCCAGAGGG - Intergenic
1094406945 12:30126286-30126308 CTTTGCATGAAGATGCTGAAAGG + Intergenic
1096501097 12:52064203-52064225 CTCAGCCTGCCCAGGCTGGAGGG + Intergenic
1096523492 12:52197272-52197294 CTTTCCCTGCACCTGCTGAGTGG + Intergenic
1097669377 12:62517601-62517623 CTTTGTCTTCACATGGTGGAGGG - Intronic
1097939911 12:65292864-65292886 CATTGCCTGGAAATCCTGGATGG + Intronic
1099414511 12:82370445-82370467 CTTTTCCTGTAAATGCTGGGTGG + Intronic
1100593684 12:96053406-96053428 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1101208645 12:102513925-102513947 CTATGCCCCCACATGGTGGAAGG - Intergenic
1101982519 12:109419999-109420021 CTTTGCCTGAAGATGCTGTTGGG + Intronic
1102929446 12:116851158-116851180 CTTGGCCCGCCCATGCTGGCTGG - Exonic
1103440493 12:120959266-120959288 CTTTGCCTTCAGTTGCTGGGAGG + Intergenic
1104008373 12:124911861-124911883 CTTTGCCTTGACATTCTCGATGG + Exonic
1104008564 12:124913229-124913251 CTTTGCCTTGACATTCTCGATGG + Exonic
1104008632 12:124913685-124913707 CTTTGCCTTGACATTCTCGATGG + Exonic
1104306828 12:127617277-127617299 CTTTTCCTATAAATGCTGGATGG - Intergenic
1106797877 13:33226045-33226067 CTGTGCCCTCACATGGTGGAGGG - Intronic
1106999352 13:35525834-35525856 CTGTGTCTTCACATGGTGGAAGG + Intronic
1107488834 13:40859994-40860016 CTCTGCCACCACAGGCTGGAGGG - Intergenic
1107623060 13:42253311-42253333 CTGTGTCCGCACATGGTGGAAGG - Intronic
1108118527 13:47158081-47158103 CTCTGTCTTCACATGATGGAAGG - Intergenic
1108149841 13:47521763-47521785 CTTTTCCTGTAAATGCTGGGTGG + Intergenic
1109425099 13:62157347-62157369 CTTTTCCTGTAAATGCTGGGTGG - Intergenic
1109775424 13:67034478-67034500 CATTAGCTGCATATGCTGGAAGG - Intronic
1110052645 13:70923831-70923853 CTTGGCCTGCACCTTCTTGATGG - Intergenic
1110343057 13:74414712-74414734 CTTTGCCCACTCATCCTGGAAGG - Intergenic
1110817237 13:79875778-79875800 CTGTGCCTTCACATGTTAGATGG + Intergenic
1111098363 13:83544934-83544956 CTTTGCCTTCACGTGATGGAAGG + Intergenic
1112135270 13:96571272-96571294 ATTTGCATGCACATGCAGGATGG - Intronic
1112998608 13:105604596-105604618 CTGGGCCTTCACATGGTGGAAGG + Intergenic
1113767950 13:112892701-112892723 CCTTTCCTGCCCATGCTGGCAGG + Intergenic
1113818470 13:113192936-113192958 CTGTGTCTGCACATGGTAGATGG - Intronic
1114164703 14:20209026-20209048 CTCTTGCTGCCCATGCTGGAGGG - Intergenic
1114556166 14:23563584-23563606 CGTTGTCAGCACATGCAGGATGG + Exonic
1120498908 14:85269687-85269709 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1121472217 14:94164795-94164817 CCTTGCCGACAAATGCTGGAAGG - Intronic
1121853171 14:97242374-97242396 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1124375089 15:29124640-29124662 CTTTGACTGCGCCTGCTGGGAGG - Intronic
1124943040 15:34235933-34235955 CTTTGCCTGGACACACAGGATGG - Intronic
1125146918 15:36481765-36481787 CTATGTCTTCACATGGTGGAAGG + Intergenic
1126136686 15:45399494-45399516 TTGTACCTGCACATGGTGGAAGG - Intronic
1126569704 15:50137338-50137360 GTTAGCCGGCACATTCTGGAAGG + Intronic
1127700222 15:61492261-61492283 CTGTGGCTGCACTGGCTGGAGGG + Intergenic
1127783777 15:62338679-62338701 CTGTGCCCTCACATGGTGGAAGG + Intergenic
1129580471 15:76803667-76803689 CTGTGTCTTCACATGGTGGAGGG + Intronic
1129668890 15:77596063-77596085 TTTTCACTGCACAAGCTGGATGG - Intergenic
1130773074 15:86944423-86944445 CTTTCCCTGCACATGCTGGTCGG - Intronic
1131421194 15:92306881-92306903 CTCTGCCTGCATATGCAAGAAGG - Intergenic
1131723483 15:95197105-95197127 CTTTGTTTGCAAATGCTGGGAGG - Intergenic
1132931843 16:2462657-2462679 CGCTGCCTGCTCACGCTGGAGGG + Exonic
1133462105 16:5995993-5996015 CTTTGTTTTCACATGGTGGAAGG + Intergenic
1136549683 16:30976385-30976407 CTGGGCCTCCCCATGCTGGAAGG + Intronic
1137958949 16:52862251-52862273 CTTTGCCAGTGCAGGCTGGAAGG + Intergenic
1138979945 16:62255948-62255970 CGTAGCCTGCACTTGCTGGTTGG - Intergenic
1139650459 16:68359647-68359669 CTTTGCCTGGTGAGGCTGGAGGG - Exonic
1143271567 17:5679307-5679329 CTATGTCTTCACATGGTGGAAGG - Intergenic
1143316893 17:6039719-6039741 CTGTGCCCTCACATGGTGGAAGG + Intronic
1143653052 17:8276092-8276114 CTCTGCCTGGTCAGGCTGGAGGG + Intergenic
1144542570 17:16158962-16158984 CTTTGCTTGCAGATTCTGTAGGG + Intronic
1145019849 17:19421161-19421183 CTTTCACTTCACATGCTGGAAGG + Intergenic
1145266323 17:21381198-21381220 CTTTGGCTGCCCAAGCAGGAGGG - Intronic
1146724739 17:35148009-35148031 CTTCGCCTGCTCAGGCTGGGAGG + Intronic
1147399204 17:40169367-40169389 CTTTGGCTGCACCTGCTGCTGGG - Exonic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1149436041 17:56634216-56634238 CTGTGTCTACACATGGTGGAAGG + Intergenic
1149544369 17:57492447-57492469 CTTTGGCAGCTGATGCTGGATGG + Intronic
1150609012 17:66718261-66718283 CTTTGCCCACACATGGTAGATGG + Intronic
1150939706 17:69677772-69677794 ATTTGTCTGCACATTCTGGAAGG - Intergenic
1151512881 17:74572200-74572222 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1152876127 17:82787161-82787183 CTTTGCCAGCATATGCCGGGGGG - Intronic
1153031653 18:718966-718988 CTGTGCCTGCTCCTTCTGGAAGG - Intergenic
1153820178 18:8825628-8825650 CTTGGCCTGCACCTTCTCGATGG - Exonic
1153978126 18:10287290-10287312 CTTTCCCTGAACAGGCTGGTGGG + Intergenic
1156546620 18:37969986-37970008 GTCTGCCTGCACTGGCTGGAGGG - Intergenic
1156547014 18:37973577-37973599 GTCTGCCTGCACTGGCTGGAGGG + Intergenic
1156845816 18:41664153-41664175 TTTTGCCTGAACTTGCTGAAAGG + Intergenic
1158881930 18:61788111-61788133 CTTTGGCTGCCCATGCTTGTGGG + Intergenic
1159203884 18:65225222-65225244 CTGTCCCTTCACATGGTGGAAGG - Intergenic
1160134099 18:76257081-76257103 GTATGCCTCCACCTGCTGGAAGG + Intergenic
1160259089 18:77274365-77274387 CTTTGCCTGCAGAGCCTGGGTGG - Exonic
1160390103 18:78523622-78523644 CTGTGGCTGCACATTGTGGAGGG - Intergenic
1161908803 19:7177257-7177279 TTTTGCTAGAACATGCTGGAAGG + Intronic
1162813828 19:13181247-13181269 CTTTGAACGCACATGCAGGACGG - Intergenic
1163315220 19:16536563-16536585 CTTTGGGTGCACAAACTGGAGGG - Intronic
1163748445 19:19061557-19061579 CTTTGCCTGCCATTGCTGGAAGG + Intergenic
1165100308 19:33435126-33435148 CTCTGCCTGGAGATGCCGGATGG - Intronic
1165869396 19:38960357-38960379 CTTTGCCGTCAGATGGTGGATGG + Intronic
1166422681 19:42651070-42651092 CTGTATCTGCACATGGTGGAGGG - Intronic
1168354940 19:55695067-55695089 CTTTGCCTGCACATGCTGGATGG + Intronic
1168449859 19:56457937-56457959 CTGTGTCTGCACATGGAGGAAGG - Intronic
925153342 2:1632605-1632627 CTTGGCCGGCCCGTGCTGGAAGG + Exonic
925448088 2:3945007-3945029 CTTTGCCCTCACATGCTGATTGG + Intergenic
926164123 2:10507497-10507519 ATTTGACTGCACTTGCTCGATGG - Intergenic
926843792 2:17111041-17111063 CTGTGCCTTCACATGGTAGAAGG + Intergenic
927060952 2:19418870-19418892 CTCTGTCTTCACAGGCTGGAAGG - Intergenic
928437114 2:31261817-31261839 CCTTGCCTGCAGATTCTGGGCGG - Intronic
929941796 2:46339827-46339849 CTGTGTCTCCACATGGTGGAAGG + Intronic
930920203 2:56744073-56744095 CTCTGGCTGCTCATGATGGAGGG + Intergenic
931995738 2:67837646-67837668 CTGTGCCTTCACATGGTAGAAGG + Intergenic
932683447 2:73847421-73847443 CTTTTCCAGCTCTTGCTGGATGG - Exonic
934014290 2:87862498-87862520 CTGTGTCCTCACATGCTGGAAGG - Intergenic
934578815 2:95421612-95421634 CTTTGGCTGGACATTCTGGCTGG - Intergenic
934600632 2:95655091-95655113 CTTTGGCTGGACATTCTGGCTGG + Intergenic
935035935 2:99373409-99373431 CTGTGTCTTCACATGATGGAAGG + Intronic
935498740 2:103812238-103812260 CTTGTGCTGCACCTGCTGGAAGG - Intergenic
936534000 2:113297215-113297237 CTTTGGCTGGACATTCTGGCTGG + Intergenic
938945874 2:136211632-136211654 CTGTGCCTTCACATGGTAGAAGG + Intergenic
939490125 2:142867015-142867037 CTCTGGCTGCTCAGGCTGGAAGG - Intergenic
940732713 2:157412317-157412339 CTTTTCTTGCCCAGGCTGGAGGG + Intergenic
940770524 2:157834891-157834913 CTCTGTCTTCACATGGTGGAAGG - Intronic
940823297 2:158382071-158382093 CTCTGTCTTCACATGGTGGAAGG - Intronic
942337202 2:174901293-174901315 CCTTGCATGGACATGCTGGTCGG + Intronic
945145463 2:206733470-206733492 CTGTGTCTCCACATGGTGGAAGG - Intergenic
945291119 2:208128342-208128364 CGTTCCCTCCACGTGCTGGAGGG - Exonic
946633373 2:221696891-221696913 CTTTGCCTTCAACTACTGGAAGG - Intergenic
948320554 2:237065443-237065465 CCTTGACTTCACAGGCTGGAGGG + Intergenic
948582950 2:239000326-239000348 CTGTGCCCTCACATGGTGGAAGG + Intergenic
948770615 2:240249722-240249744 GTCTGCCTGGGCATGCTGGAGGG + Intergenic
1169944645 20:10975625-10975647 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1170503433 20:16998771-16998793 CTTTCCCTACATATGTTGGAAGG + Intergenic
1170930141 20:20762341-20762363 CTTTGCCTGAACAGTCTGGTAGG - Intergenic
1171465275 20:25323668-25323690 CTGTCCCTGCCCATGCTGGCTGG - Intronic
1172631173 20:36379167-36379189 CTGGCCCTGCAAATGCTGGATGG + Intronic
1173241540 20:41301722-41301744 CTTTGCCTGCATCTGCTGGATGG - Intronic
1173291510 20:41719072-41719094 CTGTGCCCTCACATGGTGGAAGG + Intergenic
1174943673 20:54960575-54960597 CTGTGTCTTCACATGCTGAAAGG - Intergenic
1175264868 20:57696359-57696381 CTTTGCCAGCCCATGGTTGAAGG - Intronic
1175299194 20:57930748-57930770 ATCTGCCTGCACAGGCAGGAAGG + Intergenic
1175588755 20:60169961-60169983 GTTGGCCTGGACATGGTGGATGG + Intergenic
1175657655 20:60786131-60786153 CTTTTCCTGGTCTTGCTGGAAGG - Intergenic
1177224183 21:18232453-18232475 CTGTGTCTCCACATGGTGGAAGG + Intronic
1178608844 21:34062651-34062673 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1178839054 21:36124019-36124041 CTTTGTCTTCACATGGTGGAAGG - Intergenic
1179551690 21:42147427-42147449 CTTGGCTGGCAGATGCTGGAGGG + Intergenic
1179879691 21:44288222-44288244 CTTGGCCTGCCCTGGCTGGAAGG + Intronic
1180258999 21:46653802-46653824 CATTGCCACCACATGCTTGAAGG + Intronic
1182843870 22:33414835-33414857 CTGTGCCTTCACATGGTGAAAGG - Intronic
1185152934 22:49176606-49176628 CCTTGTCCTCACATGCTGGAAGG + Intergenic
949536466 3:4999960-4999982 CTTTACCTGCTTTTGCTGGAGGG + Intergenic
949765487 3:7521466-7521488 CTGTGACTTCACATGATGGAAGG - Intronic
949931533 3:9082388-9082410 CTGTGTCTTCACATGGTGGAAGG - Intronic
950163101 3:10774617-10774639 CTTTCCCTCTACATGCTGGCGGG - Intergenic
951391872 3:22114908-22114930 CTGTGCTTTCACATGGTGGAAGG - Intronic
952081580 3:29764789-29764811 CATAGCCTGCATATTCTGGAAGG - Intronic
953336447 3:42098360-42098382 CTTTTCCAGCACATGGAGGAAGG + Intronic
953581080 3:44157225-44157247 CATAGCCTCCACATGCTGGCTGG + Intergenic
955165126 3:56503475-56503497 CTGTGTCTTCACATGGTGGAAGG + Intergenic
959619650 3:108386260-108386282 CTTTGCCTTCCCATGTGGGAGGG - Intronic
959877046 3:111395378-111395400 CTGTGTCTTCACATGGTGGAAGG - Intronic
963390779 3:144661094-144661116 CTGTGTCTTCACATGGTGGAAGG + Intergenic
963462791 3:145638175-145638197 CTGTGTCTTCACATGGTGGAAGG - Intergenic
966312277 3:178606896-178606918 CTGTGTCTTCACATGATGGAAGG - Intronic
969166637 4:5321817-5321839 CTCTGCCTGGAGGTGCTGGATGG + Intronic
970045089 4:11843337-11843359 ATTTGTCTGCAAATTCTGGAAGG - Intergenic
970207312 4:13667952-13667974 CTGTGTCTCCACATGGTGGAAGG + Intergenic
970551973 4:17190752-17190774 CTTCACCTGCAAATGCTGCATGG - Intergenic
971614573 4:28771383-28771405 CCTTGTCTTCACATGGTGGAAGG + Intergenic
973766432 4:54167492-54167514 CCATGTCTGCACATGGTGGAAGG + Intronic
976537487 4:86235316-86235338 CTTTGTCTGCACATGCTCCCGGG + Intronic
977640696 4:99355283-99355305 CTTTTCCTGTAAATGCTGGGAGG - Intergenic
977653973 4:99500959-99500981 CTGTGCCTTCACATGGTGGAAGG + Intergenic
977885018 4:102244454-102244476 CTTTTCCTGTAAATGCTGGGTGG - Intergenic
979141901 4:117186216-117186238 CTATGTCTTCACATGGTGGAAGG - Intergenic
979714600 4:123822581-123822603 CTGTGCCCTCACATGGTGGACGG + Intergenic
981080302 4:140633431-140633453 CTGGGCCTGCTCCTGCTGGAAGG + Intronic
981890560 4:149731300-149731322 CTGTGTCTTCACATGGTGGAAGG - Intergenic
982235599 4:153248954-153248976 CTTTGCCTGCTAACCCTGGAGGG - Intronic
983860439 4:172699084-172699106 CTGTGCTTCCACATGGTGGAAGG + Intronic
984316963 4:178140802-178140824 GTTTGCCTACACTTGCAGGATGG + Intergenic
986666931 5:10112685-10112707 CTGTGTCTGCACATGGTAGAAGG + Intergenic
986867984 5:12012581-12012603 CTGTGCCCTCACATGGTGGAAGG - Intergenic
987436994 5:17906587-17906609 CTGTGTCTTCACATGGTGGAAGG - Intergenic
987715539 5:21564677-21564699 CTTTGGGTGCACATTCTTGAGGG - Intergenic
988363610 5:30267555-30267577 CCTTTCCTTCACATGGTGGAAGG - Intergenic
988521667 5:31951015-31951037 CTGTACCTGCACATGGTGGAAGG + Intronic
989506882 5:42236450-42236472 CTGTGTCTTCACATGATGGAAGG + Intergenic
990634915 5:57713904-57713926 TTGTGCCTTCACATGGTGGAAGG - Intergenic
990755697 5:59066831-59066853 CTTTGTCCTCACATGGTGGAAGG - Intronic
993575378 5:89592924-89592946 CTGTGTCCGCACATGGTGGAAGG + Intergenic
993908347 5:93649416-93649438 GCTAGCCTGCACATGCAGGAAGG - Intronic
995368344 5:111389176-111389198 CTGTGTCTGCACATGGTGGAAGG + Intronic
996681054 5:126228535-126228557 CTTTTCCTGCAAATGCAGGGTGG - Intergenic
998089655 5:139357189-139357211 CTTTGCCTTCACTTCCTGCATGG + Intronic
999122212 5:149218279-149218301 CTGTGTCTCCACATGGTGGAAGG + Intronic
999897848 5:156053885-156053907 CTTTGTCCCCACATGGTGGAAGG + Intronic
1001195191 5:169666804-169666826 CTTTATCTCCACTTGCTGGATGG - Intronic
1002073370 5:176693905-176693927 ATTTGCCTGAAGATGCTGGAGGG + Intergenic
1002508462 5:179697374-179697396 CTTTGCCAGTCCATTCTGGATGG + Intronic
1003193033 6:3890843-3890865 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1003201459 6:3965088-3965110 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1003264313 6:4552075-4552097 CTTTGCCCTCCCAAGCTGGAAGG + Intergenic
1003486745 6:6586734-6586756 CTGTGCCCTCACATGGTGGAAGG - Intergenic
1004249238 6:14009493-14009515 CTTTTCCTGCATCTGCTGGCAGG + Intergenic
1004928464 6:20438664-20438686 CTTTGGCTGCACAGATTGGAAGG + Intronic
1005827095 6:29639433-29639455 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1009001187 6:57717373-57717395 CTTTGGGTGCACATTCTTGAGGG + Intergenic
1009053675 6:58310130-58310152 CTTTGGCTGCCCTTGCTGCAAGG - Intergenic
1009237444 6:61140419-61140441 CTTTGGCTGCCCTTGCTGCAAGG + Intergenic
1010157373 6:72810539-72810561 GTTTCCCTGCTAATGCTGGAGGG - Intronic
1010716508 6:79235712-79235734 CTTTTCCTGCATCTGCTGAAAGG - Intergenic
1010903345 6:81454781-81454803 CTCTGGCTGCTCATGTTGGAAGG + Intergenic
1011935470 6:92771072-92771094 CTGTGCCAGCTCATGGTGGAAGG - Intergenic
1011967534 6:93177547-93177569 CTGTGCCTGCAAGTGCTGGCTGG - Intergenic
1013781452 6:113732913-113732935 GTTTGTCTGCACAGGCAGGATGG + Intergenic
1014619494 6:123648094-123648116 CTATGTCTTCACATGGTGGAAGG + Intergenic
1015089250 6:129334774-129334796 CTTTGTCTTCACGTGTTGGAAGG + Intronic
1018785340 6:167103669-167103691 CTGTGTCCGCACATGGTGGAAGG - Intergenic
1019144953 6:169970559-169970581 CTGTGCCTGCAGAGGCAGGAGGG + Intergenic
1019182926 6:170203125-170203147 CCTGGTCTGCACAAGCTGGAAGG + Intergenic
1019376713 7:696747-696769 CTTTGCCTGTCCAGGCTCGACGG + Intronic
1019732576 7:2636036-2636058 CTGTGCCAGCCCAGGCTGGATGG + Intronic
1019872751 7:3780722-3780744 CTCTGCCTGCACAGGGTGGTTGG - Intronic
1020951563 7:14685274-14685296 CTTTGCCTGAACATGCTGATTGG - Exonic
1021479174 7:21096735-21096757 CTTTGCCAACACCTGCTTGATGG + Intergenic
1021523271 7:21557484-21557506 CTATGTCTTCACATGGTGGAAGG + Intronic
1022316068 7:29246794-29246816 CTGTGCCCGCACATGGTGGAAGG + Intronic
1023225725 7:37966922-37966944 CTTTGCCTGAAGATGGTGGCAGG + Intronic
1024617677 7:51129298-51129320 CTTTGCGCTCACATGGTGGAAGG + Intronic
1024904746 7:54363908-54363930 CTGTGCCTTCACGTGGTGGAAGG + Intergenic
1026102998 7:67398147-67398169 CTGTGTCTTCACATGTTGGAAGG + Intergenic
1027646790 7:80811958-80811980 CATTGCCTCCACATCCTGAAAGG + Intronic
1027695728 7:81407823-81407845 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1029920551 7:104257826-104257848 CTCTTGCTGCACAGGCTGGAGGG - Intergenic
1030641937 7:112015847-112015869 CTTTGTCTTCACATGGTGGAAGG + Intronic
1030776811 7:113543663-113543685 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1031628274 7:124015740-124015762 CTGTGTCCTCACATGCTGGAAGG + Intergenic
1032357636 7:131225277-131225299 CTGTGTCTCCACATGGTGGAAGG + Intronic
1032531852 7:132627687-132627709 CTGTGCCTTCACATGGTGGAAGG - Intronic
1033224389 7:139549145-139549167 CTAAGTGTGCACATGCTGGATGG + Intergenic
1034189842 7:149205505-149205527 CTTTTCCTGCATCTGGTGGAAGG + Intronic
1036719357 8:11158699-11158721 CTGTCTGTGCACATGCTGGAGGG - Intronic
1037130599 8:15404117-15404139 CTATGTCTTCACATGGTGGAAGG + Intergenic
1038844565 8:31216748-31216770 CTTTTCCTTCTCAAGCTGGAGGG + Intergenic
1039883481 8:41641933-41641955 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1040970962 8:53137305-53137327 CTTTTCCTGTAAATGCTGGGTGG + Intergenic
1041113682 8:54512488-54512510 CTGTGTCTTCACATGCTGGAAGG - Intergenic
1044385822 8:91587277-91587299 CTGTGACTTCACATGGTGGAAGG - Intergenic
1047824831 8:128562064-128562086 CTGTTCCTTCACATGGTGGAAGG - Intergenic
1048258250 8:132922742-132922764 CTGTGCCCTCACATGCTGGGAGG + Intronic
1049323376 8:142009282-142009304 CTGTGCCCTCACATGGTGGATGG - Intergenic
1049437186 8:142592157-142592179 CTTTGCCAGCACAGCCTCGATGG - Intergenic
1049725078 8:144142074-144142096 CTTTGGCTTCACAGGCTGCATGG - Intergenic
1049756490 8:144313378-144313400 GTACGCCTGCACAGGCTGGAGGG - Intronic
1050313278 9:4374520-4374542 CTTTGCCTGGACAGGCTTAAGGG - Intergenic
1052160078 9:25247051-25247073 CTTTTCCTGTAAATGCTGGGCGG - Intergenic
1053368139 9:37538283-37538305 CTTTGCCAGCACATGCGGCTAGG - Intronic
1054885581 9:70194449-70194471 CTATGTCTTCACATGGTGGATGG - Intronic
1055368443 9:75571516-75571538 CTATGACAGCACATGCTGGCCGG + Intergenic
1057079486 9:92161537-92161559 CTTCTCCTTCACCTGCTGGAGGG + Intergenic
1058375774 9:104319859-104319881 CTTTTGCTGGACATGCTTGATGG + Intergenic
1058600093 9:106659884-106659906 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1060607767 9:124932828-124932850 CTGTGCCCTCACATGGTGGAAGG + Intronic
1061325572 9:129861901-129861923 TTTTTCCTGCACTTGCTGCAAGG - Intronic
1061938669 9:133872476-133872498 CTGTGCCCCCACATGCTGGTTGG - Intronic
1062039087 9:134395980-134396002 CTTTGCCTGCCCCTGCGGGGAGG + Intronic
1185758082 X:2668020-2668042 CTGTGTCCTCACATGCTGGAAGG - Intergenic
1185969013 X:4641017-4641039 CTGTGTCCTCACATGCTGGAAGG - Intergenic
1186117392 X:6319258-6319280 CTGTGTCTACACATGGTGGAAGG + Intergenic
1186211400 X:7253979-7254001 CTGTGTCTTCACATGGTGGAAGG + Intronic
1186242354 X:7583141-7583163 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1186313899 X:8348524-8348546 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1186367287 X:8909076-8909098 CTGTGTCTTCACATGATGGAAGG + Intergenic
1186451783 X:9680061-9680083 CTGTGTCTTCACATGGTGGAAGG + Intronic
1187762070 X:22598321-22598343 CTGTACCTTCACATGGTGGAAGG - Intergenic
1188691656 X:33136654-33136676 CTTTACCCTCACATACTGGAAGG - Intronic
1188760835 X:34027377-34027399 CTGTGTCTACACATGGTGGATGG - Intergenic
1188840759 X:35014153-35014175 CTGTGCCTGCACATGGTAGAAGG - Intergenic
1189219949 X:39363014-39363036 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1189789916 X:44593388-44593410 CTTTGTTTGCACATGGTGGAAGG + Intergenic
1194693289 X:97013059-97013081 GTTTGCCTGCTGATGCTGGAAGG + Intronic
1194736713 X:97521127-97521149 CTGTGCCCTCACATGGTGGAAGG - Intronic
1195089340 X:101443301-101443323 CTGTGTCTTCACATGATGGAAGG - Intronic
1196536062 X:116845873-116845895 CTTTGTCCTCACATGGTGGAAGG + Intergenic
1196786371 X:119424826-119424848 CTTTGCCCTCACATGGTGGAAGG + Intronic
1196937710 X:120745973-120745995 CTGTGCCCTCACATGGTGGAGGG - Intergenic
1197405760 X:126047068-126047090 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1198180638 X:134205039-134205061 TTTTGCCTTCACATGGTGGAAGG + Intergenic
1199051248 X:143239557-143239579 TTTGGCCTGCACATGCTTGCAGG + Intergenic
1199130183 X:144175975-144175997 CTGTGTCCTCACATGCTGGAAGG + Intergenic
1200163563 X:154021006-154021028 CTTCACATGCACATGCTAGAAGG - Intergenic
1200776818 Y:7176846-7176868 CTTTTCCTGTAAATGCTGGGTGG - Intergenic
1200783488 Y:7238050-7238072 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1201227819 Y:11835105-11835127 CTGTGTCCTCACATGCTGGAAGG - Intergenic