ID: 1168358713

View in Genome Browser
Species Human (GRCh38)
Location 19:55719684-55719706
Sequence CTGTCAGACCAAGAGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168358705_1168358713 23 Left 1168358705 19:55719638-55719660 CCTCATTCTTCAAGCCTCTCGAT 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1168358713 19:55719684-55719706 CTGTCAGACCAAGAGGAAATGGG 0: 1
1: 0
2: 0
3: 15
4: 194
1168358706_1168358713 9 Left 1168358706 19:55719652-55719674 CCTCTCGATTGAAACTATGATGG 0: 1
1: 0
2: 1
3: 4
4: 32
Right 1168358713 19:55719684-55719706 CTGTCAGACCAAGAGGAAATGGG 0: 1
1: 0
2: 0
3: 15
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168358713 Original CRISPR CTGTCAGACCAAGAGGAAAT GGG Intronic
901898732 1:12339521-12339543 CTCTCAGCCCATGAAGAAATTGG + Intronic
903738528 1:25544858-25544880 CTGTAAGGCCAAGAGGGGATGGG - Intronic
904198909 1:28806456-28806478 TTGTCAGACTAGGAGGACATTGG + Intergenic
904604037 1:31689324-31689346 CTGTCAGACAAAAAGGTGATTGG - Intronic
908374690 1:63523351-63523373 CTGTTACACCAGCAGGAAATAGG - Intronic
908727481 1:67192384-67192406 TTGTCAGACCCAGACAAAATAGG - Intronic
910676142 1:89819044-89819066 CTGTAAAAGTAAGAGGAAATTGG - Intronic
911679679 1:100700704-100700726 TTCTCAGCCCATGAGGAAATGGG + Intergenic
912629736 1:111236254-111236276 CTATGAGCCCAAGAGGGAATTGG + Intronic
913189474 1:116401219-116401241 CTGTAAGACCAGGAGGAATTCGG + Exonic
915278110 1:154803648-154803670 GTGTTTGACCAAGAGGGAATGGG + Intronic
916432955 1:164749824-164749846 CTGACAGATCAAGAGGATGTGGG + Intronic
917667977 1:177244000-177244022 CTGTGAGCCCAGGAGGAAAATGG + Intronic
920537124 1:206745077-206745099 AGGGCAGAACAAGAGGAAATGGG - Intergenic
923052994 1:230401848-230401870 CTGGCACACCAAGAGCAAACGGG + Intronic
923125458 1:231030506-231030528 AGGACAGAACAAGAGGAAATGGG - Intronic
923249943 1:232170629-232170651 CTGGCAGTACAAGAGCAAATGGG - Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1067134237 10:43594141-43594163 CTGTGAGACAAAGAGGCCATTGG - Intergenic
1067714625 10:48680818-48680840 CTGATAGACCAACAGCAAATTGG - Intergenic
1069860480 10:71468135-71468157 CTGGCAGAGCTAGAGGAACTGGG - Intronic
1072111821 10:92329242-92329264 CTGGCAAAGCATGAGGAAATAGG - Intronic
1073761582 10:106634589-106634611 CTTTCAGACCAAGAGGAAGGTGG + Intronic
1074049431 10:109868606-109868628 CTTACAGACAAAGAGGTAATGGG - Exonic
1074709249 10:116163467-116163489 CTGACAGCCCAAGAAGAAATGGG - Intronic
1076182290 10:128419552-128419574 CTGCCAGAGGAAGGGGAAATTGG + Intergenic
1076634078 10:131871665-131871687 GAGTCCAACCAAGAGGAAATCGG + Intergenic
1077761658 11:5106676-5106698 CTGTCTGACCAACTGTAAATAGG - Intergenic
1079249951 11:18780126-18780148 CTGACAGAGCCTGAGGAAATAGG - Intronic
1079692593 11:23438508-23438530 CTGAAAGACCAAAAGGAAAGTGG + Intergenic
1080293350 11:30696698-30696720 CTGACAGACCAAAATGTAATTGG + Intergenic
1081447149 11:43141582-43141604 CTGTTAAACAAAGAGAAAATCGG - Intergenic
1084193004 11:67507424-67507446 CTGTCAGTCATAGAGGAGATGGG - Exonic
1084839436 11:71832745-71832767 CTTTCAGACCAGGAGAAAGTGGG + Intergenic
1085610845 11:77947458-77947480 CTCGCAGACCAAGAGAGAATGGG + Intronic
1086084515 11:82941031-82941053 CTGGAAAACCAAGAAGAAATGGG + Intronic
1087715235 11:101601275-101601297 CTGTCAGTCATAGAGAAAATAGG + Intronic
1089689383 11:120177788-120177810 CTGTCTGGCGAAGAGGAAAGTGG - Intronic
1090184259 11:124725924-124725946 CTTGCAGAGCAAGGGGAAATGGG - Intergenic
1090524601 11:127519083-127519105 CTGTCAGACCATGAAAAAACTGG - Intergenic
1092941030 12:13407326-13407348 CTGGCAGACCAACAGGTCATGGG - Intergenic
1094228053 12:28068658-28068680 CTTACAGGCCAAGAGGAAGTGGG + Intergenic
1094369862 12:29726491-29726513 CTGTGAGCTCAAGAGGAAACAGG + Intronic
1094741374 12:33293122-33293144 GTGCAAGACAAAGAGGAAATTGG + Intergenic
1096527553 12:52220550-52220572 TAGTCAGATGAAGAGGAAATAGG + Intergenic
1098580435 12:72093148-72093170 CTTCCAGACCAGGAGGAAGTGGG - Intronic
1098821096 12:75230967-75230989 CTTGCAGACCAAGAAGAAGTAGG - Intergenic
1099794130 12:87375831-87375853 CTTGCAGACCATGAGAAAATGGG - Intergenic
1100551655 12:95651668-95651690 AAATCAGACCAAGAGGAAAAGGG + Intergenic
1101289314 12:103351641-103351663 GAGTCAGACCAAGAAGAAGTCGG + Intronic
1102616259 12:114157226-114157248 ATGTCAGACCAGGAGGATGTTGG + Intergenic
1104430475 12:128711863-128711885 CTGTAAGACCACGAGAAGATAGG - Intergenic
1104747060 12:131217192-131217214 TTGTCAGACCCAGAGGAAACAGG + Intergenic
1106852686 13:33812241-33812263 CTTTCAGACCTAGTGGAAAAAGG + Intergenic
1108851225 13:54732737-54732759 TTGTGAGATCAAGAGGACATTGG + Intergenic
1112459678 13:99592510-99592532 GTGTGAGACTGAGAGGAAATGGG + Intergenic
1115367267 14:32572312-32572334 CTGTCTCTACAAGAGGAAATGGG - Intronic
1116943361 14:50812353-50812375 GGGTCAGACCAAGAGGGAAGTGG - Intronic
1117382733 14:55181212-55181234 GTGTCAGACAAAGAGAAAAAAGG - Exonic
1121330221 14:93044977-93044999 CTGTCAGATCAGGAAGAAAGGGG + Intronic
1122262588 14:100531729-100531751 CTGTCAGAACAGGAGGAGAAAGG - Intergenic
1126568825 15:50128312-50128334 CCTTCAGACCCAAAGGAAATGGG - Intronic
1127764934 15:62175999-62176021 CTGTCAGATCAAGAGAAAAAGGG + Intergenic
1127892691 15:63269262-63269284 CTGTGAGACCAAGAGGAAGGAGG - Intergenic
1128745826 15:70113565-70113587 CAGTAAGGCCAAGAGGAACTGGG + Intergenic
1130238558 15:82163162-82163184 CTGTCAAACCTAGAGGGAAGAGG + Intronic
1132384527 15:101390632-101390654 CTGACAGCCCACAAGGAAATGGG + Intronic
1133531422 16:6658644-6658666 CTGTCAGCCTGAGAGAAAATAGG - Intronic
1133600580 16:7336401-7336423 CTGTCAGACCTGGATGAAATGGG - Intronic
1139016948 16:62701351-62701373 CTATCATAGCAAGAGGAAACAGG - Intergenic
1139506917 16:67403093-67403115 CTGGCAGGCAAAGAGGAAAGGGG + Intronic
1139823694 16:69740531-69740553 CTGTCAGACATAGAGAAAGTAGG - Intergenic
1139835864 16:69838106-69838128 AAGTTAGACCAAGAGGAATTAGG + Intronic
1141138335 16:81481227-81481249 CTGCCAGACCATGAGGATAATGG - Intronic
1144244841 17:13352707-13352729 CTCTCAGTCCAAAAGGAAAGTGG + Intergenic
1144275468 17:13664261-13664283 ATGTTAGACCAAAAGTAAATTGG + Intergenic
1146119043 17:30173569-30173591 CAGTTAGACAAAGAGGAAATAGG - Intronic
1146531049 17:33607989-33608011 CTGTCAGGACAAGAGGAATGGGG + Intronic
1146589229 17:34114146-34114168 CTCTTAGATCAAGAAGAAATTGG + Intronic
1147403599 17:40195296-40195318 CTGTCAGGGCAAGAGGGCATGGG - Exonic
1149300584 17:55301703-55301725 ATTTCAGACCAGGAGGCAATGGG + Intronic
1149481274 17:57005330-57005352 GTGACAAACCAACAGGAAATGGG - Intronic
1150201763 17:63364317-63364339 CTGTCAGACCATTAGAAGATGGG + Intronic
1150948196 17:69770867-69770889 AAGTCACACCTAGAGGAAATAGG + Intergenic
1151136128 17:71947186-71947208 CTGTCAGAATAAGAGCAAAAGGG + Intergenic
1152387902 17:79986164-79986186 CTTTGGGACCACGAGGAAATTGG - Intronic
1154213670 18:12400014-12400036 GTGACAGACAAAGAGGAAAGGGG + Intergenic
1160273147 18:77406101-77406123 CTCTTAGACAAAGAGGAAAGAGG - Intergenic
1161253684 19:3294818-3294840 CTGCCAGAGGAGGAGGAAATGGG + Intronic
1163194030 19:15702027-15702049 TGGTCAGACCAAGAGGCAAGTGG + Intergenic
1164864661 19:31594478-31594500 CTGTAATACCAAGAGGTAATAGG + Intergenic
1165460985 19:35944380-35944402 ATGTCAGACCAAAGGGAATTGGG + Intronic
1166344155 19:42155030-42155052 CTGGCAGAGTACGAGGAAATTGG - Intronic
1168358713 19:55719684-55719706 CTGTCAGACCAAGAGGAAATGGG + Intronic
925109447 2:1321481-1321503 GTGGCAGACCAGAAGGAAATTGG + Intronic
925303184 2:2831381-2831403 CTGTCAGACAAACTGTAAATTGG + Intergenic
927973744 2:27322523-27322545 CTGTCAAGCCAAGAGGAGAGGGG + Intronic
931829131 2:66032417-66032439 CTGTCAGATTAACAGGACATGGG - Intergenic
931851547 2:66256188-66256210 CTTTCAGAACAAGAAGAAATTGG - Intergenic
932093666 2:68828322-68828344 CTGCCAGACCAGGAGGTAGTTGG - Intergenic
934555762 2:95286389-95286411 CTGACATACCAAGAGAAAGTGGG - Intronic
936595732 2:113845753-113845775 ATGTCAGACAATTAGGAAATTGG + Intergenic
937321034 2:120960874-120960896 CTTTAAAAACAAGAGGAAATGGG - Intronic
937604847 2:123786998-123787020 CTGGAATACCTAGAGGAAATGGG - Intergenic
937924634 2:127158208-127158230 CTGTCAGGCCAAGAGTAGAAAGG - Intergenic
939827316 2:147030260-147030282 CTGTCAGACCACCTGGGAATAGG - Intergenic
939853338 2:147326306-147326328 GTGCCAGACAAAGAGGAGATAGG + Intergenic
945469173 2:210207393-210207415 CTGACTGAAGAAGAGGAAATTGG - Intronic
947750297 2:232528614-232528636 CTGCCAGTCGAAGGGGAAATAGG - Exonic
947834842 2:233167701-233167723 CTGTCCAACCAAAAGAAAATGGG + Intronic
1169003336 20:2184556-2184578 CTGTGAGAGCCAAAGGAAATGGG - Intergenic
1170981183 20:21214466-21214488 CTTTGAGACCAAGAGGAATGTGG + Intronic
1171533909 20:25869482-25869504 CAGCCAGACCAAGAGGCAACTGG + Intergenic
1172650958 20:36501018-36501040 CTGTCAGACACAGAGAAAAGTGG + Intronic
1173682255 20:44892353-44892375 CAGACAGAACTAGAGGAAATAGG - Intronic
1173683469 20:44905041-44905063 GTGCCAGACCAAGACGAATTGGG - Exonic
1174035972 20:47668486-47668508 CTGCCACACCAACAGGGAATGGG + Intronic
1174182742 20:48685012-48685034 AAGTCAGGACAAGAGGAAATGGG - Intronic
1177512335 21:22104952-22104974 CTGAAAAACCTAGAGGAAATGGG - Intergenic
1179510934 21:41873103-41873125 CTGTCAGACCTTGAGGGCATGGG - Intronic
1179514468 21:41897304-41897326 CTGCCAGGACAAGAGGAAACGGG + Intronic
1180970502 22:19812448-19812470 CTGCCAGACAAAGAGGAGACAGG + Intronic
1181886291 22:26024727-26024749 CTGCCAGACCTGGAGGAGATAGG + Intronic
1182979527 22:34655440-34655462 CTGTAAGGCCAAGATGAAAGTGG + Intergenic
949813135 3:8029527-8029549 CTTTCAGACCAAGAGCATTTAGG + Intergenic
950581094 3:13862601-13862623 CTGTCTCACCAAGAGGAACCAGG + Intronic
951241890 3:20295737-20295759 CTGACAGCCCCAGAGGATATTGG + Intergenic
951365622 3:21778437-21778459 CTGTGAGATGAATAGGAAATGGG - Intronic
953054990 3:39380973-39380995 CTGTCAGAGCAGGAGGAGGTGGG - Intergenic
953570617 3:44068470-44068492 CTGTCACTCCAAGTGGAGATAGG - Intergenic
955639830 3:61070304-61070326 ATGTCAGAGCAAGAGGTAATTGG + Intronic
955719903 3:61869581-61869603 CTGTCAGACAAAGAGGTGAAGGG - Intronic
955808184 3:62758472-62758494 CAGTCTGACAAAGAGGAAGTGGG + Intronic
956861576 3:73329205-73329227 CTGTAAGACTAAGAGAAAAAGGG - Intergenic
957789155 3:84918138-84918160 CTTTCAAGCCAAGAGAAAATGGG + Intergenic
958770766 3:98422497-98422519 CTGACAGAGCCAGAGGAAACTGG + Intergenic
959710309 3:109379079-109379101 CTGTGAAACCAAGATGAATTGGG - Intergenic
962983790 3:140515702-140515724 CTCTCAGACCACAATGAAATTGG - Intronic
963128051 3:141833386-141833408 TTGTCAGACCCAGATAAAATAGG + Intergenic
963300153 3:143588268-143588290 CTGGCAGGCCTGGAGGAAATTGG - Intronic
963932843 3:151022149-151022171 CTGGGAGACCTAGAGGAAGTTGG - Intergenic
964760312 3:160129293-160129315 TTGTCAGACCCAGACAAAATAGG - Intergenic
969780521 4:9398751-9398773 CTTTCAGACCAGGAGCAAGTGGG + Intergenic
970845114 4:20528232-20528254 AGGTAAGACCAAGAGGAAAATGG - Intronic
970912366 4:21292208-21292230 CAGTCAAACCACTAGGAAATGGG + Intronic
971179166 4:24311893-24311915 TTGTCAGACCCAGATAAAATAGG + Intergenic
973579622 4:52330143-52330165 CTTGCAGGCCAGGAGGAAATTGG - Intergenic
977003780 4:91538960-91538982 CTGACAGAACAAGGGTAAATGGG - Intronic
978731370 4:112030746-112030768 CTGTCAGAGTGAGAGGAAACAGG + Intergenic
979883980 4:126000789-126000811 CTATCAGACCAAGCAGAAAGAGG + Intergenic
981969796 4:150653747-150653769 TTTTCAGAGCAAGAGAAAATGGG - Intronic
982094820 4:151912156-151912178 CTGAGAGACCAAGAGGCAGTGGG + Intergenic
986491371 5:8294514-8294536 TTGTCAGACCCAGATAAAATAGG + Intergenic
986526657 5:8686009-8686031 CTGTGAGACCAAGGGTAACTTGG + Intergenic
988012573 5:25508677-25508699 CTATGAGACCAAGAGGGAAAGGG - Intergenic
988839314 5:35067524-35067546 CTGTCAGACCCAGAGCAGCTGGG + Intronic
989406158 5:41063557-41063579 ATGACAGAACAAGAAGAAATGGG + Intronic
989582426 5:43045330-43045352 CTGTAAGACCAGAAGGCAATTGG - Intergenic
990037721 5:51342496-51342518 CTTCCAAACCAAGAGGAAAAAGG + Intergenic
991204395 5:64033744-64033766 ATTTCAGGCCAATAGGAAATTGG - Intergenic
994613445 5:102074983-102075005 CTGTGTGCCCAAGAGGAAAAGGG - Intergenic
997628660 5:135349424-135349446 CTGCCAGGCCAAAATGAAATCGG - Intronic
999724350 5:154422785-154422807 CTGCCAAAACAAGAGGAGATGGG + Intergenic
999864139 5:155682524-155682546 CTTACAGACCAAGAGAAAATAGG - Intergenic
1002255407 5:177954697-177954719 CTGGCAGACCAATAGGACAATGG + Intergenic
1002482640 5:179513369-179513391 CTGGCAGACCAATAGGACAATGG - Intergenic
1003156544 6:3601778-3601800 CTTACAGACCAAGAGAGAATGGG - Intergenic
1004056812 6:12147263-12147285 GTGTCAGAACATGAAGAAATGGG - Intronic
1005071793 6:21868813-21868835 CTCTCAGACCCAAAGGAAATGGG - Intergenic
1005158391 6:22834467-22834489 CTGTGAGACCAAGATGCAAGTGG + Intergenic
1005832743 6:29683571-29683593 TTGTCAGACCCAGATAAAATAGG - Intergenic
1011283823 6:85703789-85703811 CTCTCAGTTCAAGAGGTAATTGG + Intergenic
1013083202 6:106831000-106831022 CTGTGAGACCCAGACAAAATAGG - Intergenic
1016380602 6:143474499-143474521 TAGTCAGACAAAGAAGAAATAGG - Intronic
1017001371 6:149999847-149999869 CTGTCAGAACCAGAGGGAAAGGG - Intergenic
1024954472 7:54902090-54902112 CTGTCAGGCAAAGAGAAATTGGG - Intergenic
1026956194 7:74377693-74377715 CTGTCAGCCCCACAGGGAATGGG - Intronic
1029180029 7:98693670-98693692 CTGTAGGACCAAGAGGACAGGGG + Intergenic
1030094907 7:105889904-105889926 CTATGAGGCCATGAGGAAATGGG - Intronic
1033755118 7:144392109-144392131 CTGTTAGACGAGGAGGACATGGG + Intergenic
1036619457 8:10415092-10415114 CTGTCTGAGCCAGAGCAAATGGG + Intronic
1041178429 8:55221869-55221891 CTGTCAGTTCATGAGGAAAGAGG + Intronic
1041712563 8:60907685-60907707 CTGTCTGACCAATGGGAAATCGG + Intergenic
1043501680 8:80864491-80864513 ATTTCAAACAAAGAGGAAATTGG - Intronic
1044765086 8:95563064-95563086 CTGTCAGCCAGAAAGGAAATGGG + Intergenic
1045413624 8:101944691-101944713 TTGTCAGGCAAAGAGGGAATAGG - Intronic
1047970726 8:130082071-130082093 CAGTCAGACCAGGAGGTGATAGG - Intronic
1048312690 8:133337869-133337891 GTGTAAGACCAGGAGGAAAGGGG + Intergenic
1048770158 8:137886524-137886546 GCTGCAGACCAAGAGGAAATTGG + Intergenic
1052029504 9:23612054-23612076 CTCAGAGACCCAGAGGAAATGGG + Intergenic
1053234520 9:36440933-36440955 CTGTCAGACCATGAGGCATTTGG - Intronic
1054707908 9:68481450-68481472 CTGGCATACCAAGAGTTAATTGG + Intronic
1056549782 9:87642646-87642668 ATGTCAAACCTAGAGGAAGTGGG + Intronic
1057481741 9:95449941-95449963 CTGGGAGATCAAGAGGAAACGGG + Intronic
1058181279 9:101803164-101803186 AAGTCAGACCCTGAGGAAATGGG + Intergenic
1058512501 9:105735608-105735630 CTTACAGGCCAAGAGAAAATGGG - Intronic
1059351657 9:113669724-113669746 ATGTAAGCCCAAGAGGAAAAGGG - Intergenic
1060396939 9:123322876-123322898 CTGGCAGACAGAGAGGAAGTGGG + Intergenic
1061729493 9:132602574-132602596 CTTCCAGACCTAGAGGAAACTGG + Intronic
1185713277 X:2321333-2321355 GTGTCAGCCCAAGAGGGAAGAGG + Intronic
1186166343 X:6830276-6830298 CTCTCACACCAAGATGTAATTGG + Intergenic
1186950511 X:14619403-14619425 ATATGAGATCAAGAGGAAATAGG - Intronic
1187779742 X:22806170-22806192 CTTACAGACCATGAGAAAATGGG + Intergenic
1189619472 X:42820519-42820541 GTGTCAGAACAAGTGGAGATTGG + Intergenic
1195167747 X:102237041-102237063 GTGTGAGACAAAGAGAAAATGGG - Intergenic
1195191110 X:102450046-102450068 GTGTGAGACAAAGAGAAAATGGG + Intronic
1196013917 X:110917365-110917387 CGTTGAGACAAAGAGGAAATGGG + Intergenic
1198030622 X:132750408-132750430 GTATCACACCAACAGGAAATGGG + Intronic
1199673706 X:150166947-150166969 CTGTCACACCAAGAAGATACTGG + Intergenic
1201339713 Y:12921392-12921414 CTGTGAGACCAAGTGCAAAACGG - Intergenic