ID: 1168360395

View in Genome Browser
Species Human (GRCh38)
Location 19:55734964-55734986
Sequence CTAATGAGTGATGAGAAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 231}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168360391_1168360395 12 Left 1168360391 19:55734929-55734951 CCAGCCACAAAATATATATTTTA 0: 1
1: 0
2: 16
3: 168
4: 1147
Right 1168360395 19:55734964-55734986 CTAATGAGTGATGAGAAATGGGG 0: 1
1: 0
2: 1
3: 19
4: 231
1168360389_1168360395 18 Left 1168360389 19:55734923-55734945 CCATGCCCAGCCACAAAATATAT 0: 1
1: 9
2: 63
3: 492
4: 2148
Right 1168360395 19:55734964-55734986 CTAATGAGTGATGAGAAATGGGG 0: 1
1: 0
2: 1
3: 19
4: 231
1168360388_1168360395 21 Left 1168360388 19:55734920-55734942 CCACCATGCCCAGCCACAAAATA 0: 2
1: 50
2: 326
3: 1876
4: 7574
Right 1168360395 19:55734964-55734986 CTAATGAGTGATGAGAAATGGGG 0: 1
1: 0
2: 1
3: 19
4: 231
1168360390_1168360395 13 Left 1168360390 19:55734928-55734950 CCCAGCCACAAAATATATATTTT 0: 1
1: 0
2: 31
3: 187
4: 1343
Right 1168360395 19:55734964-55734986 CTAATGAGTGATGAGAAATGGGG 0: 1
1: 0
2: 1
3: 19
4: 231
1168360392_1168360395 8 Left 1168360392 19:55734933-55734955 CCACAAAATATATATTTTATGCA 0: 1
1: 1
2: 6
3: 106
4: 1087
Right 1168360395 19:55734964-55734986 CTAATGAGTGATGAGAAATGGGG 0: 1
1: 0
2: 1
3: 19
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168360395 Original CRISPR CTAATGAGTGATGAGAAATG GGG Intronic
900215165 1:1477651-1477673 CTGCTGAGTGAAAAGAAATGAGG - Intronic
900220119 1:1503924-1503946 CTGCTGAGTGAAAAGAAATGAGG - Intergenic
901540387 1:9911407-9911429 CAAATGAGTAAAGAGTAATGTGG - Intergenic
908157628 1:61371149-61371171 CTAAAGAGTGTTAAGACATGAGG - Intronic
908834149 1:68211705-68211727 CTCATGAGTGGTGAGAAATGGGG - Intronic
909367981 1:74850584-74850606 CTAATGTTTGATTAGAAACGTGG + Intergenic
909998361 1:82309370-82309392 CCAATGAGTTTTGAGAAATCTGG + Intergenic
910056158 1:83035198-83035220 CTAATGAGTCATGAGAAGAAGGG + Intergenic
910109865 1:83671454-83671476 CTACTGTTTGATGAGTAATGGGG + Intergenic
911512679 1:98826993-98827015 CTAATGAGGTCTCAGAAATGAGG + Intergenic
913363766 1:118012711-118012733 CTACGGAGTAATGATAAATGCGG + Intronic
914420691 1:147526009-147526031 CTGGAGAGTGATGGGAAATGAGG + Intergenic
915228504 1:154428850-154428872 CTAAGGAGTGGGGAGAGATGAGG + Intronic
915993779 1:160544093-160544115 ATAATGAGTGGTCATAAATGTGG - Intronic
916894222 1:169145125-169145147 TTAATGGGTAATGAGAAAAGTGG + Intronic
917179209 1:172276155-172276177 CTCAAGAGTGATGATAAATTAGG - Intronic
920969331 1:210729496-210729518 TTCTTGAGTGAAGAGAAATGTGG - Intronic
921124950 1:212169276-212169298 CTGTTGAGTGGTGAGAAGTGAGG - Intergenic
921774806 1:219084634-219084656 CTAATGAGTGCTGTGAAAGCAGG - Intergenic
923469832 1:234280671-234280693 GTGGTGAGTGCTGAGAAATGTGG - Intronic
924646882 1:245886309-245886331 CTAATAAGTAAGGAGAGATGTGG - Intronic
1065042876 10:21715656-21715678 ATAATGAATGAGAAGAAATGGGG - Intronic
1065340697 10:24702051-24702073 CTAATCAGTGTTTAGAAATAGGG - Intronic
1065774462 10:29106576-29106598 CTGAGGACAGATGAGAAATGTGG - Intergenic
1069268861 10:66498534-66498556 CTAACAAGTGATACGAAATGTGG - Intronic
1069282825 10:66676988-66677010 GTACTGAGTGGTCAGAAATGGGG + Intronic
1070556907 10:77535267-77535289 CTGATGAGTCCTGAGATATGTGG - Intronic
1071691658 10:87826433-87826455 TTAATGAGAGATCAGAAAAGGGG + Intronic
1073110823 10:101062161-101062183 CTAATGGGGGGTGAGAACTGGGG - Intronic
1073653731 10:105389749-105389771 CTAATTAGTGATGAGAAAAAGGG - Intergenic
1074173299 10:110967620-110967642 TTAATGAGTTAGGAGAAATTAGG - Intronic
1074253619 10:111778475-111778497 TTAAGGAGTGCTGAGAGATGAGG - Intergenic
1075243878 10:120802874-120802896 TTAAAGATTGGTGAGAAATGAGG + Intergenic
1077870135 11:6255094-6255116 AAAATGAGGAATGAGAAATGTGG - Intergenic
1079429356 11:20374109-20374131 CTTGTGAGTGATGGGAAAGGAGG + Intronic
1082620711 11:55418163-55418185 CTTCTGGGTGATGAGAAATGTGG + Intergenic
1084774196 11:71364726-71364748 CTAATGAGTGAGGACACAGGTGG + Intergenic
1084961645 11:72719993-72720015 ATATTGAGTGATCAGAATTGTGG - Intronic
1085625802 11:78071893-78071915 ATGATGAGTGATGAGGAATGAGG + Intronic
1085859243 11:80212841-80212863 GTAATGGGAGATGAGGAATGAGG - Intergenic
1086527391 11:87744056-87744078 ATAATGAGTGAAGACAAAAGAGG - Intergenic
1088729865 11:112671149-112671171 CTAACCAGTGAGGAGAAGTGAGG - Intergenic
1088969442 11:114760055-114760077 CTAATGAGTGCAGAGAAAAAAGG - Intergenic
1091870348 12:3884763-3884785 ATCATGAGTGATTAGAAATCTGG + Intergenic
1092079369 12:5701677-5701699 CTAAGGAGTGGTGAGAAAGCTGG - Intronic
1094424697 12:30305743-30305765 CACATGAGGGATGAGAAAGGAGG + Intergenic
1097781056 12:63705011-63705033 CTAAAGAGAGAAGATAAATGGGG + Intergenic
1098625214 12:72657737-72657759 ATATAGAGAGATGAGAAATGGGG + Intronic
1098717489 12:73849452-73849474 ATAATGAAAAATGAGAAATGAGG - Intergenic
1098770672 12:74548959-74548981 GTAATGAGTGATGAAGAATAAGG + Intergenic
1098924212 12:76331258-76331280 TGAATGAATGAAGAGAAATGTGG + Intergenic
1101196803 12:102391901-102391923 CTCATAGGTGCTGAGAAATGTGG + Intergenic
1101388866 12:104281903-104281925 CTAATGAGTGAGAAAAAAAGTGG - Intronic
1102847362 12:116200341-116200363 GCAATGTGTGATGAGAAAGGTGG - Intronic
1102870542 12:116410709-116410731 CTAAGGAGTGGTGAGGACTGTGG + Intergenic
1105320547 13:19316605-19316627 GTAATAAGTGAAGAGAAATACGG - Intergenic
1106303094 13:28487058-28487080 CTAATGTGTGATGAAATTTGAGG + Intronic
1106619619 13:31360820-31360842 CTTAAGAGAGATGAGGAATGGGG + Intergenic
1107118462 13:36772617-36772639 CTTATTAGAGATGAGAAATCAGG + Intergenic
1108258181 13:48630520-48630542 CTAATGGGTGAGCAGAAATTAGG + Intergenic
1109337712 13:61013788-61013810 TTAAAAAGTGATCAGAAATGAGG - Intergenic
1109915857 13:68984390-68984412 CTAAAGACTGATGAAAAAAGAGG - Intergenic
1110633599 13:77738707-77738729 CTTCTGCCTGATGAGAAATGTGG + Intronic
1112034298 13:95483339-95483361 AAAATTAGAGATGAGAAATGAGG - Intronic
1113116100 13:106876235-106876257 GTAATGAGTGGTGAGAGCTGAGG + Intergenic
1113233090 13:108237339-108237361 CTTATGAGTGTGGAGGAATGAGG + Intergenic
1119616099 14:76100083-76100105 AGAATGAGTGATCAGAAGTGAGG + Intergenic
1121476243 14:94207331-94207353 CTAGAGAGTGATGAGAACAGTGG + Intronic
1122956264 14:105072982-105073004 CAAAGGAGGAATGAGAAATGTGG - Intergenic
1125332375 15:38594813-38594835 CTAAGGAGATGTGAGAAATGAGG + Intergenic
1126817065 15:52464402-52464424 CTAAGAAGAGATGGGAAATGAGG - Intronic
1126832964 15:52628068-52628090 TTAGTGACTGATGAGACATGTGG + Intronic
1127665803 15:61145989-61146011 CTAATGAGTTATGAGATAGCAGG + Intronic
1133921390 16:10156382-10156404 CTAATGAGGGAAGAGAAATAAGG + Intronic
1138930943 16:61655301-61655323 CTAATAAGTGAAGAGAAAAAGGG - Intronic
1139113125 16:63916925-63916947 CTAATTGGTGAAGAGAAATAGGG - Intergenic
1139184156 16:64784944-64784966 CTAAGTGGTGAAGAGAAATGTGG - Intergenic
1139195459 16:64913433-64913455 GTAAAGAGTAATCAGAAATGAGG - Intergenic
1139494786 16:67308481-67308503 ATAAAGAATGATGGGAAATGAGG - Intronic
1140752278 16:78035981-78036003 ATAAGCAGTGATGAGAAATAAGG + Intronic
1141209400 16:81962475-81962497 CTAATGAAAAATAAGAAATGTGG - Exonic
1143649706 17:8255904-8255926 CCAATAGGTGAGGAGAAATGGGG + Exonic
1152805590 17:82354339-82354361 CAAATGAGTGCTGGGAATTGTGG - Intergenic
1153757264 18:8296932-8296954 CTAATGAGTGTTGTGATATGGGG - Intronic
1153956693 18:10102360-10102382 CTAATGAGAGAAGTGAAATACGG + Intergenic
1155691665 18:28632348-28632370 TTGAGGAGAGATGAGAAATGTGG + Intergenic
1155977312 18:32144926-32144948 ATGAAGAGTGATGATAAATGAGG - Intronic
1156161789 18:34368340-34368362 CTAATGACTTAATAGAAATGTGG + Intergenic
1157305895 18:46517313-46517335 CTAATGAGTGATTAGGACTGGGG + Intronic
1157353594 18:46913603-46913625 CCATTGAGTGATGAGAAGTAGGG + Intronic
1157630264 18:49088379-49088401 CTGGTGTGTGATGTGAAATGGGG - Intronic
1158203996 18:54970834-54970856 CTAATCTGAGATCAGAAATGAGG + Intergenic
1158445976 18:57521300-57521322 CTAAAAAGTAATTAGAAATGTGG + Intergenic
1158704436 18:59779077-59779099 CTAATGAGTCAAGAGAGAAGGGG - Intergenic
1159057991 18:63485617-63485639 CTAATGGTAGATGAGAAATGAGG - Intronic
1159608944 18:70504985-70505007 CTAATGAGGTCTGAGAAATGGGG + Intergenic
1164037410 19:21466893-21466915 CAAATGAGGGATGGCAAATGAGG + Intronic
1164903511 19:31948017-31948039 CTAATTTGTCAGGAGAAATGCGG - Intergenic
1166642547 19:44506335-44506357 CTAAAGTGTGATGAGAATGGAGG - Intronic
1168360395 19:55734964-55734986 CTAATGAGTGATGAGAAATGGGG + Intronic
927302285 2:21528376-21528398 CTAATGGATGATGAGGACTGTGG - Intergenic
927354079 2:22152969-22152991 CTCATGAGTGAAGAGAAAGAAGG + Intergenic
927838817 2:26423581-26423603 CCAATGAGTGATGGAAAATAGGG - Intronic
928675787 2:33649736-33649758 CTAATGTGTGATTAAAATTGAGG + Intergenic
928679379 2:33683895-33683917 TTGATGAATGATGAGAAATGGGG + Intergenic
928718530 2:34091986-34092008 TTAATGAGTGACCATAAATGGGG + Intergenic
930088486 2:47515156-47515178 CTGATGGGTGACGAGAAATCAGG + Intronic
930318976 2:49830632-49830654 ATAAAGATTTATGAGAAATGAGG - Intergenic
931957627 2:67445231-67445253 TAGATGAGAGATGAGAAATGAGG - Intergenic
932163309 2:69482461-69482483 CTTATGAATGAGGAGGAATGTGG - Intronic
934237175 2:90242903-90242925 CAAAGGAAAGATGAGAAATGTGG + Intergenic
934924319 2:98371320-98371342 CAAATGAATGAGAAGAAATGAGG - Intronic
937129543 2:119497218-119497240 CTAGTGACTGATGATAAGTGTGG - Intronic
937880729 2:126862659-126862681 CTTATGAGTGGTTGGAAATGTGG - Intergenic
941719914 2:168801829-168801851 CTTTTGAGTGATGAAAAATGAGG + Intronic
942005451 2:171695014-171695036 GGAATTAGAGATGAGAAATGAGG - Intronic
943025499 2:182623203-182623225 CTAATGAGAGGAAAGAAATGAGG + Intergenic
945282053 2:208045246-208045268 TTACAGAGTGCTGAGAAATGAGG - Intergenic
946810678 2:223521543-223521565 CTAATTAAAGATGAAAAATGAGG - Intergenic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
1169958671 20:11134202-11134224 CTAATGAGTGAAGATTTATGTGG + Intergenic
1170399701 20:15967810-15967832 GTAATGAGTGATGAGGATTCTGG - Intronic
1170610760 20:17910954-17910976 CTATTTAGTAATGAAAAATGAGG - Intergenic
1172507685 20:35475740-35475762 CTAATGATTGAGGAAAGATGAGG - Intronic
1173119777 20:40277976-40277998 CTAATGATTGCTGAGATATGAGG + Intergenic
1173869902 20:46334764-46334786 AGAATGAGTGAGGAGGAATGAGG + Intergenic
1174436763 20:50513086-50513108 CTTTTGAGTGCTGAGGAATGTGG + Intronic
1174851875 20:54003493-54003515 CAACTGAGTGCTGAGAACTGTGG - Intronic
1175058193 20:56217325-56217347 CTAACGTGTGATGAGCAGTGAGG - Intergenic
1176138855 20:63536479-63536501 CCAATCACTGATGAGAAACGCGG + Intronic
1176703953 21:10095433-10095455 GAAATGAGTGATGAGCAAAGGGG + Intergenic
1177942104 21:27423815-27423837 TTTATGAGTGAAGAGAGATGGGG + Intergenic
1178641440 21:34347578-34347600 TTAATGAGTTATGAGAAAATGGG + Intergenic
1178817211 21:35942460-35942482 CAAATGTGTGATGTGTAATGAGG - Intronic
1178817214 21:35942505-35942527 CAAATGTGTGATGTGTAATGAGG - Intronic
1183370617 22:37429777-37429799 CTATTGAGTGATTGGAATTGTGG + Intergenic
949600112 3:5588932-5588954 CCAATTTCTGATGAGAAATGGGG - Intergenic
950007313 3:9699685-9699707 CTACTGAGAGATGAGAAAAGAGG - Intronic
951103670 3:18718410-18718432 CTAATGACTGATGATATCTGGGG - Intergenic
951105241 3:18734610-18734632 CTACTGAGTGATGAGAGTTGTGG - Intergenic
951322974 3:21270041-21270063 CTGAGGAGAGATGACAAATGAGG - Intergenic
951949194 3:28180392-28180414 GTCATAAGTGGTGAGAAATGAGG + Intergenic
952687238 3:36163770-36163792 ATAGGGAGTGATGAGAAATCAGG - Intergenic
953786470 3:45915294-45915316 CAAAGCAGTGATGAGAAAAGAGG - Intronic
957382799 3:79455277-79455299 CTAAAGATTGATGTTAAATGTGG - Intronic
959284778 3:104393176-104393198 AAAATGACTGAAGAGAAATGTGG + Intergenic
960081607 3:113546953-113546975 CTAATGAGCTATTTGAAATGGGG + Intronic
963008607 3:140749316-140749338 TTAATGAGTGAGTTGAAATGGGG - Intergenic
963276974 3:143341563-143341585 CAAATGTTTGAGGAGAAATGTGG + Intronic
965072809 3:163937621-163937643 AGAATGAGTGCTGAGAAAAGGGG + Intergenic
965971498 3:174561543-174561565 CTAAGGAGTGATGAAGGATGAGG + Intronic
967620559 3:191628665-191628687 CTGAGGAGTGAAAAGAAATGTGG - Intergenic
969171629 4:5368637-5368659 CTCATGACTCATGAGAGATGAGG - Intronic
970125237 4:12802287-12802309 TGAATGAATGATGAGTAATGGGG - Intergenic
970658096 4:18254134-18254156 TGGAGGAGTGATGAGAAATGAGG + Intergenic
970673606 4:18423027-18423049 CAAATGACAGATGAGAAGTGGGG - Intergenic
970675959 4:18450562-18450584 TTCATGAGTGATGAAAAATGAGG + Intergenic
971458286 4:26865550-26865572 CTAATCATTGATGATAATTGTGG + Intronic
972184712 4:36514433-36514455 CTCATTAGCTATGAGAAATGAGG + Intergenic
972462023 4:39313464-39313486 CACATTAGTGATCAGAAATGAGG + Intronic
973680556 4:53313994-53314016 GTACTGTGTGATGAGAAGTGTGG + Intronic
973801531 4:54483279-54483301 GGTAGGAGTGATGAGAAATGGGG - Intergenic
978998180 4:115181030-115181052 ATAATAAGTGATGAAAAATTGGG + Intergenic
980376170 4:131951776-131951798 GAAATGAGTGATGAGCAAAGGGG + Intergenic
980858757 4:138473277-138473299 CTACTGACTGATGAGAATGGTGG - Intergenic
981459965 4:145001661-145001683 ATATTGAGTGATGGGAAAGGTGG - Intronic
983138373 4:164115235-164115257 ATAATCAGTCATGAGCAATGAGG + Intronic
987043663 5:14086460-14086482 GTAATTAGTCATGAGTAATGAGG + Intergenic
988565440 5:32317002-32317024 TTAATGGTTGATGAGCAATGGGG + Intergenic
990590718 5:57260815-57260837 CTAATGAGTAGTCAGAAATATGG + Intronic
991412372 5:66357832-66357854 ATAATGAGTGAACAAAAATGTGG + Intergenic
992211276 5:74482328-74482350 CTAATGTGTGCTGAGAAAATTGG - Intergenic
995347854 5:111141281-111141303 ATAAAGAGTGATGAGAAAACTGG + Intergenic
995482255 5:112604993-112605015 TCAATGAGTAATGAGAAATCTGG + Intergenic
996252620 5:121355110-121355132 CTAATGAGTGTTTCTAAATGTGG - Intergenic
997286129 5:132679946-132679968 CTAAGGAGTGTTTAGAAGTGAGG - Intronic
997752897 5:136365789-136365811 CAAATGAGGAATGAGGAATGAGG + Intronic
999371337 5:151057035-151057057 AAACTGAGTCATGAGAAATGAGG - Intronic
1001287403 5:170434042-170434064 CTTAAGCGTGATGAGAAAAGTGG - Intronic
1001911363 5:175521141-175521163 ATAAAGAGTGATGAGATATATGG - Intronic
1003275438 6:4646852-4646874 CTGATGGGTCATCAGAAATGTGG - Intergenic
1004569527 6:16831845-16831867 TTAGTGAGCCATGAGAAATGTGG - Intergenic
1005735368 6:28740591-28740613 CTACTGAGTTAAGATAAATGTGG - Intergenic
1008623821 6:53298473-53298495 CTAATAAGTGAAAAAAAATGGGG - Intronic
1009319391 6:62267668-62267690 CTAAAGACTAATGATAAATGTGG + Intronic
1010967584 6:82229501-82229523 CTAATGATTGATTGGAATTGTGG - Intronic
1011509665 6:88086713-88086735 CAAACGGTTGATGAGAAATGGGG - Intergenic
1012467131 6:99528629-99528651 TGAAAGTGTGATGAGAAATGAGG - Intergenic
1016727514 6:147392182-147392204 CTAAAGAGTAAAGAGAATTGGGG - Intergenic
1016733956 6:147455773-147455795 CTTATTAGTGATGAGAACTCTGG + Intergenic
1016792757 6:148083136-148083158 CTGAAGAGTGATTAGAAATAAGG + Intergenic
1017520459 6:155197395-155197417 CAAATGATTGAGGAAAAATGGGG + Intronic
1017633744 6:156423653-156423675 TTAATGAGCCATGAGAAATTAGG + Intergenic
1018101012 6:160440145-160440167 TTAATGAGTGTTAAGAAATTTGG - Intronic
1018174551 6:161167531-161167553 CTAACGAGTGATTAAAAATGGGG - Intronic
1021300239 7:18963870-18963892 GCAATGAATGAGGAGAAATGAGG - Intronic
1022939641 7:35221074-35221096 CTAAAGAGAGAAGATAAATGGGG + Intronic
1024186946 7:46958980-46959002 TTAAGGAGTGAAGGGAAATGTGG + Intergenic
1024307442 7:47940272-47940294 CTTATGAGTGATGGGAAGTGTGG - Exonic
1025029794 7:55547826-55547848 CTAGGGAGTGATGGGAAGTGTGG - Intronic
1028283272 7:88960521-88960543 ATAAGGAGGGATAAGAAATGGGG + Intronic
1030854786 7:114541534-114541556 CTGATGAATGATGAAGAATGAGG - Intronic
1035134534 7:156688409-156688431 CTAGCAAGTGATGAGTAATGAGG + Intronic
1036161713 8:6395083-6395105 CTGATGAGGTATCAGAAATGAGG - Intergenic
1036575750 8:10026404-10026426 CAAATGGGAGATGGGAAATGGGG - Intergenic
1037156067 8:15700598-15700620 CCTGTGAGTGTTGAGAAATGAGG + Intronic
1038353992 8:26809426-26809448 CTCATGAGAGCTGAGAAATCAGG - Intronic
1038667736 8:29555393-29555415 CTAATGAGTCATATGAAATCAGG - Intergenic
1038794884 8:30701153-30701175 TTAATAACTGATGAGAAATGAGG - Intronic
1038974396 8:32676852-32676874 ACAGTAAGTGATGAGAAATGGGG + Intronic
1039143444 8:34419078-34419100 CTAATCAGTGATGACAAGAGAGG + Intergenic
1040653617 8:49478628-49478650 CTAATGAGAGATATAAAATGTGG + Intergenic
1041761122 8:61367447-61367469 CCACTGGGTCATGAGAAATGGGG - Intronic
1042174848 8:66028788-66028810 CCAACGAGTGCAGAGAAATGAGG - Intronic
1042852553 8:73230687-73230709 TTTATGAGTGATGAGATTTGAGG + Intergenic
1043937428 8:86157463-86157485 CGAATGACTGAGGAGAAAGGGGG - Intergenic
1044275754 8:90297673-90297695 CTAAGGAATAATGAGAAACGAGG - Intergenic
1044536143 8:93358254-93358276 ATAAGGAGCGATGAGAAAAGTGG + Intergenic
1044641425 8:94385898-94385920 TGAAGGAGTGATGAGAGATGAGG + Intronic
1047172338 8:122505979-122506001 GTTATTAGTGCTGAGAAATGGGG - Intergenic
1048465964 8:134665017-134665039 CAAATCAGAGATCAGAAATGAGG - Intronic
1049489304 8:142885552-142885574 CCACAGAGTGAAGAGAAATGGGG - Intronic
1050141898 9:2524835-2524857 CTGTTCAGTGATGAGAAATGAGG - Intergenic
1051189188 9:14492950-14492972 CTACTGTTTGATGAGGAATGAGG + Intergenic
1051998139 9:23244443-23244465 GTAAGGTGTGGTGAGAAATGGGG + Intergenic
1052626555 9:30982833-30982855 ATAATGAGAGCTGAGAAAAGTGG + Intergenic
1053515909 9:38730561-38730583 CAAAAGAGACATGAGAAATGTGG - Intergenic
1053641221 9:40082460-40082482 GAAATGAGTGATGAGCAAAGGGG + Intergenic
1053764918 9:41383003-41383025 GAAATGAGTGATGAGCAAAGGGG - Intergenic
1054321961 9:63678752-63678774 GAAATGAGTGATGAGCAAAGGGG + Intergenic
1054543530 9:66294160-66294182 GAAATGAGTGATGAGCAAAGGGG - Intergenic
1054956651 9:70919023-70919045 GTAATGAGTAATGGGTAATGAGG - Intronic
1057257864 9:93565887-93565909 CACATTAGTGATCAGAAATGAGG + Exonic
1057363020 9:94392369-94392391 CTAAGGAGTCATGAGAAGTCAGG - Intronic
1057541424 9:95975899-95975921 CAAATGAGTGATAAGAACTTAGG - Intronic
1057660321 9:96995730-96995752 CTAAGGAGTCATGAGAAGTCAGG + Intronic
1058105813 9:100970624-100970646 TTAATGTGTGATGTGATATGGGG + Intergenic
1058136674 9:101315546-101315568 TTACTGAGTGATGAGAAACAGGG - Intronic
1059679821 9:116575415-116575437 CAGAGGAGTGATGAGAAGTGAGG + Intronic
1061324856 9:129857628-129857650 CTAATGGGGGATGATGAATGGGG - Intronic
1202788990 9_KI270719v1_random:65528-65550 GAAATGAGTGATGAGCAAAGGGG + Intergenic
1186568510 X:10690029-10690051 CTAAGGAGTGACAGGAAATGAGG + Intronic
1189355075 X:40304418-40304440 CTCATGAGTGATGGGACAGGAGG - Intergenic
1191976610 X:66878729-66878751 GGAATGAGTGATGGGAGATGAGG - Intergenic
1194151195 X:90326489-90326511 CCACTCAGTGATGAGGAATGGGG - Intergenic
1195159594 X:102157815-102157837 CTAACTAGTGATGAGAAGTTGGG + Intergenic
1195861099 X:109384162-109384184 CACATGAGTGATGGGAAGTGGGG + Intronic
1195862851 X:109399932-109399954 ATAATGAGAAATGAGAAGTGGGG + Intronic
1196268757 X:113685752-113685774 CAAATCAGTGTTGGGAAATGTGG + Intergenic
1198953939 X:142106211-142106233 GCAATGAGTGATGAGAAATAAGG - Intergenic
1199555420 X:149102777-149102799 ATAATAATTAATGAGAAATGAGG - Intergenic
1200497565 Y:3903243-3903265 CCACTCAGTGATGAGGAATGGGG - Intergenic