ID: 1168358091

View in Genome Browser
Species Human (GRCh38)
Location 19:55714794-55714816
Sequence GGCGTCCACAGATGGTGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168358086_1168358091 10 Left 1168358086 19:55714761-55714783 CCACGTTCTGCTTTGGAAGTGGC No data
Right 1168358091 19:55714794-55714816 GGCGTCCACAGATGGTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168358091 Original CRISPR GGCGTCCACAGATGGTGGAA GGG Intronic