ID: 1168358086

View in Genome Browser
Species Human (GRCh38)
Location 19:55714761-55714783
Sequence GCCACTTCCAAAGCAGAACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168358086_1168358091 10 Left 1168358086 19:55714761-55714783 CCACGTTCTGCTTTGGAAGTGGC No data
Right 1168358091 19:55714794-55714816 GGCGTCCACAGATGGTGGAAGGG No data
1168358086_1168358094 26 Left 1168358086 19:55714761-55714783 CCACGTTCTGCTTTGGAAGTGGC No data
Right 1168358094 19:55714810-55714832 GGAAGGGGCAGAAGAGTCTCTGG No data
1168358086_1168358096 28 Left 1168358086 19:55714761-55714783 CCACGTTCTGCTTTGGAAGTGGC No data
Right 1168358096 19:55714812-55714834 AAGGGGCAGAAGAGTCTCTGGGG No data
1168358086_1168358088 2 Left 1168358086 19:55714761-55714783 CCACGTTCTGCTTTGGAAGTGGC No data
Right 1168358088 19:55714786-55714808 TTTCTCACGGCGTCCACAGATGG No data
1168358086_1168358090 9 Left 1168358086 19:55714761-55714783 CCACGTTCTGCTTTGGAAGTGGC No data
Right 1168358090 19:55714793-55714815 CGGCGTCCACAGATGGTGGAAGG No data
1168358086_1168358092 11 Left 1168358086 19:55714761-55714783 CCACGTTCTGCTTTGGAAGTGGC No data
Right 1168358092 19:55714795-55714817 GCGTCCACAGATGGTGGAAGGGG No data
1168358086_1168358095 27 Left 1168358086 19:55714761-55714783 CCACGTTCTGCTTTGGAAGTGGC No data
Right 1168358095 19:55714811-55714833 GAAGGGGCAGAAGAGTCTCTGGG No data
1168358086_1168358089 5 Left 1168358086 19:55714761-55714783 CCACGTTCTGCTTTGGAAGTGGC No data
Right 1168358089 19:55714789-55714811 CTCACGGCGTCCACAGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168358086 Original CRISPR GCCACTTCCAAAGCAGAACG TGG (reversed) Intronic