ID: 1168357435

View in Genome Browser
Species Human (GRCh38)
Location 19:55710796-55710818
Sequence CCACCATGCCTGGCAGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1261
Summary {0: 1, 1: 11, 2: 34, 3: 236, 4: 979}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168357435_1168357442 18 Left 1168357435 19:55710796-55710818 CCAGTCTCTGCCAGGCATGGTGG 0: 1
1: 11
2: 34
3: 236
4: 979
Right 1168357442 19:55710837-55710859 GCTCTTTGAGAGGCTGAGGCAGG 0: 17
1: 3106
2: 76956
3: 286424
4: 433276
1168357435_1168357440 14 Left 1168357435 19:55710796-55710818 CCAGTCTCTGCCAGGCATGGTGG 0: 1
1: 11
2: 34
3: 236
4: 979
Right 1168357440 19:55710833-55710855 CCCAGCTCTTTGAGAGGCTGAGG 0: 36
1: 4439
2: 106441
3: 335231
4: 459423
1168357435_1168357443 21 Left 1168357435 19:55710796-55710818 CCAGTCTCTGCCAGGCATGGTGG 0: 1
1: 11
2: 34
3: 236
4: 979
Right 1168357443 19:55710840-55710862 CTTTGAGAGGCTGAGGCAGGTGG 0: 1180
1: 28993
2: 83764
3: 163834
4: 172008
1168357435_1168357438 8 Left 1168357435 19:55710796-55710818 CCAGTCTCTGCCAGGCATGGTGG 0: 1
1: 11
2: 34
3: 236
4: 979
Right 1168357438 19:55710827-55710849 TGTAATCCCAGCTCTTTGAGAGG 0: 90
1: 13374
2: 317540
3: 335475
4: 309485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168357435 Original CRISPR CCACCATGCCTGGCAGAGAC TGG (reversed) Intronic
900178102 1:1299521-1299543 CCACCATCCCGGGCAGAGGTTGG - Intronic
900345290 1:2207583-2207605 ACACCATGCCTGGCAGGAGCTGG + Intronic
900547147 1:3235534-3235556 CCCCGCTGCCTGGCAGAGAAAGG + Intronic
900664761 1:3807755-3807777 CCACTGTGCCTGGCTGAGACTGG + Intergenic
900764872 1:4498048-4498070 CCACCATGCATGGCCCAGAAAGG - Intergenic
900817966 1:4864377-4864399 CCACCATGCCTGGCCTTGAGTGG + Intergenic
900994332 1:6112335-6112357 CCCCCGTGCTTGGCAGAGAGAGG - Intronic
901166964 1:7228313-7228335 CCACCATGCCCGGCTGAGTCCGG - Intronic
901487170 1:9572322-9572344 CCACCAAGCCCGGCTGACACTGG - Intronic
901498248 1:9635120-9635142 CCACCACGCCTGGCTAAGAGAGG - Intergenic
901738991 1:11330105-11330127 CCACCATGCCCGGCTGGGATGGG + Intergenic
901856713 1:12049117-12049139 CCACCGCGCCTGGCCAAGACAGG + Intergenic
902176924 1:14657368-14657390 CCACCATGCCTGGCTGGGAGAGG + Intronic
902342375 1:15792375-15792397 CCACCGTGCCTGGCCCAGGCTGG - Intergenic
902403108 1:16168588-16168610 CCACCGTGCCTGGCAATGCCCGG + Intergenic
902869696 1:19306717-19306739 CCACCATGCCTGGCCCATCCTGG + Intronic
902894124 1:19467161-19467183 CCACCATGCCTGGCAACTACGGG + Intronic
902895358 1:19476033-19476055 CCACCATGCCTGGCCAAAATTGG - Intronic
903231179 1:21923117-21923139 CCACCGTGCCCGGCTGAGTCTGG - Intronic
903252893 1:22069461-22069483 CCACCACGCTTGGCCGAAACAGG + Intronic
903361901 1:22782270-22782292 ACACAATGCCTGGCATAGATTGG + Intronic
903419719 1:23209928-23209950 TCACCAGGCCTGTCAGAGAGAGG - Intergenic
903497974 1:23783740-23783762 CCACCACGCCTGGCCCATACTGG + Intronic
903847460 1:26286984-26287006 CCACCACGCCAGGCTGAGGCAGG + Intronic
903893695 1:26587912-26587934 CCACCATGCCCGGCCTAGCCTGG + Intergenic
904168810 1:28576602-28576624 CCACCGCGCCCGGCCGAGACGGG + Intronic
904190535 1:28739586-28739608 CCACCATGCCCGGCTGAGTCAGG + Intronic
904228974 1:29050960-29050982 CCACCACGCCTGGCTGATAAAGG + Intronic
904250435 1:29220101-29220123 CCACCATGCCTGGCCATGACTGG - Intronic
904437553 1:30508481-30508503 GCACCATGCCTGGCACACAAGGG - Intergenic
904484712 1:30817100-30817122 AAACCAGGCCTGGCAGGGACTGG - Intergenic
904636400 1:31884838-31884860 CCACCATGCCCGGCCTAGAGAGG - Intergenic
904940892 1:34164497-34164519 CCAGCGTGCCTGGCAGAATCAGG + Intronic
905041532 1:34964009-34964031 CCACCACGCCTGGCCAAGAGTGG - Intergenic
905186294 1:36199426-36199448 CCACCGTGCCTGGCCTGGACTGG - Intergenic
905615678 1:39396165-39396187 CCACCATGCCCGGCTAAGATGGG - Intronic
905736110 1:40327285-40327307 CCACCGTGCCTGGCCGAGATCGG + Intergenic
905799576 1:40834650-40834672 CCTGCATCTCTGGCAGAGACTGG - Intronic
905858774 1:41332310-41332332 CCACCATGCCTGGCCTTGACTGG - Intergenic
906208120 1:43997704-43997726 CCACAAAGCCAAGCAGAGACTGG - Exonic
906224197 1:44107390-44107412 CCACCGCGCCTGGCTGAGACTGG + Intergenic
906534835 1:46545692-46545714 CCCCGATGCCTGGCAGGGCCAGG - Intronic
906801018 1:48736994-48737016 CCACCATGCCTGGCTGTCACTGG - Intronic
907195488 1:52683216-52683238 CCACCATGCCTGGCCAAAATGGG - Intergenic
907421686 1:54352006-54352028 CCACCAGGCCTGGCCAAGATCGG - Intronic
908005574 1:59724189-59724211 CCACCATGCCTGGCCAACACGGG - Intronic
908236963 1:62156239-62156261 CCACCATGCCTGGCCTACATTGG - Intronic
908261629 1:62343691-62343713 CCACCACGCCCGGCCAAGACAGG + Intergenic
908645005 1:66268380-66268402 CCACCATGCCTGGCCGAAGAGGG - Intronic
908754354 1:67454465-67454487 CCACCACGCCTGGCCAAGAAGGG + Intergenic
908822320 1:68101260-68101282 GCACCATGCCTGGCAGAGAGGGG + Intronic
908983556 1:69988280-69988302 CCACCATGCCTGGGTGAGTGTGG - Intronic
909613417 1:77577904-77577926 CCACCGTGCCCGGCCGAAACTGG + Intronic
910228892 1:84965963-84965985 CCACCACGTCTGGCCGAGATTGG - Intronic
910367075 1:86477255-86477277 CCACCATGCCCGGCCCAGAATGG + Intronic
910803261 1:91165725-91165747 CCACCAACCCTGGGAGAGAAGGG - Intergenic
910986226 1:93007598-93007620 CCACCGTGCCTGGCCAAGAGAGG - Intergenic
911330208 1:96518345-96518367 CCACCATGCCTGGCCCAGGTTGG - Intergenic
912347930 1:108982243-108982265 CCACCATGCCTGGCCTAGTATGG - Intronic
912407679 1:109454189-109454211 CCACCATGCCTGGCCCACATAGG + Intergenic
912493141 1:110073407-110073429 CCACCATGCCTGTCTAAGATTGG + Intronic
912875506 1:113354717-113354739 CCACCACGCCTGGCCTTGACAGG - Intergenic
913583542 1:120250543-120250565 CCACCATCCCTAGCAGAGAGGGG - Intergenic
913624634 1:120647777-120647799 CCACCATCCCTAGCAGAGAGGGG + Intergenic
914320108 1:146551101-146551123 CCACCATGCCAGGCCAAGATGGG - Intergenic
914565530 1:148862379-148862401 CCACCATCCCTAGCAGAGAGGGG - Intronic
914607295 1:149267873-149267895 CCACCATCCCTAGCAGAGAGGGG + Intergenic
914706162 1:150171624-150171646 CCACTGTGCTTGGCAGAGAAGGG - Intergenic
914812607 1:151040036-151040058 CCACCATGCCTGGCCCAGTAAGG + Intronic
914828690 1:151154929-151154951 CCACCATGCCCAGCCGAGACAGG + Intergenic
914914994 1:151814212-151814234 GCACAATGCCTGGCAGAGAAGGG + Intronic
915139560 1:153758818-153758840 CCACCATGCCTGGCCAGGCCTGG - Intronic
915178610 1:154038630-154038652 CCACCATGCCCAGCAGACACAGG + Intronic
915286132 1:154853654-154853676 CCACCATGCCCGGCTGAGAGTGG - Intronic
915403282 1:155639951-155639973 CCACCATGCCTGGCTGGCCCTGG - Intergenic
915424469 1:155813142-155813164 CCACCGTGCCTGGCTGAGAATGG - Intronic
917035595 1:170744261-170744283 CCACCGCGCCTGGCCAAGACTGG + Intergenic
917626967 1:176856046-176856068 CCACCGTGCCTGGCACAGGCTGG - Intergenic
917692554 1:177484156-177484178 CCACCATGCCTGTCCGATGCTGG - Intergenic
917928833 1:179810078-179810100 ACACCATGCCTGACACATACCGG - Intronic
918052836 1:180989769-180989791 CCACCACGCCTGGCTGAGCTTGG + Intronic
918140775 1:181717719-181717741 CCTACATGCCTGGCAGGGACAGG - Intronic
918217075 1:182401051-182401073 CCACCATGCCTGTCCGAGTAAGG - Intergenic
918272117 1:182912152-182912174 CCACCGTGCCTGGCGGAATCTGG - Intronic
918371499 1:183866257-183866279 GCACAATGCCTGGCAGACAGTGG - Intronic
918491936 1:185090205-185090227 CCATCGTGCCTGGCCGAGGCTGG + Intronic
919069562 1:192736556-192736578 CCACCATGCCTGGCTGAGACTGG + Intergenic
919104188 1:193128590-193128612 CCACCATGCCTGGCCTAGGCTGG + Intronic
919201060 1:194356119-194356141 CCACCATGCCTGGCAATAATTGG + Intergenic
919406644 1:197193248-197193270 CCACCGTGCCTGGCTGTGCCAGG - Intronic
919574228 1:199286946-199286968 CCACCATGCCTAACAGGCACAGG + Intergenic
919932639 1:202231261-202231283 TGACCATGCCTGGCTGAGCCTGG + Intronic
920005686 1:202832225-202832247 CCACCATGCCTGGCTGCTACTGG - Intergenic
920130518 1:203728568-203728590 CCACCATGCCTGGCCGACTGGGG - Intronic
920245094 1:204581948-204581970 GCACCATGCTTGTCAAAGACAGG - Intergenic
920537462 1:206747907-206747929 CCACCATGCCTGGCCTAAACTGG + Intergenic
920569107 1:207002894-207002916 CCACCTGGCCTGGCTGAGAGTGG - Intergenic
921205203 1:212842799-212842821 CCACCACGCCCAGCCGAGACAGG - Intronic
921235005 1:213117733-213117755 CCACCATGCCTGGCCAAGTAAGG - Intronic
921620714 1:217323487-217323509 CCACCGTGCCTGGCCAAGTCAGG - Intergenic
921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG + Intronic
921870848 1:220138183-220138205 CCACCATGCCTGGCCAACACAGG - Intronic
922290625 1:224206355-224206377 CCACCATGCCTGGCTAATTCTGG + Intergenic
922500473 1:226093802-226093824 CCAGCAGGCCTGGCAGGGGCTGG - Intergenic
922506310 1:226127987-226128009 CCACCCTGCCAGGAAGACACAGG - Intergenic
923038288 1:230300893-230300915 CCAGCACCCCTGGGAGAGACGGG - Intergenic
923404754 1:233648852-233648874 CCACCATGCCTGGCCAACAAAGG + Intronic
923514506 1:234683290-234683312 CTACCATGCCCAGCAAAGACAGG - Intergenic
923708316 1:236363876-236363898 CCACTAAGCCTGGCCAAGACTGG - Intronic
923765829 1:236891513-236891535 CCACCATGGGTGTCAGAGGCAGG + Intronic
924222022 1:241887332-241887354 CCACCTTGCCTGGCCTACACTGG + Intronic
924290409 1:242530179-242530201 CCACCATGCCTGGCCGGCACTGG + Intergenic
924440360 1:244080772-244080794 CCACCGTGCCGGTCAGAGACAGG - Intergenic
924587012 1:245368845-245368867 CCACCACGCCCAGCAAAGACTGG - Intronic
1063590828 10:7394148-7394170 CCACCATGTCTGGTAGAGACGGG + Intronic
1063657219 10:8003756-8003778 CCACTGTGCCTGGCCAAGACTGG - Intronic
1063665893 10:8060385-8060407 CCACGGTGCCTGGCAGGGGCTGG + Intronic
1063701192 10:8386931-8386953 CCACCATGCCTGGCCTATGCAGG + Intergenic
1064050131 10:12052784-12052806 CCACCGTGCCTGGCCAAGAAAGG + Intergenic
1064269532 10:13852394-13852416 CCACCATGCCTGGTAGAGACAGG + Intronic
1064577559 10:16761567-16761589 CCACCGTGCCCGGCTGAGAATGG - Intronic
1064741905 10:18442435-18442457 CCACCACGCCTGGCCGAATCTGG + Intronic
1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG + Intergenic
1065149782 10:22811062-22811084 CCACCCAGCCTGGCAGGGCCAGG - Intergenic
1065278354 10:24109116-24109138 CTACCGTGCCTGGCCAAGACTGG + Intronic
1065278671 10:24112871-24112893 CCACCACGCCTGGCCATGACTGG + Intronic
1065349986 10:24786762-24786784 ACACCATGCCTGGCCAAGGCAGG + Intergenic
1065831486 10:29618518-29618540 CCACCATGCCTGGCCCAGCCTGG + Intronic
1066085032 10:31967994-31968016 CCACCATGCCCGGCTGAGGCTGG - Intergenic
1066253592 10:33656940-33656962 CCACCATGCCTGGCTGAGATTGG + Intergenic
1066361578 10:34736962-34736984 CCACCATGCCTGGCCAAAATAGG + Intronic
1066384283 10:34929017-34929039 CCACCATGCCTGGCCCATACTGG + Intergenic
1066407283 10:35129907-35129929 CCACCATGCCCGGCCTAAACTGG - Intronic
1066570149 10:36762568-36762590 CCACCATGCCCGGCCTAGACTGG + Intergenic
1067014150 10:42743508-42743530 CCACCATGCCTGGCCAAAAATGG + Intergenic
1067096936 10:43307606-43307628 CCACCATGCCTGGCCAAAACTGG - Intergenic
1067282858 10:44886030-44886052 CCCCCAAGCCTGGCAGGGACAGG + Intergenic
1067537583 10:47125277-47125299 CCACCATGCCCAGCAAAGAAAGG + Intergenic
1067723639 10:48749867-48749889 CCACGAGGCCTGGCAGGGGCTGG - Intronic
1067827289 10:49586255-49586277 CCACCACACCCGGCCGAGACTGG - Intergenic
1067841519 10:49683585-49683607 CCACCATGCCCAGCAGACAATGG - Intronic
1068119947 10:52775007-52775029 CCACCACGCCTGGCTGGGAAGGG - Intergenic
1069214631 10:65804192-65804214 CCACCATGCCCGGCCTGGACAGG - Intergenic
1069493576 10:68882782-68882804 CCACCATGCCCGGCATAAATTGG + Intronic
1069689375 10:70339831-70339853 CCACCATGCCTGGCCGATGTTGG - Intronic
1070196456 10:74161665-74161687 CAACCATTCCTGGCAGAATCAGG + Intronic
1070629869 10:78076827-78076849 CCACCATGCCTGGCCTGCACAGG + Intergenic
1070912239 10:80128688-80128710 CCACCATGCCTGGCCAATAATGG + Intergenic
1070978280 10:80623200-80623222 CCGCCGTGCCTGGCCGAAACTGG + Intronic
1071439424 10:85677301-85677323 CCAGCATGCCTGGCACACAGTGG + Intronic
1071532292 10:86399918-86399940 CCTCCAGGCCTGGCGGGGACAGG + Intergenic
1071572558 10:86705968-86705990 CTACCATGCCAGGCAGAGCAAGG - Intronic
1071943567 10:90615208-90615230 CCACCATGCCTGGCACCAGCTGG - Intergenic
1072157282 10:92735441-92735463 CCACCATGCCTGGCAGATTTTGG + Intergenic
1072159032 10:92749322-92749344 CCACTATGCCTGGCCGAAACTGG + Intergenic
1072193142 10:93092434-93092456 CCACCATGCCTGGCACATAAAGG + Intergenic
1072542662 10:96410227-96410249 GCACCATGCCTGGCATACAGTGG + Intronic
1072734429 10:97869397-97869419 CCACCTTGCCAGCCAGGGACAGG + Exonic
1073082246 10:100867598-100867620 CCACCATGCCTGGCCCAGTGGGG - Intergenic
1073084742 10:100880914-100880936 CCACCATGCCTGGCCGCGAAGGG + Intergenic
1073131100 10:101189756-101189778 CCCCCAAGGCTGGCAGAGGCTGG + Intergenic
1073321956 10:102620990-102621012 CCATCAGGACTGGCAGAGAATGG - Intronic
1073543979 10:104333919-104333941 GCACCGTGCCTGGCGCAGACTGG - Intronic
1073767195 10:106695648-106695670 ACACCATGCCTGGCATAAAGTGG + Intronic
1073773660 10:106762714-106762736 CCATCATGCCTGGGGGAGACTGG + Intronic
1073783664 10:106865434-106865456 CCACCATGCCTGGCCCAGTTTGG - Intronic
1074553957 10:114471180-114471202 TCACCATGTCTGGCAGAGTCTGG + Intronic
1074756474 10:116627673-116627695 CCCCCATCCCTGGCAGGGCCCGG + Intronic
1074875939 10:117613469-117613491 CATCCATCCCTGGCAGAGAAGGG + Intergenic
1074892290 10:117745755-117745777 CCACCTTCCCTGGAAGACACAGG + Intergenic
1075049885 10:119175680-119175702 CCACAGTGCCTGGCTGAGATGGG + Intronic
1075113116 10:119603980-119604002 CCACCATGCCTGGCCTAGACTGG + Intergenic
1075368200 10:121912031-121912053 CCACCATGCCCGGCCAAGCCCGG + Intronic
1075711959 10:124535695-124535717 CCGCCATGCCTGGCCTAGTCTGG + Intronic
1076076554 10:127538052-127538074 CCACCATGGCTGGAAGAGAGTGG + Intergenic
1076314326 10:129530188-129530210 CCACCATGACTGGCCCAGATTGG + Intronic
1076517671 10:131057295-131057317 CCCCGATGCCTGGGAGAGGCAGG - Intergenic
1076660751 10:132054578-132054600 GCACCAGCCCTAGCAGAGACTGG - Intergenic
1076774493 10:132687229-132687251 CCACCAAGCCTGGCCAACACTGG + Intronic
1077021522 11:419198-419220 CCACTTTCCCTGCCAGAGACTGG + Intronic
1077169814 11:1161097-1161119 CCAGCAGCCCTGGCAGAGGCAGG + Intronic
1077274758 11:1699308-1699330 CCACCGCGCCCAGCAGAGACGGG + Intergenic
1077560655 11:3258280-3258302 CCACCTTGCCTGGCACAGGAGGG - Intergenic
1077566551 11:3304108-3304130 CCACCTTGCCTGGCACAGGAGGG - Intergenic
1077961622 11:7081879-7081901 CCACCCTGACTTCCAGAGACAGG - Intergenic
1078269974 11:9786146-9786168 CCACTGCGCCTGGCAGACACTGG + Intronic
1078697244 11:13646796-13646818 CCACCTTGCCTGGCTGAAAAAGG + Intergenic
1078834495 11:15013997-15014019 CCACCATGCCTGGCACCCAATGG + Intronic
1079948359 11:26770597-26770619 CCACCATGCCCAGCTGATACTGG + Intergenic
1079986616 11:27206792-27206814 CCACCATGCCCGGCTAAGGCTGG + Intergenic
1080103777 11:28490224-28490246 CCACCATCCCTGGCAATGCCAGG - Intergenic
1080104913 11:28501810-28501832 CCACCGCGCCTGGCCGAGCCAGG - Intergenic
1080184528 11:29465059-29465081 CCACCATGCCCAGCCGAAACTGG + Intergenic
1080518442 11:33045065-33045087 CCACCATGCCTGGCCAATCCTGG - Intronic
1080834795 11:35930078-35930100 CCACCATGCCTGGCCTGGCCTGG - Intergenic
1080946388 11:36979535-36979557 CCACCATGCCCGGCCTAGCCTGG - Intergenic
1081217186 11:40416092-40416114 CCACCATGACAGGCTGAGAGAGG + Intronic
1081622270 11:44625616-44625638 CCACAGTGCCTGGCATAGAGTGG - Intergenic
1081890736 11:46540117-46540139 CCACCGTGCCCGGCAGTAACTGG + Intronic
1082086530 11:48054895-48054917 CCACCATGCCTGGCTGCCAGCGG - Intronic
1082259272 11:50065003-50065025 CCACCATATCTGGCAAAGATAGG + Intergenic
1082857410 11:57820742-57820764 CCACCATGCCTGGCCCATCCAGG + Intergenic
1083047694 11:59751485-59751507 CCACCACGCCCGGCTGAGATGGG + Intronic
1083224232 11:61274490-61274512 CCACCATACCTGGCAAACACAGG + Exonic
1083455573 11:62776561-62776583 CCACCATGCCCGGCAGCGTTTGG - Intronic
1083549459 11:63575500-63575522 CCTCCATGCCTGGCAGGACCAGG - Intronic
1083641142 11:64146055-64146077 CCACCGTGCCTGGCCAAGAATGG + Intronic
1083837092 11:65277463-65277485 CCAGCATGCCTGGCAGTAATTGG + Intronic
1084150840 11:67287242-67287264 ACAGCATGCCAGGCAGAGAAGGG + Intergenic
1084351254 11:68601442-68601464 CCACACTGCCTGGGAGAGACTGG - Intronic
1084371446 11:68747477-68747499 CCACCATGCCTAGTAGAGACAGG - Intronic
1084377000 11:68784387-68784409 CCACCATGCCTAGTAGAGACAGG - Intronic
1084513883 11:69624947-69624969 CCACCATGCCCAGCCGAGAAAGG + Intergenic
1084726858 11:70947506-70947528 CCACCATGCCTGGCTAATCCTGG + Intronic
1084785341 11:71438676-71438698 CTCCCAGGGCTGGCAGAGACAGG + Intronic
1084984087 11:72852174-72852196 CCATCATGCCTGGCTGAGAATGG + Intronic
1085282707 11:75341423-75341445 CCACCATGCCTGGCCGACAATGG + Intronic
1085482170 11:76831668-76831690 CCACCATGCCCAGCTGATACTGG - Intergenic
1085531300 11:77193779-77193801 GCACCAGGCCAGGCAGAGAAGGG + Intronic
1086965120 11:93019405-93019427 CCACCATGCCTGGCCAATATAGG + Intergenic
1087803063 11:102525165-102525187 CCACCATGCCTGGCCTGGACTGG - Intronic
1087938326 11:104061893-104061915 CCACCATGCCTGGCCGTTTCTGG + Intronic
1088456552 11:110038853-110038875 CCACCATGCCTGGCCAAGAAAGG - Intergenic
1089307792 11:117537507-117537529 CCAACATGAGTGGCAGAGCCTGG - Intronic
1089381014 11:118031848-118031870 CCACCATGCCTGGCCGATGCTGG - Intergenic
1089411090 11:118243479-118243501 CCACCACGCCTGGCCTAGAGAGG - Intronic
1089590186 11:119535113-119535135 CCACCGCGCCTGGCCCAGACTGG + Intergenic
1090059558 11:123452356-123452378 CCACCATGCCTGGCCAAGGAAGG - Intergenic
1091083006 11:132690225-132690247 TCACCATGCCTGGCCAAGCCAGG + Intronic
1091425139 12:381279-381301 CCACCGTGCCCGGCTGAGACAGG + Intronic
1091552683 12:1548737-1548759 CCACCATGCCCGGCTGAGACTGG - Intronic
1091568882 12:1667381-1667403 CCACCACGCCTGGCCCACACTGG - Intergenic
1092023073 12:5218183-5218205 CCAGCATGCCTGACAGGGCCAGG - Intergenic
1092944999 12:13444668-13444690 CCACCATGCCTAGCCTAGGCTGG + Intergenic
1093371231 12:18367839-18367861 CCACCACCCCTGGCTGAGACTGG + Intronic
1094019485 12:25898878-25898900 CCACCATGCCTGGCACACTTAGG + Intergenic
1094203403 12:27816102-27816124 CCACCATACCTGGCTAAGAAAGG + Intergenic
1094637931 12:32244912-32244934 CCACCATGCCCGGCCGACATAGG + Intronic
1094690018 12:32759656-32759678 CCACCATGCCCGGCCGTAACCGG - Intergenic
1096070669 12:48773865-48773887 TCACCAGGCCTGGCACAGAAGGG + Intronic
1096146234 12:49280899-49280921 CCACCACACCTGGTAGAGATGGG - Intergenic
1096168827 12:49449499-49449521 CCACCGTGCCTGGCCCAGTCTGG + Intronic
1096172628 12:49485339-49485361 CCACCATGCCCGGCCGAAATAGG + Intronic
1096248571 12:50011666-50011688 CCACCATGCCCGGCCCACACCGG - Intronic
1096645039 12:53028400-53028422 CCACCACACCTGGTAGAGACGGG - Intronic
1096793511 12:54059965-54059987 CCTCCAGGCCTGGCAGAAAGTGG - Intergenic
1096806152 12:54142367-54142389 CCACTGTGCCTGGCCGAGCCTGG - Intergenic
1097002835 12:55892583-55892605 CCACCACGCCCGGCTGAGAGTGG - Intergenic
1097034247 12:56112239-56112261 CCACCATGCCTGGCTCAAAATGG + Intronic
1097346587 12:58499973-58499995 GCACCATGTCTGGCACATACAGG - Intergenic
1098212650 12:68182683-68182705 CCACCACGCCTGGTAGAGATGGG - Intergenic
1098344382 12:69485753-69485775 CCACCATGCCTGACCTAAACAGG + Intronic
1100438565 12:94594378-94594400 CCACCGTGTCTGGCAGAACCAGG + Intronic
1100612468 12:96202812-96202834 CCACCATGCCTGGCCACCACAGG + Intronic
1100793364 12:98154367-98154389 GCTCCATGCCTGGCACAGATAGG + Intergenic
1101006172 12:100403187-100403209 CCACCACGCCTGGCAGAAAGAGG - Intronic
1101118400 12:101554101-101554123 CCACCATGCCTGGCCCACATAGG + Intergenic
1101145671 12:101838406-101838428 CCACCGTGCCTGGCAGAAGCTGG - Intergenic
1101332150 12:103765827-103765849 CCACCATGCCCGGCTGAGCGGGG + Intronic
1101789806 12:107916247-107916269 CCACCACACCTGGCCCAGACTGG - Intergenic
1102017778 12:109659407-109659429 CCACCATGCCCGGCAGAACTGGG - Intergenic
1102027622 12:109722587-109722609 ACACCAGGCCTGGCAGTGACGGG + Intronic
1102055129 12:109890864-109890886 CCACATTGCCTGGCAAAGCCTGG - Intergenic
1102087269 12:110152876-110152898 CCACCATGCCTGGCTTATTCGGG + Intronic
1102103289 12:110298430-110298452 CCACCACGCCTGGCCAAAACAGG - Intronic
1102299284 12:111759290-111759312 CCACCGTGCCCAGCAGGGACAGG + Intronic
1102498890 12:113337777-113337799 CCACCATGCCTAGCTGAAATAGG + Intronic
1102575585 12:113854242-113854264 ACACCATCCCTGCCAAAGACGGG + Intronic
1102662020 12:114537400-114537422 CCACCTTGCCTGGCCAACACTGG + Intergenic
1102802800 12:115751261-115751283 CCACCATGCCTGGCCTAAGCAGG + Intergenic
1103047987 12:117754348-117754370 CCACCATGCCTGGCCGAGGAAGG - Intronic
1103477990 12:121232658-121232680 TCACCATGCCTAGCAGTGCCAGG - Exonic
1103784237 12:123420310-123420332 CCACTGCGCCTGGCAGAGACGGG + Intronic
1103868495 12:124073277-124073299 CCACTCTGCCTGGCAAAGAACGG + Intronic
1103958760 12:124594405-124594427 CCACCATGCCTTGCAGGGAAGGG - Intergenic
1104348217 12:128021702-128021724 GCACCATGGCTGGCAGAGCTAGG - Intergenic
1104513695 12:129404482-129404504 CCACCATGCCCGGCCAAGACTGG + Intronic
1104849508 12:131864894-131864916 CCACCACGCCTGGCTAATACGGG - Intergenic
1104912309 12:132245152-132245174 CCACCACGCCTGGCTGACATAGG - Intronic
1105522891 13:21147203-21147225 GCACCATGTCTGGCAGAAAGGGG + Exonic
1106119394 13:26846384-26846406 CCACCATGCCCGGCCGTGACTGG + Intergenic
1106254830 13:28012645-28012667 CCACCACGCCTGGCTAAGAGAGG - Intronic
1106377589 13:29204243-29204265 CCACCATGCCCGGCCATGACTGG + Intronic
1106781126 13:33060114-33060136 CCACCATGCCGGGCCAAGACGGG + Intronic
1107589123 13:41883227-41883249 CCTCCATGCCTGGTAAAGAATGG + Intronic
1107644712 13:42482007-42482029 CCACCATGCCCGGCCTACACAGG - Intergenic
1108197185 13:48006912-48006934 CCACCATGCCTGGCTGGGATTGG - Intergenic
1108650217 13:52470870-52470892 CCACCATGCCCGGCCAGGACTGG - Intronic
1109177343 13:59172973-59172995 CCACCATGCCTGGCATCACCTGG - Intergenic
1109347145 13:61127359-61127381 CCACCATGCCTGGCCAAATCAGG + Intergenic
1110370759 13:74737666-74737688 CCACCATACCTGGCCATGACTGG - Intergenic
1110656452 13:78005519-78005541 CCACCATGCCTGGCCCACATAGG + Intergenic
1111968554 13:94885941-94885963 CCACCAAGCCTGGCCTAGACTGG + Intergenic
1111991841 13:95124402-95124424 CCACCATGCCTGGCAGCAGTGGG - Intronic
1112238923 13:97661814-97661836 CCACCAAGCCTTGCAGAGTGAGG + Intergenic
1112239103 13:97663606-97663628 CCACCAAGCCTTGCAGAGTGAGG + Intergenic
1112898840 13:104335305-104335327 CCACCACACCTGGCCGAGAGTGG + Intergenic
1113018576 13:105856609-105856631 CCACCACGCCTGGCACAGGCCGG + Intergenic
1113271059 13:108674961-108674983 GCACCAAGCCTAGCAGAGAGAGG + Intronic
1113389002 13:109877916-109877938 CCACCCTGCCTGCCAGGGAATGG - Intergenic
1114234295 14:20811327-20811349 CCACCGTGCCTGGCCCTGACTGG - Intergenic
1114556880 14:23567311-23567333 CCATCCTGACTGGCAGAGTCCGG + Exonic
1114584912 14:23802382-23802404 CCACCATACCTGTAAGAGAGCGG - Intergenic
1114891218 14:26926033-26926055 CCAGCGGACCTGGCAGAGACTGG + Intergenic
1115058928 14:29167773-29167795 CCACCATGCCTGTCCAAGGCTGG - Intergenic
1115234946 14:31200356-31200378 CCACCGTGCCTGGCCAAGAAAGG - Intronic
1115491249 14:33960324-33960346 CCACCGCGCCCGGCCGAGACAGG - Intronic
1116180466 14:41526046-41526068 CCACCACACCTGGCCCAGACTGG - Intergenic
1116446448 14:45017594-45017616 CCACCACGCCTGGCCAAGAATGG - Intronic
1116455870 14:45119975-45119997 CCACCACGCCTGGCTGGGGCAGG + Intronic
1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG + Intergenic
1117651663 14:57914274-57914296 CCACCATGCCCGGCTGAGACTGG - Intronic
1117685778 14:58251436-58251458 CCACCATGCCTGGCTAAGCCAGG + Intronic
1117986290 14:61389195-61389217 CCATCATGCCTGGCTTAGAGAGG - Intronic
1118302466 14:64627745-64627767 CCACCTTGCCCAGCCGAGACTGG - Intergenic
1118658804 14:67984222-67984244 CCACCATGCCTGGCCAGGGCTGG + Intronic
1119265203 14:73260230-73260252 ACAGCATGCCTGGCACAGAGAGG + Intronic
1119352571 14:73978314-73978336 CCACCATGCCCGGCTGCCACTGG - Intronic
1119750742 14:77075706-77075728 CCACCAAGCCTGGCTGAGATGGG + Intergenic
1120127137 14:80758232-80758254 CCACCATGCCTGGCAGGTTAAGG - Intronic
1120253392 14:82088421-82088443 CCACTATGCCTGGCTGAGACTGG + Intergenic
1120912173 14:89677112-89677134 CCACCATGCGTGGCAGGCCCTGG + Intergenic
1121122219 14:91383220-91383242 ACTCCAGGCCTGGCAGAGCCAGG - Intronic
1121221586 14:92289285-92289307 CCACCATTCCTGGTATAGAGTGG + Intergenic
1121231952 14:92364832-92364854 CAAGCATGTCTGGCACAGACTGG + Intronic
1121246214 14:92462683-92462705 CCACCATGCCCAGCCGAGACAGG + Intronic
1121402810 14:93695737-93695759 CCACCATGCCTGGCTGATGTTGG - Intronic
1121644023 14:95505400-95505422 CCACCTGGCCTGGCAGAGAGTGG - Intergenic
1122158197 14:99763853-99763875 CCACCTTGCATGGCAGAGGTGGG - Intronic
1122225334 14:100273439-100273461 CCACCATGCCTGGCTGATTTTGG + Intronic
1122269988 14:100564724-100564746 CCACAGTGCCTGGCAGAGGCTGG - Intronic
1122497200 14:102166150-102166172 CCACCACGCCTGGCAGAGACCGG + Intronic
1122560938 14:102613841-102613863 CCACCGCGCCTGGCTGAGATAGG + Intronic
1122622959 14:103070253-103070275 CCTCCATGCCGGGCAGGGAAGGG - Intergenic
1122667758 14:103345326-103345348 CCACCACGCGTGGCCGAGAATGG - Intergenic
1123037391 14:105477077-105477099 CCACCCTGCCCGGCAGAATCTGG - Intronic
1123218961 14:106839262-106839284 CCACCACGACTGGCTGAAACCGG - Intergenic
1202904332 14_GL000194v1_random:59776-59798 CCATGCTGCCTGGCAGAGGCTGG + Intergenic
1123698969 15:22900685-22900707 CCACCGTGCCTGGCCGAGCCTGG + Intronic
1124385866 15:29207806-29207828 TCCCCAGGCCTGGCAGGGACTGG - Intronic
1125600210 15:40911442-40911464 CCACCTTGCCTGGCCGGGAGGGG + Intergenic
1125630846 15:41145801-41145823 CCACCATGCCTGGCCGAGCCTGG - Intergenic
1125710477 15:41781488-41781510 CCACCATGCCCGGCATAGCAGGG - Intronic
1125857322 15:42962775-42962797 CCACCACGCCTGGCCAACACTGG + Intronic
1125898565 15:43324327-43324349 CCACCATGCCTGGCCTAGGTGGG - Exonic
1125928936 15:43585901-43585923 CCACCGTGCCTGGCCGAAACAGG - Intronic
1125942103 15:43685736-43685758 CCACCGTGCCTGGCCGAAACAGG - Intergenic
1126480565 15:49114743-49114765 CCACCACGCCTGGCTGAGGAGGG + Intronic
1126527837 15:49677440-49677462 CCACCATGCCTGGCTTGAACTGG + Intergenic
1126547416 15:49888244-49888266 CTACCATGCCAGGTGGAGACGGG + Intronic
1126652530 15:50938766-50938788 CTACCCTGCCTGGGAGAGAGAGG - Intronic
1126746816 15:51834541-51834563 CCACTGTGCCTGGCCGAGAAAGG - Intronic
1127360495 15:58240873-58240895 CCACCATGCCTGGCCGACCCAGG - Intronic
1127542254 15:59952374-59952396 CCACTATGCCTAGTAGAGACGGG - Intergenic
1127822097 15:62667251-62667273 CCACCGTGCCTGGCGAACACTGG + Intronic
1127902295 15:63349814-63349836 CCACAGTGCCTGGCACAGAGTGG + Intronic
1128398168 15:67250462-67250484 CCACCATGCCTGGCACATGGAGG + Intronic
1128587453 15:68862009-68862031 CCACCATAGCTGGCCGAGAGTGG + Intronic
1128814535 15:70597972-70597994 CCATCATGCCTGGCGCACACTGG - Intergenic
1129436789 15:75547951-75547973 CCACCATGCCTGGCCCCTACTGG + Intronic
1129539989 15:76341357-76341379 CCACTTAGCCTGGCAGAGAGGGG + Intronic
1129785955 15:78310246-78310268 CCACCGTGCCTGGCCAAGACTGG + Intergenic
1130001865 15:80054792-80054814 CCACCGCGCCTGGCCGAGGCTGG + Intergenic
1130003004 15:80063973-80063995 CCACCATGTCTGACCCAGACTGG + Intronic
1130048571 15:80464766-80464788 GCAGCATGCCTGGGAGCGACTGG + Intronic
1130212046 15:81933213-81933235 CCACCGTGCCTGGCCCAGAAAGG + Intergenic
1130320107 15:82834321-82834343 CCACCGTGCCTGGCTGATGCTGG + Exonic
1131199066 15:90381093-90381115 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1131253262 15:90844846-90844868 CCACCACGCCTGGCTAAAACTGG + Intergenic
1131486817 15:92827781-92827803 CCACCATGCCCGGCTGAGGAAGG + Intergenic
1131492667 15:92876389-92876411 CCACCATGCCCGGCTGAGGTGGG - Intergenic
1131641160 15:94295235-94295257 CCACCACACCTGGCCGGGACTGG + Intronic
1131708953 15:95032186-95032208 CCACCATTCCTGGCTGAGGGGGG - Intergenic
1132100078 15:99016467-99016489 CCACCATGCTCGGCCGAGAAAGG + Intergenic
1132417588 15:101634144-101634166 TCCCCATGCCTGGCCCAGACTGG - Intronic
1132491166 16:232167-232189 CCACCGTGCCTGGCCAAGACAGG - Intergenic
1132656519 16:1043910-1043932 CCCCCAGGCCTGGGAGAGGCGGG - Intergenic
1132672158 16:1106377-1106399 CCAAGCTGCCTGGCAGAGTCTGG + Intergenic
1132753466 16:1470282-1470304 CCACCATGCCTGGCTCAAAATGG + Intronic
1132828280 16:1915676-1915698 CCCCCACACCTGGCAGACACAGG + Intronic
1132853098 16:2033556-2033578 GCACCAGCCCTGGCAGAGAAAGG - Intronic
1132911849 16:2317796-2317818 CCATCATGGCGGGCAGTGACGGG - Intronic
1133124205 16:3634513-3634535 CCACTGTGCCTGGCCGAGACAGG + Intronic
1133126517 16:3650880-3650902 CAACCCAGCCTGGCAGAGAGAGG + Intronic
1133129615 16:3668717-3668739 CCAGCATGCCTGCCACAGCCAGG + Intronic
1133300733 16:4780971-4780993 CCACCGTGCCCAGCAGAGACAGG - Intronic
1133411048 16:5569135-5569157 CCACCATGCCCGGCTGACATTGG + Intergenic
1133513086 16:6479760-6479782 CCACCGTGCCTGGCCTAGACTGG - Intronic
1133639736 16:7705217-7705239 CCACCATGCCCGGCCCACACAGG - Intronic
1133855915 16:9549099-9549121 CCACCATGCCTGGCCAAGAATGG + Intergenic
1134005089 16:10813716-10813738 CCACCATGCCCGGCCTAGAAAGG - Intronic
1134087252 16:11366046-11366068 CCACCATGCCTGGCTCAGCATGG + Intronic
1134180763 16:12045909-12045931 CCACCGTGCCTGGCCAAGGCAGG + Intronic
1134242253 16:12514575-12514597 CCACCATGTCTGGCCAAGAGAGG - Intronic
1134253098 16:12588540-12588562 CCACCATGCCTGGCTGGATCTGG - Intergenic
1134587064 16:15420861-15420883 CCACTGTGCCTGGCCCAGACAGG + Intronic
1134766488 16:16763279-16763301 CCACCATGCCTGGCCAAAAAAGG + Intergenic
1134831872 16:17330497-17330519 CCACCATGCCTGGCCCAGCAGGG - Intronic
1135026077 16:19000065-19000087 CCACCACGCCGGGCAGAGTCCGG + Intronic
1135034556 16:19066147-19066169 CCACCACGCCCAGCTGAGACTGG - Intergenic
1135094448 16:19553756-19553778 CCACCATGCCTGGCTAATATCGG - Intergenic
1135307511 16:21379672-21379694 CCACCGTGCCTGGCCAAGGCAGG + Intergenic
1135667878 16:24351281-24351303 CCACCATGCCTGGCTGAAACTGG - Intronic
1135799220 16:25476921-25476943 CCACCATGCCTGGCCCAAAGCGG + Intergenic
1135956573 16:26961040-26961062 CTACCATGCCTGGCACAGAGCGG - Intergenic
1136020270 16:27435739-27435761 CCACCATGCCAGGCCCAAACAGG + Intronic
1136099794 16:27985554-27985576 CCACCGTGCCCGGCCGAGACTGG - Intronic
1136304256 16:29358792-29358814 CCACCGTGCCTGGCCAAGGCAGG + Intergenic
1136445288 16:30313769-30313791 CCACCACGCCTGGCTGATATTGG - Intergenic
1136473678 16:30498609-30498631 CCACCATGCCTGGCCAATAATGG - Intronic
1136570733 16:31094961-31094983 CCATCATGCCTGGCAGCCGCTGG - Intronic
1136571261 16:31098349-31098371 CCACCATGCCTGGCCCACAGGGG + Intergenic
1136625126 16:31457743-31457765 CCACCATGCCCAGCCCAGACTGG + Intergenic
1137562930 16:49514569-49514591 GGACCCTGCCTGGCAGAGCCCGG + Intronic
1137625088 16:49902671-49902693 CCACCATGCCTGGCCAACAATGG - Intergenic
1137630182 16:49937775-49937797 CCACCATGCCTGGCCAATCCAGG + Intergenic
1137664003 16:50237607-50237629 CCACCACACCTGGCTAAGACAGG - Intergenic
1137751536 16:50864541-50864563 CCAGCAGGCCTGGCACAGAGGGG - Intergenic
1138089488 16:54162600-54162622 CCACCACATCTGGCTGAGACTGG + Intergenic
1138489732 16:57369736-57369758 CCACATTGCCTGGCACACACCGG + Intergenic
1138525974 16:57607431-57607453 CCACCATGCCTGGCCAGCACTGG - Intergenic
1138552815 16:57756661-57756683 CCACAATCCCTGGCAGGGCCTGG + Intronic
1138754420 16:59465895-59465917 CCACCATGCCTGGCCACAACAGG + Intergenic
1138973426 16:62173696-62173718 CCACCATGCCTGACTTAGAAAGG + Intergenic
1139022034 16:62761446-62761468 CCACCACGCCTGGCCCACACAGG + Intergenic
1139185477 16:64801084-64801106 CCACCGCGCCCGGCCGAGACAGG + Intergenic
1139287215 16:65826303-65826325 CCAGCCTGCCTTGCAGAGAGGGG + Intergenic
1139422361 16:66856543-66856565 CCACCATCCCTGGGAGGGGCTGG - Intronic
1139438659 16:66952406-66952428 CCACCGTGCCTGGCCGAAACCGG - Intergenic
1139460885 16:67121487-67121509 CCACCGTGCCTGGCCAAGAGTGG + Intronic
1139604351 16:68007491-68007513 CCACCGCGCCTGGCCGAGACAGG + Intronic
1139808063 16:69586688-69586710 CCACCATGCCCGGCCTCGACTGG + Intronic
1139973346 16:70790192-70790214 CATCCCTGCCTGGCAGACACGGG - Intronic
1140013417 16:71158976-71158998 CCACCATGCCAGGCCAAGATGGG + Intronic
1140108903 16:71986321-71986343 CCAGCATGCGTGACAGACACGGG + Exonic
1140386692 16:74546547-74546569 CCACCACGCCTGGCCTAGTCAGG - Intronic
1141351316 16:83300577-83300599 GCACCATGCCAGGCAGGGTCTGG + Intronic
1141520787 16:84577530-84577552 CCACCATGCCTGGCCGGAACAGG + Intronic
1141648517 16:85379960-85379982 CCACCATGCTTGGCAGGGCAGGG - Intergenic
1142359001 16:89617538-89617560 CCAGCATTTCTGGCACAGACCGG - Intronic
1142360997 16:89626828-89626850 CCACCGCGCCTGGCCAAGACTGG - Intronic
1142491681 17:283778-283800 CCACCATCCCTCACAGAGACTGG + Intronic
1142571025 17:874300-874322 CCACCGTGCCCGGCTGAGACTGG - Intronic
1142732400 17:1869247-1869269 CCACCATGCCCGGCCGAAACAGG - Intronic
1143025419 17:3938822-3938844 CCACCGTGCCCGGCCAAGACTGG + Intronic
1143580037 17:7820094-7820116 CCACCACGCCTGGCAAAAACTGG + Intronic
1143685955 17:8515829-8515851 CCACCGTGCCTGGCCGGGATTGG + Intronic
1143836004 17:9693546-9693568 CCACCATGCCTGGCTGAATTTGG - Intronic
1143900807 17:10173479-10173501 CCACCGCGCCTGGCCGAGAGAGG - Intronic
1144222423 17:13112217-13112239 CCACCATGCCTGGCCCCGATGGG + Intergenic
1144311594 17:14018979-14019001 CCACCATGCTTGGCCTTGACTGG - Intergenic
1144629725 17:16864849-16864871 CCACCAGGCCTGGCACACATCGG + Intergenic
1144651703 17:17011268-17011290 CCACCAGGCCTGGCACACATCGG - Intergenic
1144696546 17:17307566-17307588 CCACCGTACCTGGCTGAGGCAGG - Intronic
1145868189 17:28254023-28254045 CCACCATGCCTGGCCAGGAGCGG - Intergenic
1145945284 17:28769466-28769488 CCACCGTGCCTGGCCCAAACGGG + Intronic
1146094097 17:29911528-29911550 GCAACTTGCTTGGCAGAGACAGG + Intronic
1146754954 17:35421825-35421847 CCACCGCGCCTGGCCGAGGCAGG + Intronic
1146943834 17:36861082-36861104 CCACCGTGCCTGGCCGACCCAGG + Intergenic
1147003001 17:37378423-37378445 CCACCATGCCTGGCCAAAGCTGG - Intronic
1147114037 17:38285445-38285467 CCACCGTGCCCAGCTGAGACTGG + Intergenic
1147126344 17:38371615-38371637 CCACCATGCCCGGCCGGGACGGG + Intronic
1147263330 17:39221384-39221406 CCACCGCGCCTGGCCAAGACTGG + Intronic
1147349129 17:39826328-39826350 CCACCATGCCTGGCTGTGGATGG + Intronic
1147404559 17:40201610-40201632 CCACCATGCCTGGCCAGGAAGGG - Intergenic
1147609182 17:41791760-41791782 CCACCATGCCTGGCCGATCCTGG + Intergenic
1147759193 17:42786678-42786700 CCACCGTGCCTGGCCGAGTATGG + Intronic
1147780859 17:42940894-42940916 CCACCATGCCCGGCCGAAATCGG - Intergenic
1147844507 17:43395310-43395332 GCACCATGCCTGGCACACATAGG - Intergenic
1147870860 17:43586516-43586538 CCACCATGCCTGGCCTAGGCAGG - Intergenic
1147983444 17:44289557-44289579 ACACCATGCCTGGCTAAGACAGG + Intergenic
1147983590 17:44290842-44290864 CCACCGCACCTGGCTGAGACGGG + Intergenic
1148415568 17:47503745-47503767 CCACCGTGCCCAGCTGAGACTGG - Intergenic
1148465733 17:47864129-47864151 CCACCACGCCTGGCCTACACTGG + Intergenic
1148493784 17:48039832-48039854 CCACCGTGCCCGGCCGACACTGG - Intergenic
1148496833 17:48058116-48058138 CCACCAGGCCTGGCAGAGATGGG - Intronic
1149440220 17:56667630-56667652 CCACCATACCTGGCCTAGTCTGG + Intergenic
1149537805 17:57445947-57445969 GAACAGTGCCTGGCAGAGACAGG - Intronic
1149825335 17:59823160-59823182 CCACCATGCCTGGCCCATTCAGG - Intronic
1149896066 17:60429426-60429448 CCCCCATGCATGGCAGAGCTTGG - Exonic
1149899194 17:60458144-60458166 CCACCATGCCTGGCTGGAAAAGG - Intronic
1149943150 17:60892631-60892653 CCACCATGCCGGGCCGAAAACGG - Intronic
1150586348 17:66522065-66522087 CCACCCTGTATGACAGAGACAGG + Intronic
1150701614 17:67451921-67451943 CCACCACGCCTGGCCGAGACTGG + Intronic
1151966064 17:77432438-77432460 GCACCAGGCCTGACACAGACGGG - Intronic
1152322984 17:79618852-79618874 TCAGCAGGCCTGGGAGAGACGGG + Intergenic
1152492100 17:80642407-80642429 CCACCACACCTGGCCGAGCCTGG + Intronic
1152557279 17:81059736-81059758 CCACCACGCCTGGCTGAAAGAGG + Intronic
1152611826 17:81318772-81318794 CCACCATGCCCGGCCGGCACTGG - Intronic
1152763282 17:82121096-82121118 CCACCATGCCTGGCAACGGCTGG - Intronic
1152765887 17:82138433-82138455 CCACCGCACCTGGCTGAGACGGG + Intronic
1152919862 17:83060823-83060845 CCACCGTGCCCGGCCGAGTCTGG - Intergenic
1153149676 18:2077414-2077436 CCACCATGCCCGGTAGAGATGGG - Intergenic
1153340383 18:3967250-3967272 CCACAGTGCCTGGCAGTGCCTGG - Intronic
1153543901 18:6186327-6186349 CCACCATGCCTGGCCAAAAAGGG + Intronic
1154384611 18:13881486-13881508 CTCCCATGCCTGGCCAAGACAGG + Intergenic
1155061954 18:22236797-22236819 CCACCCTGCCCGGCCGAGAGTGG + Intergenic
1155176125 18:23302758-23302780 CCACCCTGGCTGGCTGAGACTGG - Intronic
1155230371 18:23767858-23767880 CCACCGTGCCTGGCAAGGAAAGG + Intronic
1155699921 18:28731180-28731202 CCACCATGCCCAGCTGAGGCGGG - Intergenic
1156120008 18:33831914-33831936 CCACCGTGCCTGGCCCAGACAGG - Intergenic
1156242120 18:35264857-35264879 CCACCGTGCCTGGCAAAAATGGG - Intronic
1156316945 18:35978331-35978353 CCACCATGCCCGGCCGTGAATGG - Intronic
1156393880 18:36680175-36680197 CCACCATCCCTGGCAGCTACAGG - Intronic
1156505704 18:37590231-37590253 CCACCATGCCTGGCCAACTCTGG + Intergenic
1156652295 18:39238619-39238641 CCACCGTGCCTGGCCGAAAATGG + Intergenic
1156888742 18:42165647-42165669 CAGCCAGGCATGGCAGAGACTGG + Intergenic
1157023506 18:43815367-43815389 CCACCACGCCGGGCCAAGACAGG - Intergenic
1157220753 18:45827201-45827223 CCACCATGCCCGGCAGAGAAAGG + Intronic
1157412447 18:47474815-47474837 CCACCATGGCTGGGTGAGAAAGG + Intergenic
1157850903 18:51050068-51050090 CCACCGTGCCTGGCTGACAGTGG - Intronic
1158231711 18:55263487-55263509 CCACTATGCCTGGCTAAGGCAGG + Intronic
1158361018 18:56673544-56673566 CCACCATGCCTGGCCCAGGAGGG - Intronic
1158426913 18:57348493-57348515 ACACCATGCTTGGCAGACTCAGG - Intergenic
1158560993 18:58513587-58513609 CCACCATGCCTGGCAAATTTGGG - Intronic
1158881477 18:61783330-61783352 CCACCATGCCCGGCCATGACTGG + Intergenic
1158927658 18:62285466-62285488 GCACCATGCCTGACTTAGACAGG - Intronic
1159036984 18:63286778-63286800 GGACCCTGCCTGGCAGAGATTGG - Intronic
1159317222 18:66791559-66791581 CCACCATGCATGACCGATACTGG + Intergenic
1159367081 18:67482039-67482061 GCACCATGCCTCTCTGAGACTGG + Intergenic
1159519165 18:69496016-69496038 CCACAATGCCCTGCAGAGTCAGG - Intronic
1159884172 18:73888535-73888557 CCACCATTCCTGGCTGTGTCAGG - Intergenic
1160753155 19:744604-744626 CCACCATGCCTGGCCATTACAGG - Intronic
1160762031 19:790442-790464 CCACCACACCCGGCCGAGACAGG + Intergenic
1160762412 19:792119-792141 CCACCACCCCTTGCAGGGACAGG + Intergenic
1161123127 19:2541043-2541065 GCACCCGGCCTGGCAGAGACAGG + Intronic
1161178715 19:2864995-2865017 CCACCATGCCTGGCCAACGCTGG - Intergenic
1161373822 19:3928652-3928674 CCACCGTGCCTGGCCGTGAATGG - Intergenic
1161413861 19:4133462-4133484 CCACCGCGCCCGGCTGAGACGGG - Intergenic
1161529799 19:4781327-4781349 CCACCATGTCTGGCCTGGACAGG - Intergenic
1161626742 19:5331418-5331440 CCACCATGCCTGGCAAAATCAGG + Intronic
1161645259 19:5449443-5449465 CCACCATGCCTGGCCAAGACAGG + Intergenic
1161676567 19:5653748-5653770 CCACCATGCCTGGCCGGGGCAGG + Intronic
1161797953 19:6398382-6398404 CCACCGCGCCTGGGTGAGACAGG - Intergenic
1161884687 19:6985394-6985416 CCACCGTGCCCGGCTGAGCCAGG - Intergenic
1162039943 19:7964545-7964567 CCACCATGCCTGGCCCAGAAAGG - Intronic
1162087344 19:8256738-8256760 CCAGCATCCCGGCCAGAGACTGG - Intronic
1162154657 19:8669230-8669252 CCACCAAGCCTGGCCAAGAGAGG + Intergenic
1162209568 19:9080592-9080614 CCACCATGCCCAGCAGAGGTGGG - Intergenic
1162228107 19:9241476-9241498 CCACCAAGCCTGGTCGAGCCGGG - Intergenic
1162244122 19:9384562-9384584 CCACCATGCCTGGCCGGAACTGG + Intergenic
1162274782 19:9644485-9644507 CCACCGTGCCTGGCCGAGACTGG + Intronic
1162356225 19:10186683-10186705 CCACCATGCCTGGCTGATTCTGG - Intronic
1162485352 19:10956968-10956990 CCACCGTGCCTGGTTGAGACAGG + Intergenic
1162603546 19:11689299-11689321 CCACCGCGCCTGGCCCAGACTGG - Intergenic
1162611211 19:11755025-11755047 CCACCATGCCTGGCCCAAAGAGG - Intergenic
1162706141 19:12555979-12556001 CCACCGTGCCTGGCCTACACAGG - Intronic
1162852218 19:13439696-13439718 CCACCGTGCCTGGCCCAGTCTGG + Intronic
1162925216 19:13927489-13927511 CCACCATGCCTGGCCAAGAGTGG - Intronic
1162986185 19:14271714-14271736 CCACCATGCCCGGCCAAGACAGG + Intergenic
1163166285 19:15500275-15500297 CCACCGTGCCTGGCCTAGGCTGG - Intergenic
1163267341 19:16228966-16228988 CCAGGCTGCCTTGCAGAGACAGG - Intronic
1163333302 19:16655391-16655413 CCACCATGCCTGGCCTAATCTGG - Intronic
1163345139 19:16736380-16736402 CCACCATGCTTGGCTTTGACTGG + Intronic
1163507677 19:17717958-17717980 CCACCGTGCCCGGCAGAGATGGG - Intergenic
1163634053 19:18430308-18430330 CCACAATTTCTGGCAGATACAGG + Intronic
1163836647 19:19579061-19579083 CCACCACGCCCGGCCCAGACTGG - Intronic
1163984359 19:20931060-20931082 CCACTGCGCCTGGCAGAGATGGG + Intronic
1164103218 19:22077950-22077972 CCACCGTGCCTGGCCTAGAATGG - Intronic
1164145853 19:22512208-22512230 CCACCATGCCTGGCCGAAGCAGG + Intronic
1164238705 19:23364029-23364051 CCACCATGCCTGGCCTGGCCTGG - Intronic
1164277647 19:23735073-23735095 CCACCAGGCCTGGCTGACAATGG + Intergenic
1164544690 19:29150534-29150556 CTACCATGCCCAGTAGAGACAGG + Intergenic
1164924054 19:32112809-32112831 CCACCATGCCTGGCTAACACTGG + Intergenic
1164930939 19:32175413-32175435 CCACCGTGCCTGGCTGATGCTGG + Intergenic
1164947304 19:32307060-32307082 CCACCGTGCCTGGCCCAGACTGG + Intergenic
1164991787 19:32689917-32689939 CCACCACACCTGGCAGAAACTGG - Intergenic
1165130345 19:33628168-33628190 CCAGCATGCCAGGCAGGCACAGG + Intronic
1165861827 19:38913070-38913092 CCACTATGCTTGGCTGAGAGTGG + Intergenic
1165887422 19:39088308-39088330 CCACCATGCCCAGCAGAGAGAGG + Intronic
1166130413 19:40742650-40742672 CCACCATCCCTGCCAGAGGAGGG - Exonic
1166181439 19:41112033-41112055 CCACCATGTGTGGCCGAGAAGGG - Intergenic
1166392267 19:42415521-42415543 CCACCATGCCCAGCTAAGACTGG - Intronic
1166534405 19:43563197-43563219 CCACCACACCTGGCCCAGACTGG - Intronic
1166706996 19:44913595-44913617 CCACCATGCCTGGCTAATGCAGG + Intergenic
1166709167 19:44926155-44926177 CCACCATGCCTGGCCAATGCAGG + Intergenic
1166851352 19:45763031-45763053 GCTCCAGGCCTGGCAGTGACTGG - Intronic
1166931070 19:46301536-46301558 CCACCATGCCCGGCGGAGGGGGG - Intronic
1166946229 19:46398269-46398291 CCACTGTGCCTGGCTGACACTGG - Intergenic
1166986986 19:46666673-46666695 CCACCGCGCCTGGCCGAGACTGG - Intergenic
1167094395 19:47366566-47366588 CCACTGTGCCTGGCTGACACTGG + Intronic
1167326190 19:48827328-48827350 CCACCGTGCCTGGCAAGGACAGG + Intronic
1167328683 19:48840710-48840732 CCACCATGCCCGGCCGAAAAAGG + Intronic
1167376089 19:49112898-49112920 CCACCTTGCCTGGCCGATACTGG - Intergenic
1167474974 19:49694851-49694873 CCACCATGCCTGGCCAAGGATGG - Intronic
1167553540 19:50177843-50177865 CCACCATGCCCGGCCCAGAGAGG - Intergenic
1167582814 19:50356484-50356506 CCACCACGCCCGGTGGAGACGGG - Intronic
1167640919 19:50680941-50680963 CCACCACGCCTGGCTGATAGTGG + Intronic
1167871566 19:52375022-52375044 CCACCATGCCTGGCCTAGAAGGG + Intronic
1167899699 19:52610568-52610590 CCACCATGCCTGGCCCATTCTGG + Intronic
1168144413 19:54412425-54412447 CCACTGGGCCTGGCCGAGACAGG + Intergenic
1168218841 19:54946076-54946098 CCACCGCGCCCGGCCGAGACAGG + Intronic
1168333209 19:55581199-55581221 ACACAGTGCCTGGCACAGACAGG - Intergenic
1168357435 19:55710796-55710818 CCACCATGCCTGGCAGAGACTGG - Intronic
1168663681 19:58186262-58186284 CTACCGTGCCTGGCAGGGACAGG - Intronic
1168713633 19:58515035-58515057 CCACCACGCCTGGCTGAGACAGG - Intronic
924964452 2:62393-62415 CCACCATGCCTGGCCCAGAGTGG - Intergenic
925616161 2:5746341-5746363 CCACCATGAGTGGCAGCGCCTGG + Intergenic
925819917 2:7790153-7790175 CCACCATGCCTGGCCCAGATTGG - Intergenic
925923584 2:8654546-8654568 CCACCATGCCTGGCCATGATGGG - Intergenic
925923591 2:8654579-8654601 CCACCATGCCTGGCCATGATGGG - Intergenic
925965605 2:9062606-9062628 CCACTGTGCCTGGCTGAGAGGGG - Intergenic
926180217 2:10636173-10636195 CCACCATGCCTGGCCCATCCAGG + Intronic
926218903 2:10922367-10922389 CCATCATGCCGAGGAGAGACTGG - Intergenic
927165509 2:20316743-20316765 CCACCATGCCTGGCCGTGTCTGG - Intronic
927179637 2:20435603-20435625 CCACCGTGACTGGCCGAGAGAGG + Intergenic
927512626 2:23653876-23653898 CCACCGTGCCTGGCCGAAGCTGG - Intronic
927541328 2:23913979-23914001 CCACCATGCCTGGTCCATACTGG - Intronic
927663292 2:25011155-25011177 CCACCATGCCTGGCCTGGCCTGG - Intergenic
927771381 2:25865141-25865163 CCACCATGCCTGGCCTAAATTGG - Intronic
927876783 2:26662005-26662027 CCACCATGCCCGGCCAAGACAGG + Intergenic
928055700 2:28051935-28051957 CCACCATGCCTGGCCAAGTCAGG + Intronic
928099495 2:28427741-28427763 CCACCATGCCTGGCCTAAAATGG + Intergenic
928300911 2:30122727-30122749 ACACCCTGGCTGGAAGAGACAGG - Intergenic
928340496 2:30439317-30439339 CCACCATGCCTGGCTGAGACTGG + Intergenic
928495840 2:31830770-31830792 CCACCATGCCTGGCCGATTTTGG + Intergenic
929555722 2:42924569-42924591 GCACAATGCCTGGCACAGAGTGG + Intergenic
929693709 2:44096549-44096571 CCACATTGCCTGGCAGAGGTAGG - Intergenic
929797544 2:45071833-45071855 CCATCATGCAAGGCAGAGTCAGG - Intergenic
929800515 2:45096339-45096361 CCACCATGCCTGGCAGATCAGGG + Intergenic
929831439 2:45349978-45350000 CCTGAATGCCTGGCAGTGACAGG + Intergenic
930007649 2:46910750-46910772 CCACCATGCCTGGCCTATCCTGG - Intronic
930110101 2:47671579-47671601 CCACCATGCCTGGCCAATATAGG + Intergenic
930377565 2:50587195-50587217 CCACCATGCCTGGCCAAAACAGG - Intronic
930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG + Intronic
930672138 2:54162676-54162698 CCACCATGCCTGGCCTGTACAGG - Intronic
930687777 2:54327416-54327438 CCACCATGCCCGGCATACCCAGG + Intergenic
930840305 2:55837959-55837981 CTACCATGCCTGGCCTAGAATGG + Intergenic
931273564 2:60723768-60723790 CCACCATGCCCGGCCGACTCAGG + Intergenic
931283138 2:60810896-60810918 CCACCATGCCTGGCCGAGACAGG - Intergenic
931338300 2:61372556-61372578 CCACCATGCCTGGCGGAAACAGG - Intronic
931474333 2:62571986-62572008 CCACCATGCCTGACAAATATGGG + Intergenic
931733918 2:65177367-65177389 CCACCACGCCTGGCCGAGTCTGG + Intergenic
931769032 2:65481561-65481583 CCAGCACTCCTGGCACAGACAGG + Intergenic
932282121 2:70502490-70502512 TCACCATGCCTGGCTAAGACGGG + Intronic
932611303 2:73202448-73202470 CCACCTTGCCTCGCACAGAGCGG + Exonic
932624674 2:73287773-73287795 CCACCATTCCTGGCCTGGACAGG + Intergenic
933429421 2:82156477-82156499 CCACCACGCCTGGCCAAGAATGG + Intergenic
933548776 2:83747235-83747257 CCAGCACGCCTGGCTGAGATAGG + Intergenic
933722528 2:85407423-85407445 CCACCATGCCTGGCTGGCACTGG - Intronic
933874037 2:86600672-86600694 CCACCGTGCCTGGCTAAGATGGG - Intronic
934076409 2:88432252-88432274 CCACCACGCCCGGCTGAGACAGG - Intergenic
934654835 2:96112100-96112122 CCACCATCACTGACAGACACGGG - Intergenic
934660645 2:96141840-96141862 CCACCATGCCTGGCCCAGGATGG + Intergenic
935159987 2:100521697-100521719 CCACCATGCCTGGCCTTGTCAGG - Intergenic
935201556 2:100861152-100861174 CCACCATGCCTGGCCCAGCCTGG + Intronic
936253431 2:110887080-110887102 CGTCCTTGCCAGGCAGAGACAGG - Intronic
936475225 2:112833704-112833726 CCACCACGCCTGGCCCAGAGAGG - Intronic
936697210 2:114965287-114965309 CCACCATGCCTGGCTGATTTTGG + Intronic
936947221 2:117941630-117941652 CCACCCTGCCAGGCAGGGACAGG + Intronic
937047696 2:118860684-118860706 CCACATGGCCAGGCAGAGACGGG - Intergenic
937366489 2:121265769-121265791 CCACCGTGCCTGGCCAAGAGTGG + Intronic
937622823 2:124008673-124008695 AAACCATGTCTGGCAGAGAACGG - Intergenic
937821997 2:126320710-126320732 CCACCATGCCTGGCCAAGTGAGG + Intergenic
937880428 2:126860259-126860281 TCACAATGCCTGGCACACACTGG + Intergenic
937892595 2:126950099-126950121 CCACTGTGCTTGGCCGAGACAGG - Intergenic
937917351 2:127105745-127105767 CCACCAGGCCTGGCAGGGGAAGG + Intronic
937926130 2:127168831-127168853 CCACCGTGCCTGGCCCAGAAAGG - Intergenic
937956867 2:127426608-127426630 CCCCCATGCCTGGCAGAGAGGGG - Intronic
938035810 2:128034070-128034092 CCACCATGCCTGGCCAAGATTGG - Intergenic
938090170 2:128426124-128426146 GCCCCAGGCCTGGCAGAGGCAGG + Intergenic
938102991 2:128511170-128511192 GCCCCATGCCTGGCAGTGTCTGG - Intergenic
938721279 2:134069265-134069287 CCACCATGCCTGGCTGCCACTGG - Intergenic
938740242 2:134224789-134224811 CCTCCATGCCTGGCCTAGATTGG - Intronic
938894309 2:135735369-135735391 CCACCATGCCCGGCCGAGAGGGG + Intergenic
938972569 2:136445946-136445968 CCCCAATGCCTGGCACAGAATGG - Intergenic
939475953 2:142686615-142686637 CCACCATGCCCGGCAGTCTCTGG + Intergenic
940229903 2:151439694-151439716 CCACCATGCCTGGCTGAGAATGG - Intronic
940377833 2:152976609-152976631 CCACCACGCCTGGCCGAAAATGG + Intergenic
940888314 2:159010537-159010559 CCAGCATGCCTGCCACAGCCAGG - Intronic
942097429 2:172547210-172547232 CCACCGCGCCTGGCCAAGACGGG + Intergenic
942666391 2:178323748-178323770 CCACCATGCCTGGCCGCCACTGG + Intronic
943248174 2:185483238-185483260 CCACTGAGCCTGGCAGGGACTGG - Intergenic
944541485 2:200757763-200757785 CCACCATGCCCAGCTGAGGCAGG - Intergenic
944545319 2:200793430-200793452 CCACCATGCATAGCAGAGGATGG - Intergenic
944958348 2:204838500-204838522 CCACCATGCCTGGCTGCATCAGG + Intronic
945160918 2:206889641-206889663 CCACCATGCCTGGCCCTGATAGG + Intergenic
945292645 2:208141332-208141354 CCACCACGCCTGGCCTACACTGG - Intergenic
945582233 2:211609694-211609716 ACACCATGCCTGGTAGAGATGGG + Intronic
945854707 2:215055163-215055185 CCACAATTCCTGGCACATACTGG - Intronic
946269785 2:218581455-218581477 CCACCATGCCTGGCCTGGAAAGG + Intronic
947167226 2:227274784-227274806 CCACCATGCCTGGCCGAAGGAGG + Intronic
947505469 2:230705107-230705129 CCACTGTGCCTGGCAAAGCCTGG + Intergenic
947852925 2:233303100-233303122 CCACCATGCCTGGCTGAAGAAGG + Intergenic
947997596 2:234541947-234541969 CCACCATGCCCAGCTGAGACAGG + Intergenic
948011714 2:234654100-234654122 CCACCATGACTGGCCAAGAAAGG + Intergenic
948496835 2:238356207-238356229 CCACCATGCCTGGCCAGGAATGG - Intronic
948545625 2:238726698-238726720 CCACTATGCCTGGCCTAGAATGG + Intergenic
948643911 2:239392085-239392107 CCACCATGCCGGGCAGGGGTGGG + Intronic
948783718 2:240340261-240340283 CCTCCATCCCGGGCAGACACTGG - Intergenic
1169086732 20:2830639-2830661 CCACCATGCCTGGCCCAAGCAGG + Intergenic
1169089908 20:2853101-2853123 CCACCATGCCCGGCTGAAAGTGG - Intronic
1169223263 20:3839599-3839621 CCACCATGCCTGGCCCAGCCAGG - Intergenic
1169838229 20:9904814-9904836 CCATCATGCCTGGCCAAGAGAGG - Intergenic
1169918222 20:10705315-10705337 GTACCTTGCATGGCAGAGACGGG - Intergenic
1170297903 20:14849491-14849513 CCACTGTGCCTGGCTGAGAGAGG - Intronic
1170529808 20:17279632-17279654 CCACTATGCCCAGTAGAGACAGG - Intronic
1170676427 20:18485630-18485652 CCACCATCCCTGGCAAACCCAGG - Intergenic
1171236019 20:23525780-23525802 CCACCACGCCTGGCTCAGCCTGG - Intergenic
1172054488 20:32144620-32144642 CCACCATGCCTGGCCAACAATGG - Intronic
1172088384 20:32407739-32407761 CCACCATGCCTGGCCTGGCCTGG + Intronic
1172105953 20:32517433-32517455 CCAGCATGGCGGGCAGAGATAGG + Intronic
1172165402 20:32895856-32895878 CCACCGTGCCTGGCCCAGGCTGG + Intronic
1172264468 20:33598971-33598993 CCACCATGCCTGGCCGACAGTGG - Intronic
1172718177 20:36979373-36979395 CCACCATGCCCGGCCGATACAGG + Intergenic
1172828970 20:37815603-37815625 CCACCATGCCTGGCCCACATTGG + Intronic
1173690507 20:44957343-44957365 CCACCACGCCTGGTAGAGACAGG + Intronic
1174019503 20:47518710-47518732 CCACCATGCCTGGCCAATAGAGG + Intronic
1174075431 20:47932196-47932218 CAAATATGCCTGGCAGAGGCTGG + Intergenic
1174360831 20:50028043-50028065 CCGCCTGGCCTGGCAGAGCCGGG - Intergenic
1174599750 20:51714653-51714675 CCACCACGCCCAGCAGAGATGGG + Intronic
1174633911 20:51982249-51982271 CCACCGCACCTGGCCGAGACTGG + Intergenic
1174660298 20:52206728-52206750 CCACCATGCCCGGCCGAGACAGG + Intergenic
1174664363 20:52243711-52243733 CCACCGTGCCTGGCAGATGTTGG + Intergenic
1175204857 20:57303649-57303671 ACATCACGCCTGGCCGAGACTGG - Intergenic
1175399786 20:58693499-58693521 CCACCAAGCCTGGAAGGGCCAGG - Intronic
1175592862 20:60207319-60207341 CCACCATGCCTGGCCGAGACTGG + Intergenic
1175689675 20:61056486-61056508 GCACCATGCCCTGCAGAGCCTGG + Intergenic
1175807622 20:61838522-61838544 CCACCGTGCCTGGCCGAGAGAGG - Intronic
1175830461 20:61962569-61962591 CCACCATGCCTGGCCTAGGCGGG - Intronic
1176727059 21:10446480-10446502 CCACTGTGCCTGGCATAGATGGG + Intergenic
1176911602 21:14571808-14571830 ACCCCATGCCTGTGAGAGACTGG - Intronic
1177018134 21:15816842-15816864 CCATCATGCCTGGCAGATTATGG - Intronic
1177446891 21:21209481-21209503 CCACCATGCCTGGCCTAGCTTGG + Intronic
1178092390 21:29178601-29178623 CCAGGATGCCTGGCAGAGCGTGG - Intergenic
1178457127 21:32765851-32765873 CCACCATGCCTGGCCTAGCATGG - Intronic
1178564361 21:33669368-33669390 CCACCATGCCTGGCCCAAACTGG + Intronic
1178628260 21:34236591-34236613 CCACCGTGCCTGGCCCAGATAGG - Intergenic
1178907057 21:36645329-36645351 CCACTGTGGCTGGCCGAGACTGG - Intergenic
1179490168 21:41736122-41736144 GCACCATTCCTGGAACAGACTGG + Intergenic
1179668043 21:42925952-42925974 CCACCGTGCCCGGCTGAGACAGG - Intergenic
1180163478 21:46008301-46008323 CCACCGTGCGTGGCCAAGACTGG + Intergenic
1180287327 22:10760564-10760586 CCACTGTGCCTGGCATAGATGGG - Intergenic
1180623853 22:17180847-17180869 CCACCATGCCTGGCCTATTCTGG - Exonic
1180866685 22:19123603-19123625 CCACCACACCCGGCAGAGTCTGG - Intergenic
1180982149 22:19883664-19883686 CCATCACGCCTGGCTGAGACAGG - Intronic
1181302283 22:21889326-21889348 CCACCGCACCTGGCAGAGGCGGG + Intergenic
1181314817 22:21964307-21964329 GCCCCATGCCTGCGAGAGACAGG + Exonic
1181531263 22:23518850-23518872 CCACCGTGCTGGGCAGTGACAGG + Intergenic
1181802964 22:25359138-25359160 CCACCATGCCTGGCCAGGCCAGG - Intronic
1182028328 22:27137817-27137839 CCTCCTGGCCTGGCAGAGCCAGG + Intergenic
1182329041 22:29537351-29537373 CCACCATTCCCGGCCGAGTCTGG - Intronic
1182338409 22:29600754-29600776 CCACCACACCTGGCACACACTGG + Intergenic
1182368117 22:29792310-29792332 CCAGCATCACTGGCAGGGACAGG - Intronic
1182846484 22:33435287-33435309 CCACCATGCCTGGCTCCTACGGG + Intronic
1183040885 22:35177090-35177112 ACACAGTGCCTGGCACAGACAGG + Intergenic
1183043880 22:35204099-35204121 GCACAATGCCTGGCATAGCCAGG + Intergenic
1183203349 22:36401462-36401484 CCACCACGCTTGGCCGAGCCCGG + Intergenic
1183249352 22:36718557-36718579 CCACCATGCCCGGCTAAGATGGG + Intergenic
1183399459 22:37593563-37593585 CCACCATGCCTGGCCTATACTGG + Intergenic
1183459638 22:37942057-37942079 CCACCAGGTGTGGCAGAGGCAGG - Exonic
1183566767 22:38621047-38621069 CCACCATGCCCGGCCGACTCAGG - Intronic
1183891691 22:40935086-40935108 CCACCATGCCCGGCCAAGCCCGG - Intergenic
1183961244 22:41413141-41413163 CCACCGTGCCTGGCCGAGGCTGG - Intergenic
1183999236 22:41660139-41660161 CCTCCATGCTTGGCAAATACGGG + Intronic
1184026236 22:41858968-41858990 CCACCACGCCCAGTAGAGACGGG - Intronic
1184028872 22:41879146-41879168 CCACCACGCCTGGCTGAGTCAGG + Intronic
1184265635 22:43344255-43344277 CCACCGGGCCTGGGAGGGACGGG + Intergenic
1184273094 22:43395848-43395870 CCACCAGGCCGGGTAGAGCCTGG - Intergenic
1184310944 22:43642226-43642248 CCACCATTCCCGGCTGAGATTGG + Intronic
1184336892 22:43859106-43859128 TCACTGTGCCTGGGAGAGACAGG - Intronic
1184578870 22:45398540-45398562 CCACCATGCCCGGCCGATGCAGG - Intronic
1184840584 22:47050290-47050312 CCACCGCGCCTGGCCGAGAGGGG + Intronic
1184913948 22:47554185-47554207 GTACTATGCCTGGCAGAGTCGGG - Intergenic
1185401160 22:50618099-50618121 CCACCGTGCCTGGCTGAAAGTGG - Intergenic
950221329 3:11198573-11198595 TCAAAATGCCTGACAGAGACTGG + Intronic
950486972 3:13279705-13279727 CCACCAGGCCTGGCTTAGCCTGG + Intergenic
950866089 3:16190349-16190371 CCACCATGCCCGGCCTAGCCAGG - Intronic
951895436 3:27605625-27605647 CCACCACGCCTGGCTGGGATCGG - Intergenic
952551808 3:34486969-34486991 CCACCATGCCTGGCCTAGAAAGG - Intergenic
952655700 3:35782844-35782866 GCACCATGCTGGGCAGAGAAAGG - Intronic
953366136 3:42346851-42346873 CCACCGTGCCTGGCCGACAAGGG + Intergenic
953642870 3:44726103-44726125 CCACCATGCCTGGCCCAGTTTGG - Intergenic
953643154 3:44728325-44728347 CCACCATGCCTGGCCTGGAATGG + Intergenic
954257219 3:49415227-49415249 CCACCATGCCTGGCCAACTCAGG - Exonic
954286025 3:49619905-49619927 CCACAGTGCCTGGCACAAACTGG - Intronic
954380919 3:50218575-50218597 CCTCCCTGCCTGCCACAGACGGG + Exonic
954472135 3:50707206-50707228 CCACCATGCCTGGCCAAGACTGG - Intronic
954701561 3:52453362-52453384 CCATCATGCCTGGCAGGCTCAGG - Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
955079102 3:55641260-55641282 CCACCATGCCTGGCCTATATTGG - Intronic
955307324 3:57846844-57846866 CCACCATGCCTAGCCGAAAATGG + Intronic
955672015 3:61412038-61412060 CCACCGTGCCTGGCCCAGAATGG - Intergenic
955693851 3:61616237-61616259 CCACCATGCCCGGCTGAGAATGG + Intronic
956130789 3:66052060-66052082 CCACCATGCCTGGCTGAGCATGG - Intergenic
956191947 3:66616450-66616472 CCACCATGCCCAGCTGAGAGGGG - Intergenic
957867955 3:86049546-86049568 CCACCGTGCCTGGCCAAGACTGG + Intronic
958006887 3:87823672-87823694 CCACCATGCCCGGCCAAGGCTGG + Intergenic
958104400 3:89053830-89053852 CCACCATGCCTGGAAAAGTGGGG + Intergenic
958767523 3:98387631-98387653 CCACCACGCCTGGCCGTGTCTGG - Intergenic
958999803 3:100950210-100950232 GCACGGTGCCTGGCAGAGAAAGG + Intronic
959096827 3:101965485-101965507 ACCTAATGCCTGGCAGAGACAGG - Intergenic
959383414 3:105671020-105671042 CCACCTTGGCAGTCAGAGACGGG + Intronic
959710073 3:109377047-109377069 CCACCATGCCCGGCCTAGACTGG - Intergenic
959983765 3:112549519-112549541 CCACCGCGCCTGGCTGAAACAGG - Intronic
960004050 3:112763914-112763936 CCACCATGCCTGGTCGCCACTGG - Intronic
960453258 3:117837230-117837252 CCACCATGCCTGGCTCAATCAGG - Intergenic
960666911 3:120118314-120118336 CCACCATGCCTGGCCAAAAAGGG - Intergenic
960813553 3:121649520-121649542 CCACCACGCCTGGCCTAAACAGG + Intronic
961004461 3:123395585-123395607 CCACCATGCCTGGCTGACATGGG - Intronic
961261274 3:125604160-125604182 CCACCATGCCTAGCTGAGATGGG + Intergenic
961359999 3:126360938-126360960 CCACAACTCATGGCAGAGACGGG - Intergenic
962301775 3:134250262-134250284 CCAGCACGGCAGGCAGAGACCGG + Intronic
962801113 3:138891462-138891484 CCACCATGCCCGGCCATGACTGG - Intergenic
963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG + Intronic
963619057 3:147581631-147581653 CCAGGATGCCTGTCAGAGAGGGG + Intergenic
964558652 3:157968468-157968490 CCACCATGCCTGGCTAAGTTTGG - Intergenic
964589541 3:158344929-158344951 CCACCGTGCCTGGCCTAGATTGG - Intronic
964750131 3:160046822-160046844 CCACCATGCCTGGCCAAGTAGGG + Intergenic
965339136 3:167464299-167464321 CCACCATGCCTGGCCAGGAGTGG + Intronic
966184504 3:177215863-177215885 CCACCATGCCTGGCCAGCACTGG - Intergenic
966394542 3:179488695-179488717 CCGCCATGCATGGCCAAGACAGG - Intergenic
966426958 3:179790059-179790081 CCACCATGCCTGGCCCACAAGGG - Intergenic
966984324 3:185165636-185165658 CCACCACGCCTGGAAGAAACAGG + Intergenic
967788530 3:193523013-193523035 CCACCACACCTGGCTGAGAGGGG - Intronic
967798857 3:193632192-193632214 CCACCGTGCCTGGCTGTGATAGG - Intronic
967895456 3:194392345-194392367 CCACTATGCCTGGCCTGGACTGG + Intergenic
967931332 3:194692662-194692684 CCACCATGCCTGGCAAGGCTGGG + Intergenic
968118241 3:196106104-196106126 CCACCGGGCCTGGCCGAGATGGG + Intergenic
968214395 3:196876008-196876030 CCACCATGCCTGGCCAATATTGG + Intronic
968452903 4:683478-683500 CCACCCTGGCTGGCAGAGGCTGG + Intronic
969118376 4:4888794-4888816 CCTCTATGCCTGGCCGACACTGG + Intergenic
969388667 4:6874383-6874405 CCAACATGACTGGCAAAGAAGGG + Intronic
969392569 4:6901280-6901302 TGCCCATGCCTGGCAGAGCCTGG - Intergenic
969633027 4:8349493-8349515 CCACCACGCCTGGCCAAGACAGG - Intergenic
970197011 4:13561099-13561121 CCACCGTGCCTGGCCGCCACAGG + Intergenic
970578654 4:17452689-17452711 TCATCACGCCTGGCTGAGACTGG - Intergenic
970603651 4:17659771-17659793 CCACCGTGCCTGGCTGCAACAGG + Intronic
971320403 4:25600856-25600878 CCACCATGCCTGGCTGGGCAGGG + Intergenic
971333463 4:25701480-25701502 CCACCATGCCCGGCCAACACAGG + Intergenic
971352571 4:25866215-25866237 CCACCATGCCTGGCCCAAAATGG + Intronic
972089185 4:35258324-35258346 CCACCGGGCCAGGGAGAGACAGG - Intergenic
972414500 4:38825082-38825104 CCAACGTGCCTGGCCGAAACTGG + Exonic
972434848 4:39023553-39023575 CCACCATGCCTGGCCTGGTCTGG - Intronic
972545289 4:40074494-40074516 CCACCACGCCTGGCCTACACAGG + Intronic
972569926 4:40301282-40301304 CCACCGCGCCTGGCCTAGACTGG + Intergenic
972624106 4:40779314-40779336 CCACAGTGCCTGGCAGAGACAGG - Intronic
972630635 4:40838754-40838776 CCACCATGCCTGGCAAAAGCAGG + Intronic
972770728 4:42194543-42194565 CCACCGTGCCCGGCCTAGACTGG + Intergenic
972920584 4:43936520-43936542 CCACCATGCCCGGCCATGACTGG - Intergenic
972922840 4:43965502-43965524 CCACCACGCCTGGCCGAAAATGG - Intergenic
973274184 4:48291571-48291593 CCACCCTGCCCAGCAGAGGCAGG + Intergenic
973753052 4:54043132-54043154 CCACCGCGCCTGGCCGAGACAGG - Intronic
973992667 4:56426113-56426135 CCACCGTGCCTGGCAGATACGGG - Intronic
974134985 4:57804004-57804026 CCAGCATGCTTGGCAAAGAAAGG + Intergenic
974435049 4:61846025-61846047 CCACCATACCTGGCCAAGAAAGG - Intronic
974769266 4:66389535-66389557 CCACCATGCCAGGCTAAGATGGG + Intergenic
974912424 4:68138670-68138692 CCACCATGCCTAGCCCACACTGG + Intergenic
975127321 4:70797555-70797577 CCACCGTGCCTGGCCTAGAGTGG - Intronic
976707258 4:88032374-88032396 CCATCGTGCCTGGCCGATACTGG - Intronic
977579889 4:98713679-98713701 CCACCATGCCTGGCCGATTAGGG + Intergenic
977813565 4:101386885-101386907 CCACCATGCCTGGCAGTTGCTGG + Intergenic
977822161 4:101485827-101485849 CCACCATGCCTAGCTAAGATGGG + Intronic
977939405 4:102842820-102842842 CCACCACGCCTGGCCAAAACTGG - Intronic
978177001 4:105743944-105743966 CCACCATGCCTCGCCAAAACAGG + Intronic
978353353 4:107844033-107844055 CCACCGTGCCTGGCAAAAAGAGG - Intronic
978845317 4:113266588-113266610 CCACCATGCCTGGCAGAGATAGG - Intronic
979715322 4:123830571-123830593 CCACCATGCCTGGCTGTGGTAGG + Intergenic
979935605 4:126690699-126690721 CCACCTTGCCTGGCCGGGACTGG - Intergenic
980355898 4:131731211-131731233 CCGCCAGGCTTCGCAGAGACGGG - Intergenic
980358052 4:131741171-131741193 CCGCCATGCTTCTCAGAGACGGG - Intergenic
980358582 4:131743662-131743684 CCGCCAGGCTTCGCAGAGACGGG - Intergenic
980359667 4:131748606-131748628 CCTCCATGCTTCTCAGAGACGGG - Intergenic
980360203 4:131751098-131751120 CCGCCAGGCTTCGCAGAGACGGG - Intergenic
980360747 4:131753573-131753595 CCGCCATGCTTCTCAGAGACGGG - Intergenic
980361830 4:131758528-131758550 CCGCCATGCTTCTCAGAGACGGG - Intergenic
980762961 4:137260826-137260848 CCACCATGCCTGGCCGAGTGGGG - Intergenic
980796966 4:137697643-137697665 CCACCATGCCCGGCCAAGACTGG + Intergenic
980884346 4:138745992-138746014 CCACTTTGCCTGGCCGACACAGG - Intergenic
980955740 4:139427597-139427619 CCACCGCACCTGGCCGAGACTGG + Intergenic
981375275 4:144007923-144007945 CCACCATGCCTGGCTTAGAATGG + Intronic
981385893 4:144130124-144130146 CCACCATGCCTGGCCTGGAATGG + Intronic
981674991 4:147332500-147332522 CCACCATGAGTGGCAGTGCCAGG - Intergenic
981697757 4:147575708-147575730 CCACCATGTCTGGCTGACACTGG + Intergenic
982643606 4:157994161-157994183 CCACCATGCCTGGCAGTTTAAGG - Intergenic
982764176 4:159324313-159324335 CCACCATGCCTGGCACCAATAGG + Intronic
982859877 4:160435088-160435110 CCATCCTGCCTGGCTGACACTGG + Intergenic
983084192 4:163423998-163424020 CTACCATGCCTGGCATACAATGG - Intergenic
983169791 4:164522480-164522502 CCACCATGCCTGGCTCTGTCAGG + Intergenic
983186241 4:164704372-164704394 CCACCACCCATGTCAGAGACAGG - Intergenic
983239047 4:165210227-165210249 GCACAGTGCCAGGCAGAGACAGG - Intronic
983470245 4:168146194-168146216 CCACCATGCCTGGCCTTGAGTGG + Intronic
983739164 4:171106199-171106221 CCACCATGCCTGGCCAACATAGG + Intergenic
983928985 4:173432658-173432680 CCTCCATGCCTGCCTCAGACAGG - Intergenic
984030645 4:174599784-174599806 CCACCGTGCCTGGCCTGGACTGG - Intergenic
984500843 4:180556957-180556979 AAACAATGCCTGGGAGAGACAGG + Intergenic
984701395 4:182820807-182820829 TCTCCATGCCTGGCATAGAGGGG + Intergenic
984890344 4:184486473-184486495 CCACCACGCCTGGCCGAGGCAGG - Intergenic
984987297 4:185343929-185343951 CCAACATGCCTGGCTGAGGGTGG - Intronic
985616924 5:928297-928319 CCACCACGCCCGGCCAAGACTGG - Intergenic
985881569 5:2642301-2642323 CCTCCATGGCAGGCAGGGACTGG - Intergenic
986002658 5:3642451-3642473 TCACCAGGCCTGGCACAGGCGGG - Intergenic
986071369 5:4287931-4287953 CCACCATGCCTGGCTGAGCAAGG + Intergenic
986818597 5:11439959-11439981 CCACCATGCCTGGTCCACACTGG + Intronic
987735518 5:21838270-21838292 CCACCATGCCTGGCCAGCACTGG - Intronic
987863549 5:23513592-23513614 CCACCATGCCTGGCCCAGAGTGG - Intronic
987882644 5:23769192-23769214 CCACCATGCCCGGCCAAAACAGG + Intergenic
987982072 5:25098375-25098397 CCACCGTGCCCGGCAGAACCAGG + Intergenic
988587707 5:32522310-32522332 CCACCACGCCTGGCCGCGATCGG + Intergenic
988603976 5:32664711-32664733 TCACCATGCCCGGCTGAGACAGG + Intergenic
988612656 5:32741876-32741898 CCACCACGCCTGGCTGAGTTGGG + Intronic
989410945 5:41119848-41119870 CCACCATGCCTGGCCGATTTTGG + Intergenic
989744538 5:44812361-44812383 CCACCATGCATGGCACAAATAGG - Intronic
990319131 5:54612548-54612570 CCACCGTGCCTGGCTGAGGGTGG + Intergenic
990412997 5:55559804-55559826 CCACCGCGCCCGGCCGAGACAGG - Intergenic
991008172 5:61852840-61852862 CCAAAATGCCTGGCAGCCACTGG - Intergenic
991714269 5:69436949-69436971 CCACTGTGCCTGGCCGAGATGGG - Intronic
992403311 5:76431535-76431557 CCACCGTGCCCGGCCAAGACTGG - Intronic
993584538 5:89707962-89707984 CCAACTTGCCTGGCAGATAGTGG + Intergenic
994145144 5:96386675-96386697 CCACCATGCCTGGCAAAGTATGG - Intergenic
994626904 5:102231612-102231634 CTACCATGCCTGGTATAGAGTGG - Intergenic
995380186 5:111523106-111523128 CCACCATGCCTGGCTGAGACAGG - Intergenic
995517034 5:112964476-112964498 CCACCATGGCTGGCCAAGGCTGG - Intergenic
996008341 5:118450886-118450908 CCAGCAAGCATTGCAGAGACAGG - Intergenic
996093240 5:119371848-119371870 CCACCACGCCCGGCCGAGATGGG - Intronic
996547059 5:124691115-124691137 CCACCATACCTGGCTGAGACGGG - Intronic
996574147 5:124963393-124963415 CCTCCCTGCCTGGCAGGGAGAGG - Intergenic
996624949 5:125559550-125559572 CCAGCAAGACTGGCTGAGACTGG - Intergenic
997140560 5:131375949-131375971 CCACCATGCCTGGCCAAGATGGG - Intronic
997181221 5:131831260-131831282 CCACCATGCCTGGCCAAAAGAGG - Intronic
997377803 5:133409687-133409709 GCACCAGGCCTGGCACAGATTGG + Intronic
997381907 5:133444389-133444411 CCACCCTGCCTGGCAGTGCCCGG + Intronic
997531381 5:134583571-134583593 CCACCATGCCTGGCTGATTTTGG + Intergenic
997802032 5:136873306-136873328 CTACCACGCCTGGCCGAGACAGG - Intergenic
997998014 5:138602185-138602207 CCACCATGCCAGGCTGAGAGTGG + Intergenic
998015309 5:138726846-138726868 CTACCACGCCTGGCTGAGCCTGG + Intronic
998153100 5:139768433-139768455 CCACCATGCCTGGCCAAGGAAGG - Intergenic
998288843 5:140892507-140892529 CCACCATGACTGGTAGACTCAGG + Intronic
998443670 5:142182180-142182202 CCACTGTGCCTGGCCGGGACTGG - Intergenic
999797470 5:155001928-155001950 CCACCGTGCCTGGCCGAAATAGG - Intergenic
1001454317 5:171848894-171848916 CATTCCTGCCTGGCAGAGACCGG - Intergenic
1001527174 5:172437234-172437256 CCACGAAGCGTGGCAGAGTCGGG - Intronic
1001552917 5:172617430-172617452 CCACCACGCCTGGCTGAGTTAGG - Intergenic
1001624407 5:173118299-173118321 CCACCATGCCTGGCCCTCACTGG + Intronic
1001851525 5:174971081-174971103 CCACCATGCCCCGTAGAGACGGG - Intergenic
1001874653 5:175189083-175189105 CCACCATGCTTGGCCTAGATTGG + Intergenic
1002003120 5:176209676-176209698 CCACCATGCCTGGCATAGACTGG + Intergenic
1002223344 5:177701274-177701296 CCACCATGCCTGGCATAGACTGG - Intergenic
1002392630 5:178927822-178927844 CCACCAAGCCTGGCTGAGTCTGG + Intronic
1002399005 5:178980919-178980941 CCACCATGCCTGGCCAAGGTTGG + Exonic
1002497634 5:179626078-179626100 CCACCATGGCTGGCAATGAAAGG + Intronic
1002783463 6:384081-384103 CCACCAAGCCTGGGAGGCACTGG + Intergenic
1003547232 6:7069706-7069728 CCACCCTGCCTGGCTGAGGTTGG + Intergenic
1003612141 6:7623240-7623262 CCACCATGCCTGGCCGAGCAGGG - Intergenic
1003643096 6:7892144-7892166 CGACCATGACAGGCAGAGCCTGG - Intronic
1003858367 6:10298778-10298800 CCACCATGCCTGGCTGGTTCTGG + Intergenic
1003928813 6:10903259-10903281 CCACCACGCCTGGCCGAGATGGG - Intronic
1004023600 6:11797282-11797304 CCACCCTGCCTCAAAGAGACAGG - Intronic
1004068896 6:12278602-12278624 CCACCATGCCTGGCCCAAGCTGG - Intergenic
1004270170 6:14188216-14188238 CCACCATGCCTGGCTAAGAATGG + Intergenic
1004276847 6:14244213-14244235 CAACCATGCCTGGGAGAGAGGGG + Intergenic
1004277752 6:14253471-14253493 TCACCATGCCTGGCAAGGTCAGG - Intergenic
1004392396 6:15220719-15220741 CCACCATGCCTGGCGAAGCTGGG + Intergenic
1004532710 6:16468474-16468496 CCACCATGCCTGGCCCGGACTGG + Intronic
1004993379 6:21163797-21163819 CCACCATGCCTGGCTGATTTTGG - Intronic
1005346744 6:24897910-24897932 CCACCATGCCTGGCTGAGGCAGG + Intronic
1005435971 6:25812512-25812534 CCACCATTCCCTGCAGGGACTGG - Intronic
1006265876 6:32923076-32923098 CCACCATGCCTGGCCTGAACTGG - Intergenic
1006324538 6:33343599-33343621 CCACCACGCCTGGCCTACACTGG - Intergenic
1006330517 6:33387253-33387275 CCACTATGCCTGGCAGTAATTGG - Intergenic
1006451094 6:34106125-34106147 CCACCATGCCTGGCCATGATGGG - Intronic
1006636417 6:35464522-35464544 CCACCGTGCCCGGCCGAGACAGG + Intronic
1006675092 6:35756851-35756873 CCACCACGCCCGGCCGAGATTGG + Intergenic
1006681961 6:35803725-35803747 CCACCATGCCTGGCTATGCCTGG + Intergenic
1006822633 6:36910438-36910460 CCACCATGCCTGGCCAATAAAGG - Intronic
1007145127 6:39621876-39621898 CCACCACGCCTGGCTGAAATAGG - Intronic
1007339525 6:41181730-41181752 ACACCCTGCCTGGCAAAGACAGG + Intergenic
1007451728 6:41945224-41945246 CCACCGTGCCTGGCCCAGATGGG - Intronic
1007511799 6:42379835-42379857 ACAACATGCCTGGCACAGGCTGG - Intronic
1007536489 6:42595456-42595478 CCACCTTGCCTGGCTGAGGAAGG - Intronic
1007617944 6:43193116-43193138 CCACCCTCCCTGGCAAAGAGCGG - Exonic
1007757192 6:44107496-44107518 CCACCGTGCCTGGCTGAGATGGG - Intergenic
1008277253 6:49555891-49555913 CCACCATGCCTGGCCAAGTGTGG + Intronic
1008683965 6:53903726-53903748 CCACCACACCTGCCAGAGGCTGG - Intronic
1008925368 6:56886486-56886508 CCACCATGCCTGGCTGTTTCAGG - Intronic
1009386931 6:63096308-63096330 CCACCATGCCTGGCCCATATGGG - Intergenic
1009789770 6:68386421-68386443 CCAGGCTGCCAGGCAGAGACTGG + Intergenic
1009953095 6:70419131-70419153 CCACCATGCCTGGCCAAAACAGG - Intronic
1010218563 6:73427586-73427608 CCACCATGCCTGGCCAATACTGG + Intronic
1010470643 6:76223880-76223902 CCATCCTGCCTGTGAGAGACAGG + Intergenic
1011201971 6:84846688-84846710 CCACCGTGCCTGGCCAAGAAAGG - Intergenic
1011287004 6:85735570-85735592 CCACCATGCCTAGCCAATACTGG + Intergenic
1011496942 6:87946160-87946182 CCACGATGCCTGGCAAAGTGAGG + Intergenic
1011667300 6:89647072-89647094 CCACCATGCCTAGATGATACAGG + Intronic
1011962886 6:93113415-93113437 CCACCATGCCCAGCACAGAGTGG + Intergenic
1012697991 6:102413646-102413668 CCACTGTGCCTGGCCAAGACAGG + Intergenic
1013120391 6:107135600-107135622 CCACCATGCCCGGCTAAAACAGG + Intergenic
1013376412 6:109519505-109519527 CCACCATGCCTGACCTAGAATGG - Intronic
1013536442 6:111067080-111067102 CCACCATGCCTTGGAGGTACAGG - Intergenic
1013550535 6:111203444-111203466 CCACCACGCCTGGCCTAGAAGGG - Intronic
1013609543 6:111781373-111781395 GCATCATGCCTGGCATACACTGG + Intronic
1014111954 6:117628285-117628307 CCACCATGCCTGGCCTACATAGG - Intergenic
1014298997 6:119656980-119657002 CCACCATGCCAGCCGGAGAGAGG + Intergenic
1014530785 6:122556924-122556946 CCACCACGCCCGGCTGAGCCTGG - Intronic
1014848200 6:126306416-126306438 CCACCATGCCTGGCCAAAGCTGG - Intergenic
1014888108 6:126807031-126807053 ACACCATGTCTGGCACATACCGG + Intergenic
1015047521 6:128794179-128794201 CCACCATGCCTGGCTCATCCCGG - Intergenic
1015177250 6:130323513-130323535 CCACCATGCCTGGCCTGGACAGG - Intronic
1015279583 6:131418913-131418935 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1015344417 6:132139026-132139048 CCACCATGACTGGCCAATACGGG - Intergenic
1016321380 6:142849804-142849826 CCACCACGCCTGGCCTAGAGTGG + Intronic
1016832719 6:148449355-148449377 TCACCGTACCTGGCTGAGACTGG + Intronic
1016954069 6:149609515-149609537 CCACCATGCCTGGCCGAGACAGG - Intronic
1017134134 6:151133478-151133500 CCATCATGCCTGGCCAAGAGAGG - Intergenic
1017525188 6:155236373-155236395 CCACCATGCCTGGCTGTCATGGG - Intronic
1017603696 6:156110764-156110786 TCACCACCCCTGGCAGAGATGGG - Intergenic
1017791216 6:157801439-157801461 CTACCATGCCTGGCACACAGTGG - Intronic
1017849813 6:158295600-158295622 CCACCATGCCTGGCCAATGCTGG - Intronic
1017874481 6:158513624-158513646 CCACCATGCCCGGCAGTCATAGG + Intergenic
1017999599 6:159567409-159567431 CCACCATGCCTGGCTGTACCAGG + Intergenic
1018198044 6:161371924-161371946 CCACCATGCCTGGCCCAGAAGGG + Intronic
1018554072 6:165032815-165032837 CCACCATGCCTGGCTGAGGCTGG - Intergenic
1018825710 6:167406642-167406664 CCACCATGCCTGGCCTAGTTTGG + Intergenic
1019021711 6:168924090-168924112 CCACCATGCCCGGCCAAGACAGG + Intergenic
1019393058 7:800532-800554 CCACCATGCCCGGCAAGGCCAGG + Intergenic
1019680793 7:2347927-2347949 CCACCACGCCTGGCCCACACTGG + Intronic
1020072533 7:5236933-5236955 CCACCACGCCTGGCCGAGTTGGG - Intergenic
1020084267 7:5302236-5302258 CCACCATACCTGGCTGAGACTGG + Intronic
1020147987 7:5659793-5659815 ACACCAAGCCTGGCAGGGGCAGG + Intronic
1020198966 7:6064376-6064398 CCACCATGCCTGGCCGCCTCAGG + Intergenic
1020232757 7:6332528-6332550 CCACCACGCCTGGCTGAGGGTGG - Intronic
1020266954 7:6567180-6567202 CCACCATGCCTGGCCATGCCTGG - Intergenic
1021063226 7:16140298-16140320 CCACCATGCCAGGCAATGCCAGG + Intronic
1021272400 7:18605965-18605987 CCACCATGCCTGGCTGCCCCTGG + Intronic
1021470412 7:20996166-20996188 CCACAGCGCCTGGCTGAGACTGG + Intergenic
1021574394 7:22094147-22094169 CCGCCATGCCCGGCAGTGCCTGG - Intergenic
1021993052 7:26154826-26154848 CCACCATGGGTGGCCTAGACTGG + Intronic
1022734134 7:33060450-33060472 CCACCATGCCTAGCCATGACTGG + Intronic
1023356408 7:39371464-39371486 CCACCACGCCCGGCCGAGAATGG + Intronic
1023580523 7:41677497-41677519 CCACCATGCCTGGCCCCCACCGG - Intergenic
1024333610 7:48180712-48180734 CCACCATGCGTGGCCGATGCTGG + Intronic
1025210022 7:57014961-57014983 CCACCACACCTGGCTGAGACTGG - Intergenic
1025243342 7:57296611-57296633 CCACCATGCCTGGCCTCGCCCGG - Intergenic
1025611256 7:63077322-63077344 ACAGCAGGCCTGGCAGATACTGG - Intergenic
1025638081 7:63341296-63341318 CCACTATGCCTGGCCAAGATTGG - Intergenic
1025644615 7:63406803-63406825 CCACTATGCCTGGCCAAGATTGG + Intergenic
1025661929 7:63561890-63561912 CCACCACACCTGGCTGAGACTGG + Intergenic
1025774203 7:64544969-64544991 CCACCATGCCTGGCCAACACAGG - Intronic
1026039603 7:66856577-66856599 CCACCGTGCCTGGCCAAGACAGG + Intergenic
1026173036 7:67971450-67971472 CCACCATGCCCGGCCTAGATAGG + Intergenic
1026340304 7:69428903-69428925 CCTCCATGCCAGGGAGCGACAGG + Intergenic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1026701298 7:72648253-72648275 CCACCACGCCTGGCAGAGCAGGG - Intronic
1026830064 7:73605269-73605291 CCACCATGCCTGGCAGGTCTGGG - Intronic
1026944960 7:74309909-74309931 CCACCATGCCTGGCCCAAAGTGG - Intronic
1027003177 7:74668857-74668879 CCACCGTGCCTGGCTAAGAAGGG + Intronic
1027047720 7:75002211-75002233 CCACCATGCCTGGCCAGGAAAGG + Intronic
1027049969 7:75015777-75015799 CCACCGCGCCTGGCCGAGGCAGG - Intronic
1027129706 7:75582200-75582222 CCACCACGCCCGGCTGAGAGAGG - Intronic
1027146097 7:75695860-75695882 CCACCGTGCCTGGCTGGTACTGG + Intronic
1027176715 7:75908628-75908650 CCACCGTGCCTGGCCCAGCCTGG + Intronic
1027192401 7:76004414-76004436 CCACCATGCTTGGCCAAGATAGG - Intronic
1027671392 7:81104135-81104157 CCACCATGCCTGGCCATGATTGG - Intergenic
1028515404 7:91672765-91672787 CTACCATGCCTGGCCCAGACTGG - Intergenic
1029331645 7:99861159-99861181 CCACCATGCCTGGCCTAAACAGG + Intronic
1029525326 7:101090335-101090357 CCACTGCGCCTGGCAGAGCCTGG - Exonic
1029610004 7:101621871-101621893 CCACCATGCCTGGCCAAGGCAGG + Intronic
1029626188 7:101721717-101721739 CCACCGTGCCTGGCACAAACCGG - Intergenic
1029631385 7:101752980-101753002 CCACCATGCCTGGCCCAGGGTGG + Intergenic
1029639294 7:101808818-101808840 CCACCATGCCAGGCCCACACAGG + Intergenic
1029731192 7:102439272-102439294 CCATCCTGGCTGCCAGAGACTGG - Intronic
1030022855 7:105292993-105293015 CCACCACGCCTGGCCAAGCCTGG - Intronic
1030049427 7:105524554-105524576 TCACCATGCCTGGCCCAGATTGG - Intergenic
1030057869 7:105599282-105599304 CCACTACGCCTGGCCAAGACTGG - Intronic
1030208707 7:106975416-106975438 TCACCATGCCTGGCTGAGCAGGG + Intergenic
1030307083 7:108029830-108029852 CCACCACGCCTGGCCAAGAAAGG - Intronic
1030813390 7:114004352-114004374 CCACCATGCCTGGCAGTTTTGGG - Intronic
1030829521 7:114203629-114203651 CCACCATGCCTGGCAGCACCTGG + Intronic
1032164805 7:129537222-129537244 CCACTGTGCCCGGCAGAGAATGG - Intergenic
1032287775 7:130555537-130555559 CCACCGTGCCTGGCTGACACTGG - Intronic
1032577628 7:133072550-133072572 CCACCATGCCTGGCCTTGAGTGG - Intronic
1033073632 7:138227816-138227838 CCACCATGCCTGGCTAAGAAAGG - Intergenic
1033194470 7:139315768-139315790 CCTCCATGCCTGGCCGGAACTGG - Intergenic
1033312084 7:140268780-140268802 CCACCATGCCAGGCCTAGACTGG - Intergenic
1033454732 7:141492489-141492511 GCACAATGCCTGGCACATACTGG + Intergenic
1033686831 7:143647638-143647660 TCCCCATACCTGGAAGAGACAGG + Intronic
1033688903 7:143719669-143719691 TCCCCATACCTGGAAGAGACAGG - Exonic
1033697780 7:143809976-143809998 TCCCCATACCTGGAAGAGACAGG - Intergenic
1033786703 7:144740431-144740453 CCACCATGCCTGGCCTCTACTGG - Intronic
1034145428 7:148867037-148867059 CCACCACGCCTGGCCAAGACTGG - Intronic
1034152810 7:148929951-148929973 GCACGGTGCCTGGCTGAGACAGG - Intergenic
1034510908 7:151533866-151533888 CCACCGTGCCAGGCTGAGACAGG + Intergenic
1034572473 7:151968006-151968028 CCACCATGCCTGGCAAAACTAGG - Intronic
1034904286 7:154930192-154930214 CCACCATGCCTGGCTGAAATTGG + Intronic
1034937971 7:155211936-155211958 CCACCATGCAGGGCTGGGACAGG + Intergenic
1034947873 7:155275426-155275448 CCACCATACCTGGCACAAAAAGG - Intergenic
1035054120 7:156022601-156022623 CCACCGTGCCCGGCCGAGACTGG + Intergenic
1035183629 7:157108864-157108886 CCACCTTGACTGGCAGCAACTGG + Intergenic
1035220676 7:157404791-157404813 CCACCGTGCCTGGCCCAGATGGG + Intronic
1035259683 7:157653490-157653512 CCACCCTCCCTGGCACACACAGG - Intronic
1035960287 8:4128921-4128943 CCACCATGCCCGGCTAAAACAGG - Intronic
1036065835 8:5380476-5380498 CCACCATGCCTGCCATCAACAGG - Intergenic
1036288601 8:7466841-7466863 CCACCCTGCCTGGCCGAGGTTGG + Intergenic
1036332874 8:7844687-7844709 CCACCCTGCCTGGCCGAGGTTGG - Intergenic
1036399484 8:8395511-8395533 CCACCATGCCTGGCCATGTCTGG - Intergenic
1036439578 8:8768615-8768637 CCACCATGCCTGGCCTATTCTGG + Intergenic
1036703671 8:11030750-11030772 CCTCCACGCCTAGGAGAGACTGG - Intronic
1037017650 8:13928570-13928592 CCACCATGTCTGGCTGATTCTGG - Intergenic
1037401016 8:18495530-18495552 CCACCATGCCGGGCCTAGAGTGG - Intergenic
1037574884 8:20192514-20192536 CCACCATGCCTGGCTGTGTCAGG - Intergenic
1037633593 8:20679988-20680010 CCACCACACCTGGCCAAGACAGG - Intergenic
1037688637 8:21164601-21164623 CCCCCAAGACTGGCAGAAACTGG - Intergenic
1038009023 8:23459033-23459055 CCACCATGCCCGGCCTAGTCTGG - Intergenic
1038508230 8:28105092-28105114 CCACCATGTCTGGCCAAGCCTGG - Intronic
1038543845 8:28411041-28411063 CCACTATGCCTAGTAGAGACGGG - Intronic
1039450690 8:37672736-37672758 TCACCATGCCTGGCTGACCCAGG - Intergenic
1039492102 8:37955617-37955639 CCACCAAGCCTGGCCGAGGAAGG - Intergenic
1039681487 8:39742456-39742478 CCACCACGCCCGGCTGAGGCTGG - Intergenic
1039792527 8:40887191-40887213 CCACCGTGCCTGGCCAAAACCGG - Intronic
1039911637 8:41831358-41831380 CCACCATGCCCGGCAAACATGGG - Intronic
1039925439 8:41927497-41927519 CCACCATGCCTGGCCATGTCTGG - Intergenic
1040432292 8:47355241-47355263 CCACCATGCCTGGCCGATGAAGG + Intronic
1040449730 8:47532354-47532376 CCACCACGCCTGGCCCAGAGTGG + Intronic
1040462030 8:47658645-47658667 CCACCAAGTCTGGCCGAGAAAGG - Intronic
1040870216 8:52092851-52092873 CCACCATGCCTGGCCGAGATAGG + Intergenic
1040886383 8:52267784-52267806 CCACCAAGCCTGGCAGCCATGGG - Intronic
1041284762 8:56249046-56249068 CCACCATGCCCGGCCGAGAATGG - Intergenic
1042134980 8:65624209-65624231 CCACCATGCCTAGCAAAAAAAGG - Intronic
1042484923 8:69338379-69338401 CCACCAGGACTGGCAGAGAGTGG - Intergenic
1042816500 8:72883108-72883130 CCATCTGGCCTTGCAGAGACTGG - Intronic
1043468461 8:80537904-80537926 CCACCATGCCTGGCCCTGATGGG - Intergenic
1043793861 8:84510521-84510543 CCACCGTGCCTGGCTGAAGCTGG - Intronic
1044850752 8:96425033-96425055 CCACCACGCCCGGCCCAGACTGG + Intergenic
1045213912 8:100127933-100127955 CCACCATGCCTGGCCTAAGCCGG + Intronic
1045459575 8:102413761-102413783 CCACCACGCCTGGCCGAGATAGG + Intergenic
1045520793 8:102901259-102901281 CCACCATGCCTGGCCATGTCTGG - Intronic
1045589793 8:103581103-103581125 CCACCACACCTGGCCGAGAAGGG + Intronic
1045610505 8:103835386-103835408 CCACCGTGCCTGGCCAAGACTGG + Intronic
1046000393 8:108413957-108413979 CAACCTTACCTTGCAGAGACAGG - Intronic
1046175761 8:110573021-110573043 CCACCATGCCTGGTAGAGATGGG - Intergenic
1046937819 8:119902624-119902646 CCACCATGTCTGGCAGATTTAGG + Intronic
1047262790 8:123276673-123276695 CCACAGTGCCTGGCATATACTGG - Intergenic
1047487582 8:125345866-125345888 CCACCATGCCTGGCTGACCATGG - Intronic
1047673263 8:127171932-127171954 CCCCAATGCATGGCAGAGTCTGG + Intergenic
1048250414 8:132862453-132862475 CCACCCTGCCTGGGAGGGTCAGG + Intergenic
1048301480 8:133254559-133254581 CCACCATGTCCGGCAGAGCTTGG + Exonic
1048316987 8:133369905-133369927 TTTCCATGCCAGGCAGAGACAGG + Intergenic
1048884821 8:138901652-138901674 CCACCATGCCTGGCCTTTACTGG + Intronic
1048942426 8:139413255-139413277 CCACCGTGCCTGGCTGAAAGTGG - Intergenic
1049037312 8:140086632-140086654 CCACCACGCCTGGCCGAGAGAGG - Intronic
1049243480 8:141550224-141550246 TCACCGTGCTTGGCAGATACAGG - Intergenic
1049523185 8:143105434-143105456 CCACCATGCCTGGCCAGGCCAGG + Intergenic
1049542438 8:143214667-143214689 GCACCAGGCCTGGCAGAGGAGGG - Intergenic
1049695145 8:143980032-143980054 CCACCGCGCCCGGCTGAGACGGG - Intronic
1049856638 8:144866256-144866278 CCACCATGCCTGGCCAGGAATGG + Intergenic
1050152429 9:2630079-2630101 CCACCGTGCCTGGCCCAAACTGG + Intronic
1050536351 9:6634115-6634137 CCACCGCGCCCGGCAGAGGCGGG + Intronic
1051504617 9:17813589-17813611 CCACCATGCCTGGCCAGGACAGG - Intergenic
1051577466 9:18633302-18633324 CCACCACACCCGGCCGAGACTGG - Intronic
1051970597 9:22882083-22882105 CCACCATCCCTGGCCCAAACTGG + Intergenic
1053318188 9:37070861-37070883 CCACCATGCCTGGCCTGCACTGG + Intergenic
1053583950 9:39436683-39436705 CCACCATGCCTATCTGAGCCTGG + Intergenic
1054105531 9:60995427-60995449 CCACCATGCCTATCTGAGCCTGG + Intergenic
1054916201 9:70497402-70497424 CCACCGTGCCTGGCCAAGAAAGG + Intergenic
1055383673 9:75737570-75737592 CCACCATGCCAGGCCAAGACTGG + Intergenic
1055892753 9:81141056-81141078 CCACCATGCCTGGCCATGCCTGG - Intergenic
1056378666 9:86037865-86037887 CCACCACGCCTGGCTGGGGCAGG - Intronic
1056593122 9:87980592-87980614 CCACCATGCCCGGCACAGTATGG - Intergenic
1056983188 9:91336342-91336364 CCACCATGCCTGGCCAATCCAGG - Intronic
1057027542 9:91746362-91746384 CCACCATGCCTGGCCTGGCCTGG + Intronic
1057063569 9:92026962-92026984 CCACCGTGCCTGGCCTAGAGAGG - Intergenic
1057613773 9:96569873-96569895 CCACCGCGCCTGGCCGAAACAGG + Intronic
1057811254 9:98258478-98258500 CCACCATGCCTGGCCTCGATAGG + Intergenic
1057974129 9:99586028-99586050 CAACCATGCTTGGCACATACTGG + Intergenic
1057995207 9:99816728-99816750 CCACCATGCCTGGCTGGAATAGG - Intergenic
1058361842 9:104157004-104157026 CCACCATGCCCAGTAGAGATGGG + Intergenic
1058389399 9:104477898-104477920 CCACCATACCTGGCATAGGTAGG - Intergenic
1058697123 9:107568809-107568831 CCACCATGCCTGGCCAAGTCTGG + Intergenic
1058847359 9:108974544-108974566 CCATCATGCCTGGCTGAAATTGG - Intronic
1058906888 9:109489220-109489242 CCACAAGGACTGGCAGAGTCTGG - Intronic
1059151073 9:111950208-111950230 CCACCATGCCCGGCCTAGAGGGG - Intergenic
1059212464 9:112526531-112526553 CCACCTTGCCCAGCCGAGACTGG + Intronic
1059238838 9:112785669-112785691 CCACCACGCCTGGCCGTGCCTGG + Intronic
1059367607 9:113798969-113798991 CCACCATGCCTGGCCTAGCTTGG - Intergenic
1059467761 9:114479773-114479795 CCACCACGCCCGGCTGAGAAAGG - Intronic
1060317138 9:122522731-122522753 GCACACTGCCTGGCACAGACAGG - Intergenic
1060463581 9:123882207-123882229 CCACCATGCCTGGCCCAGTGGGG - Intronic
1060483059 9:124029315-124029337 CCCCGGTGCATGGCAGAGACTGG - Intronic
1060658082 9:125386645-125386667 CCACCATGCCTGGCCTGGAGTGG - Intergenic
1060664521 9:125424775-125424797 CCACCATGCCCGGCAAAGACAGG + Intergenic
1061097863 9:128470341-128470363 CCACCACGCCTGGCCAAGAAGGG - Intronic
1061240937 9:129371935-129371957 CCACCATGCCCGGCCGATAGAGG - Intergenic
1061249197 9:129416590-129416612 CCACCGTGCCAGGCAGTGACAGG - Intergenic
1061501168 9:131003188-131003210 CCACCGTGCCCGGCCGAGATGGG - Intergenic
1061675864 9:132215291-132215313 CCACCATGCCTGGCCCCCACTGG - Intronic
1061910934 9:133723473-133723495 CCACCATGCCTGGCAGAAGAAGG - Intronic
1061990619 9:134156817-134156839 CCAGCATGCCTGGCAGAACAGGG - Intronic
1062013906 9:134281802-134281824 CCACCAGGTCCGGCAGAGCCTGG + Intergenic
1062083935 9:134638909-134638931 CCACAGTGCCTAGCAGAGAGTGG - Intergenic
1062113053 9:134792650-134792672 CCACCATGCCCGGCCCAGAGAGG + Intronic
1062114144 9:134798555-134798577 CCTCCTGGCCTGGGAGAGACAGG + Intronic
1062172687 9:135144237-135144259 CCCCCAGGTCTGGCAGACACGGG + Intergenic
1062429876 9:136522262-136522284 CCACCACGCGCGGCCGAGACTGG + Intronic
1062459404 9:136656621-136656643 CCACTGTGCCTTGCGGAGACTGG + Intergenic
1062616748 9:137400476-137400498 CCACCATGCCCGGCCCAGAATGG - Intronic
1203563220 Un_KI270744v1:74509-74531 CCATGCTGCCTGGCAGAGGCTGG - Intergenic
1185560486 X:1056841-1056863 CCACCACGCCTGGCCAAGTCTGG + Intergenic
1185714971 X:2334315-2334337 CCACCATGCCTGGCTAATATTGG + Intronic
1185740524 X:2528280-2528302 CCACCATGCCTGGCCAAGACTGG + Intergenic
1186574418 X:10750342-10750364 CCACCATGCCTGGGATGGCCAGG - Intronic
1186623230 X:11263677-11263699 CCAGCAGCCCAGGCAGAGACTGG + Intronic
1186880922 X:13865442-13865464 CCACCGTGCCTGGCTGAGAATGG - Intronic
1186884953 X:13903787-13903809 CCACCCTGGCTGCCAGACACAGG - Intronic
1187333086 X:18358382-18358404 TAACTAAGCCTGGCAGAGACTGG + Intergenic
1187379257 X:18785593-18785615 CTACCATGCCTGGCTGCAACTGG - Intronic
1187403664 X:18984182-18984204 CCAGCAGGCCTGGCCGAGGCGGG - Exonic
1187871891 X:23771456-23771478 CCACCGTACCCGGCTGAGACAGG - Intergenic
1188206281 X:27363228-27363250 CCACCGTGCCCGGCCAAGACTGG + Intergenic
1188592615 X:31857089-31857111 CCACCATGCCTGGCCAAGATTGG - Intronic
1188685162 X:33060543-33060565 CCACCACGCCTGGTCGAGACTGG - Intronic
1189066173 X:37811599-37811621 CCACTGTGCTTGGCAGAGAGCGG + Exonic
1189345420 X:40237516-40237538 CCACCATGCCTGGCTAAAAGTGG + Intergenic
1189597522 X:42585049-42585071 CCACCCTGGCTGGGAGAGGCAGG - Intergenic
1189827414 X:44933728-44933750 CCACCATGCCTGGCTAATTCTGG + Intronic
1189903768 X:45736165-45736187 CCACCATGCCTGGCCGAGTCAGG - Intergenic
1190086787 X:47402022-47402044 CCACCATGCCTGACCGAGAACGG + Intronic
1190265757 X:48826570-48826592 CCCCCAGGCCTGGCAGGGCCAGG - Intergenic
1190303230 X:49068077-49068099 CCCCCATACCTGCCAGAGACAGG - Exonic
1190580032 X:51883370-51883392 CCACTCTGCTTGGGAGAGACTGG - Intronic
1190692817 X:52926053-52926075 CCACCACGCCTGGCAAAACCTGG + Intergenic
1190711276 X:53072426-53072448 CCAGCATGCCAGACAGAGAAGGG - Intronic
1190850319 X:54234084-54234106 ACACCATGCCTGGCCTAGAAGGG - Intronic
1191247568 X:58240018-58240040 CCACCATGCCCGGCAAACTCAGG + Intergenic
1191851102 X:65587142-65587164 GCACCATGCATGAAAGAGACTGG + Intergenic
1192259736 X:69498076-69498098 CCACCATGCCTGGCCCACACTGG - Intergenic
1192431577 X:71115994-71116016 CCACCATGCCTGGCCCACTCTGG + Intergenic
1193071503 X:77310809-77310831 CCACCATGCCTGGCCCTGATGGG - Intergenic
1193115414 X:77771088-77771110 CCACCACGCCCGGCCGAGAAAGG - Intronic
1193186847 X:78523430-78523452 CCACCACGCCCGGCACAAACAGG - Intergenic
1193673319 X:84416865-84416887 CCACCATGCCCGGCCAGGACTGG - Intronic
1193978112 X:88148903-88148925 CCACAGTGCCTGTCAGAGCCTGG - Intergenic
1193990850 X:88305249-88305271 CCACCGCGCCTGGCCGAGGCGGG - Intergenic
1194684438 X:96895290-96895312 CCACTATGCCTGGTCCAGACTGG + Intronic
1194760270 X:97788221-97788243 CCACCATGCCTGGCAAATTTTGG - Intergenic
1195004148 X:100670057-100670079 CCACCATGCCTGGCCGCAAAAGG + Intronic
1196728697 X:118920771-118920793 CCACCTCGCCCGGCAGAGATTGG - Intergenic
1196781944 X:119391583-119391605 CCACCGTGCCTGGCCAAGACTGG - Intergenic
1196902278 X:120397084-120397106 CCACCATGCCTGGTTGAGTTTGG - Intergenic
1197046886 X:122008355-122008377 CCACCATGCCTAGCTAGGACAGG + Intergenic
1197166602 X:123384335-123384357 CCACCACGCCTGGCCGAAAAGGG - Intronic
1197296218 X:124722551-124722573 CCACCACGCCTGGCCGAGCTGGG - Intronic
1197659320 X:129152613-129152635 CCACCATGCCTGGCCTAGAATGG + Intergenic
1197762477 X:130037603-130037625 CCACCATGCCTGCCAGCGGCAGG - Intronic
1198227654 X:134660391-134660413 CCACCATGCCTGGCCGAAAGAGG + Intronic
1198253717 X:134906939-134906961 CCACCGTGCCAGGCCGAGGCAGG - Intronic
1198532403 X:137559573-137559595 CCACCATGCCTGGCCCACCCTGG + Intergenic
1199315991 X:146378899-146378921 AGACCATGCCTGGCAGAAAATGG + Intergenic
1199607106 X:149586128-149586150 CCCTGATGCCTGGCAGAGCCTGG + Intronic
1199632016 X:149783240-149783262 CCCTGATGCCTGGCAGAGCCTGG - Intronic
1199828384 X:151523536-151523558 CCACCCTGCCTGGCAAACAAGGG - Intergenic
1199874873 X:151921538-151921560 CCCCGATGCCAGGCAGAGCCTGG - Intronic
1199947089 X:152678990-152679012 CCTTGATGCCTGGCAGAGCCTGG - Intergenic
1199962592 X:152789464-152789486 CCTTGATGCCTGGCAGAGCCTGG + Intergenic
1200095354 X:153656992-153657014 CCACCAAGCTAGGCAGATACAGG - Intergenic
1200417990 Y:2933499-2933521 CCAGCCTGCGTGGCAGAGCCAGG + Intergenic
1200797512 Y:7354857-7354879 CCACTGTGCCTGGCAGAAAAGGG - Intergenic
1200827263 Y:7658206-7658228 CCCCCATGCCAGACAGAGACAGG + Intergenic
1200958314 Y:8972831-8972853 CCCACATGCCGGACAGAGACAGG - Intergenic
1201450786 Y:14111651-14111673 CCACCATGCCTGGCAAATTTTGG + Intergenic
1201513632 Y:14792500-14792522 CCACCATGCCTGGCCTTGAGTGG - Intronic
1201901744 Y:19050568-19050590 CCACCATGCTTGGCCAAGTCTGG + Intergenic