ID: 1168360788

View in Genome Browser
Species Human (GRCh38)
Location 19:55738173-55738195
Sequence CAAACATTACCCAGGAAAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1863
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 1810}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168360788_1168360792 8 Left 1168360788 19:55738173-55738195 CCTGCTTTCCTGGGTAATGTTTG 0: 1
1: 0
2: 2
3: 50
4: 1810
Right 1168360792 19:55738204-55738226 CTTTGCTACATCTTCTTTGGAGG 0: 1
1: 0
2: 3
3: 22
4: 275
1168360788_1168360793 29 Left 1168360788 19:55738173-55738195 CCTGCTTTCCTGGGTAATGTTTG 0: 1
1: 0
2: 2
3: 50
4: 1810
Right 1168360793 19:55738225-55738247 GGCCTTCTTCAGCTCAGCCCAGG 0: 1
1: 0
2: 1
3: 17
4: 282
1168360788_1168360794 30 Left 1168360788 19:55738173-55738195 CCTGCTTTCCTGGGTAATGTTTG 0: 1
1: 0
2: 2
3: 50
4: 1810
Right 1168360794 19:55738226-55738248 GCCTTCTTCAGCTCAGCCCAGGG 0: 1
1: 0
2: 1
3: 33
4: 241
1168360788_1168360791 5 Left 1168360788 19:55738173-55738195 CCTGCTTTCCTGGGTAATGTTTG 0: 1
1: 0
2: 2
3: 50
4: 1810
Right 1168360791 19:55738201-55738223 CAGCTTTGCTACATCTTCTTTGG 0: 2
1: 0
2: 2
3: 24
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168360788 Original CRISPR CAAACATTACCCAGGAAAGC AGG (reversed) Exonic
900648563 1:3720073-3720095 CAAATATTAGCCAGGCAAGGTGG - Intronic
900701331 1:4050251-4050273 GAAAAATTACCCAGGAAAGTAGG + Intergenic
900974468 1:6008466-6008488 CAAAAATTACCCAGGCATGATGG + Intronic
901100115 1:6713424-6713446 CAAAAATTACCCAGGCATGTTGG + Intergenic
901136370 1:6999534-6999556 CAAAAATTAGCCAGGCATGCTGG - Intronic
901213861 1:7542679-7542701 CAAACATTAGCCAGGTATGGTGG - Intronic
901269400 1:7940089-7940111 TAAACATTTCCAAGGAAAGGTGG + Intronic
901387126 1:8917920-8917942 CAAACATTAGCCAGGCACGATGG + Intergenic
901488434 1:9582065-9582087 CAAAAATTAGCCAGGCAAGGTGG - Intronic
901495449 1:9618638-9618660 CAAAAATTAGCCAGGCAAGATGG + Intergenic
901551792 1:10000886-10000908 CAAAAATTAGCCAGGAGAGGTGG - Intronic
901555793 1:10030301-10030323 CAAAAATTAGCCAGGCATGCTGG + Intergenic
901749788 1:11398880-11398902 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
901768559 1:11519104-11519126 CAAACATTACCCAGGAAGAGGGG - Intronic
901969697 1:12897702-12897724 CAAAAATTAGCCAGGCAAGTTGG + Intronic
902303420 1:15519330-15519352 CAAACATTAGCCAGGCATGGTGG - Intronic
902430136 1:16356505-16356527 CAAAAATTAGCCAGGAATGGTGG + Intronic
902646543 1:17803481-17803503 CAAAAATTAGCCAGGCAAGGTGG - Intronic
902698667 1:18156969-18156991 CAAACATTAGCCAGGCATGGTGG + Intronic
902806886 1:18866592-18866614 TAAAAATTAGCCAGGAATGCTGG - Intronic
902827195 1:18984236-18984258 CAAAAATTACCCAGGCATGGTGG + Intergenic
903042500 1:20541967-20541989 CAAAAATTAGCCAGGAATGGTGG - Intergenic
903194669 1:21676309-21676331 CAAAAATTAGCCAGGTATGCCGG - Intergenic
903389264 1:22952983-22953005 CAAACCTTACTCTAGAAAGCTGG + Intergenic
903419595 1:23209149-23209171 CAAAAATTAGCCAGGCATGCTGG - Intergenic
903424434 1:23243302-23243324 CAAAAATTAGCCAGGAACGGTGG + Intergenic
903729212 1:25478090-25478112 CAAACATTAGCCAGGCATGGTGG + Intronic
903770622 1:25761773-25761795 CAAAAATTACCCAGGCATGGTGG - Intronic
903778435 1:25807621-25807643 CAAGCAGGACCCAGGAAGGCGGG + Intronic
903946999 1:26970338-26970360 CAAAAATTACCCAGGCATGGCGG - Intergenic
904227962 1:29040431-29040453 CAAAAATTAGCCAGGAATGGTGG - Intronic
904241559 1:29149526-29149548 CAAAAATTAGCCAGGCATGCTGG + Intronic
904487384 1:30835908-30835930 CAAAAATTAGCCAGGAATGGTGG - Intergenic
904644920 1:31958466-31958488 CAAAAATTAGCCAGGAATGGTGG - Intergenic
904680687 1:32226983-32227005 CAAAAATTACCCAGGCATGGTGG - Intronic
904727349 1:32559615-32559637 CAAAAATTACCCAGGCATGGTGG - Intronic
904728031 1:32565175-32565197 CAAACATTAACCAGGCATGGTGG + Intronic
904750523 1:32739094-32739116 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
904814348 1:33183720-33183742 CAAACATATCCCAGCAAAGGGGG - Intergenic
904991388 1:34596175-34596197 CAAACATTCCCCAACAAATCAGG + Intergenic
905063094 1:35156364-35156386 CAAAAATTACCCAGGCATGGTGG + Intergenic
905088177 1:35403436-35403458 CAAAAATTACCCAGGCATGGTGG - Intronic
905109625 1:35585894-35585916 CAAAAATTACCCAGGCATGGTGG + Intronic
905252350 1:36657797-36657819 CAAAAATTAGCCAGGAATGGTGG - Intergenic
905372973 1:37495543-37495565 CAAAAATTAGCCAGGCAAGGTGG + Intronic
905412985 1:37784862-37784884 CAAAAATTACCCAGGCATGGTGG + Intergenic
905597452 1:39220323-39220345 CAAAAATTAGCCAGGCAAGGTGG - Intronic
905624055 1:39475314-39475336 CAAAAATTAGCCAGGCAAGGTGG + Intronic
905711988 1:40113027-40113049 CAAACATTACCCAGGCATGGTGG + Intergenic
905716917 1:40160157-40160179 CAAACATTAGCCAGGCATGGTGG + Intergenic
905721139 1:40203388-40203410 CAAACATTAGCCAGGCATGGTGG + Intronic
906040147 1:42782678-42782700 CAAACATTAGCCAGGCATGGTGG + Intronic
906122556 1:43404055-43404077 CAAAAATTAGCCAGGCATGCTGG + Intronic
906172436 1:43738648-43738670 CAAAAATTAGCCAGGAATGGTGG - Intronic
906373171 1:45271663-45271685 CAAAAATTAGCCAGGAATGGTGG + Intronic
906396125 1:45466494-45466516 CAAAAATTACCCAGGCATGGTGG + Intronic
906418360 1:45640863-45640885 CAAACATTAGCCAGGCATGGTGG + Intronic
907025551 1:51114568-51114590 CAAAAATTACCCGGGAATGGTGG + Intronic
907035050 1:51208828-51208850 CAAAAATTAGCCAGGAATGGTGG + Intergenic
907058423 1:51395019-51395041 CAAAAATTACCCAGGTATGGTGG - Intronic
907067849 1:51503487-51503509 CAAAAATTAACCAGGAATGGTGG + Intronic
907074852 1:51568863-51568885 CAAACATTAGCCAGGCATGGTGG - Intergenic
907356112 1:53875360-53875382 CAAACATTATCCAGGCATGGTGG + Intronic
907406203 1:54254983-54255005 CAAAAATTAGCCAGGCATGCTGG - Intronic
907662128 1:56402817-56402839 CAAAAATTACCCAGGCATGGTGG + Intergenic
907744977 1:57204040-57204062 CAAAAATTAGCCAGGAGAGGTGG - Intronic
908258863 1:62324009-62324031 CAAAAATTAGCCAGGCAGGCTGG + Intergenic
908364319 1:63402617-63402639 CAAACATTAGCCAGGCATGGTGG - Intronic
908523003 1:64962917-64962939 CAAAAATTACCCAGGCATGGTGG + Intronic
909161873 1:72161827-72161849 CAAAAATTAGCCAGGCATGCTGG - Intronic
909217995 1:72916105-72916127 CAAACAATACCAAAGAAAGATGG - Intergenic
909621187 1:77669608-77669630 CAAACATTAGCCAGGTATGGTGG - Intronic
909633204 1:77788153-77788175 CAAAAATTAGCCAGGCATGCTGG - Intronic
909661666 1:78090345-78090367 CAAAAATTACCCAGGCATGGTGG - Intronic
909708902 1:78621422-78621444 CAAAAATTAGCCAGGCATGCTGG - Intronic
909724846 1:78821990-78822012 CAAAAATTACCCAGGCATGATGG - Intergenic
910623556 1:89282942-89282964 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
910869430 1:91819213-91819235 CAAAAATTACCCAGGCATGGTGG + Intronic
910869642 1:91821175-91821197 CAAACATTAGCCAGGTATGGTGG + Intronic
910871654 1:91839128-91839150 AAAACATTAGCCAGGAATGGTGG - Intronic
911329576 1:96511638-96511660 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
911343039 1:96662606-96662628 CAAAAATTAGCCAGGAATGGTGG - Intergenic
911611310 1:99961572-99961594 CAAAAATTAGCCAGGCATGCTGG + Intergenic
911847912 1:102777623-102777645 CAAACATTAGCCAGGCATGGTGG - Intergenic
912127467 1:106556338-106556360 TCAAGATTACCCAGGAAAACAGG + Intergenic
912229884 1:107780666-107780688 CAAACATTAGCCAGGCATGGTGG - Intronic
912397184 1:109355066-109355088 CAAAAATTACCCAGGAGTGGTGG + Intronic
912398337 1:109366750-109366772 CAAAAATTACCCAGGCATGGAGG + Intronic
912833885 1:112978239-112978261 CAAAAATTAGCCAGGCATGCTGG + Intergenic
912839938 1:113030434-113030456 CAAAAATTACCCAGGCATGATGG + Intergenic
912849468 1:113109669-113109691 CAAAAATTACCCAGGCGAGGTGG - Intronic
912884863 1:113460336-113460358 GAAACATTACCCTTGAAAACCGG + Intronic
912916026 1:113815829-113815851 CAAAAATTACCCAGGCATGTTGG - Intronic
912976657 1:114337033-114337055 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
913000907 1:114579711-114579733 CAAAAATTACCCAGGCATGGTGG + Intronic
913035999 1:114966835-114966857 CAAAAATTAGCCAGGTATGCTGG - Intronic
913226571 1:116705696-116705718 CAAAAATTACCCAGGCATGGTGG + Intronic
913417023 1:118619874-118619896 CAAAAATTAGCCAGGTAAGGTGG - Intergenic
913465994 1:119143322-119143344 CAAAAATTACCCAGGCATGGTGG + Intergenic
913504531 1:119504325-119504347 CAAAAATTACCCAGGCATGGTGG + Intergenic
913678928 1:121170121-121170143 CAAAAATTACCCAGGCATGGTGG - Intronic
913696300 1:121329056-121329078 CAAAAATTAGCCAGGCAAGATGG + Intronic
913720485 1:121587612-121587634 AAAAAATTACCCAGAACAGCGGG - Intergenic
913970185 1:143409061-143409083 CAAAAATTACCCAGGCATGGTGG - Intergenic
914030760 1:143957767-143957789 CAAAAATTACCCAGGCATGGTGG - Intronic
914064560 1:144234658-144234680 CAAAAATTACCCAGGCATGGTGG - Intergenic
914114590 1:144731696-144731718 CAAAAATTACCCAGGCATGGTGG + Intergenic
914141262 1:144950999-144951021 CAAAAATTAGCCAGGCAAGATGG - Intronic
914158689 1:145110195-145110217 CAAAAATTACCCAGGCATGGTGG + Intronic
914228760 1:145745291-145745313 CAAAAATTACCCAGGCATGGTGG + Exonic
914685303 1:149973636-149973658 CAAAAATTAGCCAGGAATGGTGG - Intronic
914723368 1:150307508-150307530 CAAACATTAACCAGGCATGGTGG - Intronic
914727863 1:150343087-150343109 CAAACATTAGCCAGGCATGGTGG + Intronic
914806917 1:150998505-150998527 CAAACATTAGCCAGGCATGGTGG - Intronic
914882031 1:151554854-151554876 CAAAAATTACCCAGGAGTGGTGG - Intronic
914910540 1:151782292-151782314 CAAACATTAGCCAGGAGTGGTGG + Intronic
914911811 1:151793330-151793352 CAAAAATTACCCAGGTATGGTGG - Intergenic
915222507 1:154386200-154386222 CAAAAATTACCCAGGCATGGTGG - Intergenic
915223538 1:154394030-154394052 CAAAAATTACCCAGGCATGGTGG - Intergenic
915364621 1:155307927-155307949 CAAAAATTACCCAGGTGTGCTGG - Intergenic
915423187 1:155801728-155801750 CAAAGATTAGCCAGGCAAGGTGG + Intronic
915480773 1:156183284-156183306 CAAAAATTACCCAGGCATGGTGG - Intergenic
915925405 1:160014882-160014904 CAAAAATTAGCCAGGCATGCTGG - Intergenic
916000908 1:160614419-160614441 CAAAAATTAGCCAGGAATGATGG + Intronic
916259410 1:162825848-162825870 CAAAAATTAGCCAGGCAAGGTGG - Intronic
916446236 1:164874788-164874810 TAAAAATTACACAGTAAAGCTGG - Intronic
916546820 1:165813479-165813501 CAAACATTAGCCAGGCATGGTGG - Intronic
916809673 1:168294652-168294674 CAAAAATTACCCAGGAGTGGTGG - Intronic
916840862 1:168599216-168599238 CAAACATCAGCCTGGAAAACAGG - Intergenic
916955459 1:169828699-169828721 TAAAAATTAGCCAGGACAGCTGG - Intronic
917340581 1:173973381-173973403 CAAAAATTACCCAGGCATGGTGG + Intronic
917349322 1:174060571-174060593 CAAAAATTAGCCAGGAATGGTGG - Intergenic
917542757 1:175931135-175931157 CAAAAATTAGCCAGGAATGGTGG - Intergenic
917948452 1:180002319-180002341 CAAAAATTATCCAGGAATGGTGG + Intronic
918043746 1:180928552-180928574 CCACCATTACCCAGGGCAGCCGG + Exonic
918059246 1:181047444-181047466 CAAAAATTAGCCAGGCATGCTGG + Intronic
918573486 1:186026785-186026807 CAAACATTAGCCAGGCATGGTGG - Intronic
918828458 1:189358312-189358334 CAAAAATTAGCCAGGCATGCTGG - Intergenic
918905406 1:190485702-190485724 CAAAAATTAGCCAGGCATGCTGG + Intergenic
918916750 1:190650616-190650638 CAAACATTAGCCAGGCATGGTGG - Intergenic
918968243 1:191378689-191378711 CAGACTATACCCAGGAAATCGGG - Intergenic
918988384 1:191663263-191663285 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
919375624 1:196790569-196790591 CAAAAATTAGCCAGGCATGCTGG + Intronic
919385321 1:196915480-196915502 CAAAAATTAGCCAGGCATGCTGG + Intronic
919512849 1:198488169-198488191 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
919922188 1:202173014-202173036 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
919948949 1:202344587-202344609 CAAAAATTACCCAGGCATGGTGG + Intergenic
920066896 1:203275590-203275612 CAAAAATTAGCCAGGAATGATGG - Intergenic
920270278 1:204757619-204757641 CAAAAATTACCCAGGCATGGTGG + Intergenic
920343447 1:205290452-205290474 CAAAAATTACCCAGGCATGGTGG + Intergenic
920466227 1:206188659-206188681 CAAAAATTACCCAGGCATGGTGG - Intronic
920483623 1:206347422-206347444 CAAAAATTAGCCAGGCAAGATGG + Intronic
920558157 1:206919441-206919463 CAAAAATTAGCCAGGAGAGGTGG + Intronic
920722624 1:208401899-208401921 CAAAAATTAGCCAGGAATGGTGG - Intergenic
920985086 1:210881153-210881175 CAAAAATTAGCCAGGAATGATGG - Intronic
921869245 1:220120527-220120549 CAAAAATTACCCAGGTATGGTGG - Intronic
921870311 1:220132676-220132698 CAAACATTAGCCAGGCATGGTGG - Intronic
922486222 1:225975252-225975274 CAAAAATTAGCCAGGCATGCTGG - Intergenic
922511521 1:226172000-226172022 CAAAAATTAGCCAGGCATGCTGG + Intronic
922646445 1:227291394-227291416 CAAAAATTACCCAGGCATGGTGG + Intronic
922742147 1:228020069-228020091 CAAACATTAGCCAGGCATGGTGG + Intronic
922888827 1:229044727-229044749 CAAAAATTACCCAGGCATGGTGG + Intergenic
923139640 1:231150542-231150564 CAAAAATTAGCCAGGAGTGCTGG + Intergenic
923169513 1:231400895-231400917 CAAAAATTAGCCAGGCATGCTGG + Intronic
923482083 1:234395069-234395091 CAAACATTAGCCAGGCATGGTGG + Intronic
923576894 1:235166543-235166565 CAAAAATTAGCCAGGAGTGCTGG + Intronic
923584752 1:235258176-235258198 CAAAAATTACCCAGGCATGGTGG + Intronic
923654570 1:235904617-235904639 CAAAAATTAGCCAGGCATGCTGG - Intergenic
923690171 1:236184917-236184939 CAAAAATTACCCAGGCATGGTGG - Intronic
924098992 1:240584340-240584362 CAAAAATTAGCCAGGCATGCTGG + Intronic
924162884 1:241252194-241252216 CAAACATTAGCCAGGAGTGGTGG - Intronic
924174644 1:241378216-241378238 CAAACATTAGCCAGGCATGGTGG - Intergenic
924699188 1:246433506-246433528 CAAAAATTAGCCAGGCATGCTGG + Intronic
924764018 1:247014915-247014937 CAAACATTAGCCAGGCATGATGG - Intergenic
1063111831 10:3044898-3044920 CAAAAATTACCCAGGCATGATGG - Intergenic
1063222580 10:3984305-3984327 CAAAAATTAGCCAGGCAAGGAGG + Intergenic
1063225786 10:4013496-4013518 CAAACATAGCCTAGGGAAGCAGG - Intergenic
1063252463 10:4288111-4288133 AAAACATTAGCCATGGAAGCTGG + Intergenic
1063400917 10:5744779-5744801 CAAAAATTACCCAGGAGTGGTGG - Intronic
1063441114 10:6074096-6074118 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
1063594574 10:7422389-7422411 CAAAAATTACCCAGGCATGGTGG + Intergenic
1063646984 10:7895026-7895048 CAAAAATTAGCCAGGAATGGTGG - Intronic
1064039797 10:11951213-11951235 CAAAAATTATCCAGGAATGTTGG - Intronic
1064272548 10:13878598-13878620 CAAAAATTAGCCAGGCATGCTGG + Intronic
1064356022 10:14618682-14618704 CAAACATTAGCCAGGCATGGTGG + Intronic
1064374878 10:14786369-14786391 CAAAAATTACCCAGGCATGGTGG + Intergenic
1064410466 10:15099629-15099651 CAAAAATTAGCCAGGAGTGCTGG - Intronic
1064527217 10:16269570-16269592 CAAAAATTACCCAGGTATGGTGG + Intergenic
1064536736 10:16364984-16365006 CAAAAATTAGCCAGGAATGATGG + Intergenic
1064537374 10:16371160-16371182 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1064770337 10:18716452-18716474 CAAACATTAGCCAGGCATGGTGG - Intergenic
1064907011 10:20357848-20357870 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
1065145491 10:22763968-22763990 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1065166718 10:22986397-22986419 CAAAAATTAGCCAGGAATGGTGG + Intronic
1065213002 10:23422744-23422766 TAAAAATTAGCCAGGAATGCCGG - Intergenic
1065341947 10:24715854-24715876 CAAAAATTAACCAGGCATGCTGG + Intronic
1065570150 10:27062918-27062940 CAAACATTAGCCAGGCATGGTGG - Intronic
1065756036 10:28932028-28932050 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1065771892 10:29085635-29085657 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1065939641 10:30552760-30552782 CAAACATTAGCCAGGCATGGTGG - Intergenic
1066119201 10:32267436-32267458 CAAACAGTGCCCGGGAAGGCTGG - Intergenic
1066219826 10:33324788-33324810 CAAAAATTAGCCAGGCAAGGTGG - Intronic
1066378290 10:34879305-34879327 CAAAAATTACCCAGGCATGGTGG + Intergenic
1066660584 10:37735495-37735517 CAAAAATTACCCAGGCATGGTGG + Intergenic
1067369076 10:45665386-45665408 CAAAAATTAGCCAGGAATGGTGG + Intronic
1067727820 10:48785008-48785030 CAAACATTAGCCAGGCATGGTGG - Intronic
1068577734 10:58703310-58703332 CAAACATTACCCAAGCATGGTGG - Intronic
1068760717 10:60705973-60705995 CAAAAATTAGCCAGGCAAGATGG - Intronic
1068947139 10:62740771-62740793 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1069487084 10:68830493-68830515 CAAAAATTAGCCAGGTAAGGTGG - Intronic
1069494623 10:68891971-68891993 CAAAAATTAGCCAGGCATGCTGG - Intronic
1069534594 10:69243647-69243669 CAAAAATTAGCCAGGAATGGTGG - Intronic
1069713731 10:70507572-70507594 CAAAAATTAGCCAGGCAAGGTGG - Intronic
1069762104 10:70818271-70818293 CAAAAATTACCCAGGCATGGTGG - Intronic
1069931145 10:71882541-71882563 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1069975012 10:72205949-72205971 CAAAAATTACCCAGGCATGGTGG + Intronic
1070073921 10:73116587-73116609 CAAAAATTAGCCAGGAATGGTGG + Intronic
1070109631 10:73472340-73472362 CAAAAATTAGCCAGGCATGCTGG + Intronic
1070624047 10:78036456-78036478 CAAAAATTACCCAGGCATGATGG - Intronic
1070753799 10:78979199-78979221 CAAAAATTACCCAGGCATGGTGG + Intergenic
1070773009 10:79093477-79093499 CAAAAATTACCCAGGCATGGTGG - Intronic
1070930971 10:80260363-80260385 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1070937535 10:80312922-80312944 CAAAAATTACCCAGGCATGGTGG + Intergenic
1071279477 10:84087089-84087111 CAAAAATTACCCAGGCATGGTGG + Intergenic
1071302894 10:84270240-84270262 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1072107178 10:92285421-92285443 CAAACATTAACCAGGCATGGTGG - Intronic
1072119564 10:92394552-92394574 CAAAAATTACCCAGGCATGGTGG + Intergenic
1072152741 10:92696380-92696402 CCAAAGTTACCCGGGAAAGCAGG - Intergenic
1072253310 10:93599094-93599116 CAAAAATTAGCCAGGCATGCTGG + Intronic
1072441882 10:95464164-95464186 CAAAAATTAGCCAGGCAAGGTGG + Intronic
1072463332 10:95640492-95640514 CAAAAATTAGCCAGGAATGGTGG - Intronic
1072917428 10:99547261-99547283 CAAAAATTACCCAGGCATGGTGG + Intergenic
1073117304 10:101098521-101098543 CAAACATTAGCCAGGCATGGTGG + Intronic
1073263757 10:102210446-102210468 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1073401728 10:103262908-103262930 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1073676734 10:105655684-105655706 GAAACAATTCCCAGGACAGCAGG + Intergenic
1074129700 10:110563094-110563116 CAAAAATTACCCAGGCATGGTGG - Intergenic
1074157858 10:110813680-110813702 CAAAAATTAGCCAGGCAAGGTGG + Intronic
1074553937 10:114471035-114471057 CAAAAATTAGCCAGGAATGATGG - Intronic
1074588790 10:114792997-114793019 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1074848112 10:117416861-117416883 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1075041483 10:119110607-119110629 CAAAAATTAGCCAGGAATGGTGG - Intronic
1075115893 10:119626961-119626983 CAAAAATTACCCAGGCATGGTGG + Intergenic
1075116227 10:119629375-119629397 CAAACATTAGCCAGGCATGATGG - Intergenic
1075143846 10:119866471-119866493 CAAAAATTAGCCAGGAATGGTGG + Intronic
1075470115 10:122682467-122682489 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
1075504715 10:123011677-123011699 CAAAAATTAGCCAGGCAAGGTGG - Intronic
1076092650 10:127701682-127701704 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1076428862 10:130387849-130387871 CAAACATTACCCGGGCATGATGG - Intergenic
1076509951 10:131006225-131006247 CAAAAATTACCCAGGCAAGGTGG - Intergenic
1077054600 11:584888-584910 CAAAAATTACCCAGGCATGGTGG - Intronic
1077904131 11:6515936-6515958 CAAACATTAGCCAGGTACGGTGG - Intronic
1078023897 11:7676495-7676517 CAAAAATTACCCAGGCATGATGG - Intronic
1078172959 11:8943673-8943695 CAAAAATTAGCCAGGCAAGTTGG - Intergenic
1078227859 11:9409259-9409281 CAAAAATTAGCCAGGGATGCTGG - Intronic
1078774188 11:14379181-14379203 CAAAAATTACCCAGGCATGGTGG + Intergenic
1079028268 11:16966028-16966050 CAAAAATTACCCAGGAGTGGTGG + Intronic
1079201553 11:18381565-18381587 CAAACATTAGCCAGGCATGGTGG - Intergenic
1079223076 11:18581529-18581551 CAAAAATTAGCCAGGCATGCTGG + Intronic
1079227524 11:18620324-18620346 CAAAAATTACCCAGGCATGGTGG + Intronic
1079390506 11:20018199-20018221 CAAAAATTAACCAGGAATGGTGG + Intronic
1079558145 11:21787263-21787285 CAAACATTAACCAGGCGTGCTGG + Intergenic
1079684083 11:23334434-23334456 CAAACATTAGCCAGGCATGGTGG - Intergenic
1079705392 11:23610186-23610208 CAAAAATTACCCAGGCATGGTGG + Intergenic
1079942424 11:26698048-26698070 CAAAAATTAGCCAGGCAAGGTGG - Intronic
1080233067 11:30039714-30039736 CAAAAATTACCCAGGCATGATGG + Intergenic
1080445256 11:32332309-32332331 CAAAAATTAGCCAGGGAAGATGG + Intergenic
1080730301 11:34944270-34944292 CAAAAATTAGCCAGGAGAGGTGG - Intronic
1080867626 11:36209510-36209532 CAAAAATTAGCCAGGCATGCTGG - Intronic
1081030523 11:38075391-38075413 TAAACAATACCCAGCAAACCTGG - Intergenic
1081315867 11:41629057-41629079 CAAAAATTACCCAGGCATGATGG + Intergenic
1081504892 11:43705913-43705935 CAAAAATTAACCGGGAAAGATGG - Intronic
1081530019 11:43951846-43951868 CAAACATTAGCCAGGCATGTTGG + Intergenic
1081898725 11:46609497-46609519 CAAAAATTACCCAGGCACGGTGG - Intronic
1081898788 11:46610003-46610025 CAAAAATTACCCAGGCATGGTGG - Intronic
1081913150 11:46713559-46713581 CAAAAATTAGCCAGGAGAGGTGG + Intergenic
1081983276 11:47283551-47283573 CAAAAATTAGCCAGGCAAGGTGG - Intronic
1082009125 11:47438473-47438495 CAAAAATTACCCAGGCATGGTGG - Intronic
1082020770 11:47531092-47531114 CAAAAATTACCCAGGCATGGTGG + Intronic
1082021990 11:47542215-47542237 CAAAAATTAGCCAGGCATGCTGG + Intronic
1082025394 11:47567710-47567732 CAAAAATTAGCCAGGCATGCTGG - Intronic
1082049301 11:47757644-47757666 CAAACATTACCCAGGTGTGGTGG - Intronic
1082099532 11:48161023-48161045 CAAAAATTAGCCAGGCATGCTGG + Intronic
1082208908 11:49473139-49473161 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1082827961 11:57594799-57594821 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1082865418 11:57895800-57895822 CAAACATTAGCCAGGCAAGGTGG - Intergenic
1082995650 11:59252740-59252762 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1083358905 11:62091385-62091407 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1083411306 11:62494712-62494734 CAAAAATTAGCCAGGACCGCCGG + Intronic
1083564090 11:63698275-63698297 CAAAAATTAACCAGGCATGCTGG - Intronic
1083699844 11:64468885-64468907 CAAAAATTACCCAGGCATGGTGG - Intergenic
1083783190 11:64928622-64928644 CAAACATTAGCCAGGCATGGTGG + Intronic
1083978863 11:66148305-66148327 CAAAAATTAGCCAGGCATGCTGG - Intronic
1084040203 11:66538242-66538264 CAAAAATTAGCCAGGAATGGTGG + Intronic
1084136798 11:67189685-67189707 CAAACATTAGCCAGGCATGATGG + Intronic
1084276016 11:68051346-68051368 CAGACATTACCCAGGACCCCGGG + Intergenic
1084287967 11:68144058-68144080 CAAAAATTACCCAGGCATGGTGG + Intergenic
1084312131 11:68323259-68323281 CAAAAATTACCCAGGCATGGTGG - Intronic
1084499648 11:69527511-69527533 CAAAAATTACCCAGGCATGATGG + Intergenic
1084523533 11:69681443-69681465 CAAAAATTACCCAGGCATGGTGG + Intergenic
1084734055 11:71093106-71093128 CAAACAGTGCCCAGAAATGCAGG + Intronic
1084851761 11:71947334-71947356 CAAAAATTACCCAGGCATGGTGG + Intronic
1084872349 11:72106786-72106808 CAAAAATTACCCAGGCATGGTGG + Intronic
1084950665 11:72663574-72663596 CAAAAATTAGCCAGGCATGCTGG + Intronic
1085558343 11:77446357-77446379 CAAAAATTAGCCAGGCATGCTGG + Intronic
1085664982 11:78406528-78406550 CAAAAATTACCCAGGCATGGTGG - Intronic
1086009176 11:82078239-82078261 CAGACATAATCAAGGAAAGCAGG + Intergenic
1086070359 11:82792752-82792774 CAAACATTAGCCAGGCATGGTGG - Intergenic
1086488913 11:87339270-87339292 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1086640710 11:89152093-89152115 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1086646114 11:89222584-89222606 CAAAAATTAGCCAGGCATGCTGG + Intronic
1086996264 11:93359865-93359887 CAGACATTACCCAGGAAAGAGGG - Intronic
1087100455 11:94358958-94358980 CAGACATTACCCAGAAAATCGGG + Intergenic
1087490341 11:98818419-98818441 CAAAAATTACCCAGGCATGGTGG + Intergenic
1087749018 11:101985433-101985455 CAAAAATTACCCAGGTATGGTGG - Intronic
1088003601 11:104913311-104913333 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
1088149861 11:106731450-106731472 GAAACATTTCCCTTGAAAGCCGG + Intronic
1088244308 11:107802083-107802105 CAAAAATTAGCCAGGAATGATGG + Intronic
1088443394 11:109896867-109896889 CAAAAATTACCCAGGCATGGTGG + Intergenic
1089268546 11:117284775-117284797 CAAAAATTAGCCAGGAACGGTGG + Intronic
1089280677 11:117372258-117372280 CAAAAATTAGCCAGGAATGGTGG - Intronic
1089375161 11:117988911-117988933 CAAACATTAGCCAGGCATGGTGG - Intronic
1089426747 11:118383438-118383460 CAAAAATTACCCAGGCATGGTGG + Intronic
1089503545 11:118947626-118947648 CAAAAATTAGCCAGGCATGCTGG - Intronic
1089510349 11:118992733-118992755 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1089770433 11:120798630-120798652 AAAAAATTACCCAGGAATGGTGG - Intronic
1090715177 11:129424000-129424022 CAAACATTAGCCAGGCATGGTGG - Intronic
1091029144 11:132168742-132168764 TAAAGATTCCCCAGGAGAGCTGG - Intronic
1091206357 11:133823878-133823900 CAAACATTACCCAGGGAATCTGG + Intergenic
1091419506 12:324151-324173 TAAACATTACCCAGGCATGGTGG + Intronic
1091535976 12:1409859-1409881 CAAACATTAGCCAGGCATGGTGG - Intronic
1091572161 12:1696546-1696568 CAAACATTAGCCAGGCATGGTGG - Intronic
1091673467 12:2469175-2469197 CAAACATTAGCCAGGAGAAATGG + Intronic
1091931714 12:4401782-4401804 CAAAAATTACCCAGGCATGGTGG + Intergenic
1092066948 12:5598506-5598528 CAAAAATTAGCCAGGAATGGTGG - Intronic
1092236007 12:6810040-6810062 CAAAAATTAGCCAGGAATGGTGG - Intronic
1092240420 12:6832752-6832774 CAAAAATTAGCCAGGCAAGATGG - Intronic
1092364429 12:7865239-7865261 CAAAAATTAGCCAGGCAGGCTGG + Intronic
1092459476 12:8673746-8673768 CAAACATTAGCCAGGCATGGTGG - Intergenic
1092478149 12:8836634-8836656 CAAACATTAGCCAGGCATGGTGG - Intronic
1092607896 12:10139673-10139695 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1092614526 12:10204533-10204555 CAAAAATTACCCAGGCATGGTGG - Intergenic
1092704103 12:11265566-11265588 CAAAAATTACCCAGGAATGATGG + Intergenic
1092795120 12:12103233-12103255 CAAAAATTAGCCAGGAATGGTGG + Intronic
1093147964 12:15589221-15589243 CAAAAATTAGCCAGGAATGGTGG + Intronic
1093152324 12:15637171-15637193 CAAAAATTACCCAGGCATGATGG - Intronic
1093237684 12:16631214-16631236 CAAAAATTAGCCAGGTATGCTGG - Intergenic
1093242150 12:16690037-16690059 CAAATATTACCCAGGCATGGTGG - Intergenic
1093504363 12:19847855-19847877 GAAAAATGACCCAGGAAAGACGG + Intergenic
1093722677 12:22462933-22462955 TAAACATTAACCAGGCAAGGGGG + Intronic
1094105453 12:26806691-26806713 CAAAAATTACCCAGGCATGGTGG - Intronic
1094602139 12:31918392-31918414 CAAAAATTACCCAGGCATGGTGG + Intergenic
1095171567 12:39042307-39042329 CAAAAATTACCCAGGCATGGTGG + Intergenic
1095357128 12:41288372-41288394 AAAACATTACCCAGGAGAATCGG - Intronic
1095468190 12:42509918-42509940 CAAAAATTAGCCAGGAATGTTGG + Intronic
1095470343 12:42530094-42530116 CAAAAATTAGCCAGGAATGGTGG - Intronic
1095474821 12:42575539-42575561 CAAAAATTAGCCAGGAATGGTGG + Intronic
1095791394 12:46171121-46171143 CAAACATTAGCCAGGCATGGTGG - Intergenic
1095901973 12:47337272-47337294 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1096213652 12:49786310-49786332 CAAAAATTACCCAGGCATGTTGG - Intergenic
1096248706 12:50012604-50012626 CAAAAATTAGCCAGGAATGGTGG + Intronic
1096392128 12:51237890-51237912 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1096730257 12:53605234-53605256 CAAACATTAGCCAGGCATGGTGG + Intronic
1096740187 12:53687805-53687827 CAAACATTAGCCAGGCATGGTGG - Intergenic
1096804376 12:54131457-54131479 CAAAAATTACCCAGGCATGGTGG + Intergenic
1096824665 12:54265892-54265914 CAAAAATTAGCCAGGTAAGGCGG + Intronic
1097793859 12:63842971-63842993 CAAAAATTACCCAGGCACGGTGG + Intergenic
1098142137 12:67460745-67460767 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1098253516 12:68593169-68593191 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
1098394568 12:70004609-70004631 CAAAAATTAACCAGGAATGGTGG + Intergenic
1099685791 12:85886943-85886965 AAAACATTACCCAGGCATGGTGG - Intergenic
1100303530 12:93329621-93329643 CAAAAATTAGCCAGGAGTGCTGG - Intergenic
1100308461 12:93372638-93372660 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1100467056 12:94855585-94855607 CAAAAATTACCCAGGCATGGTGG + Intergenic
1100541173 12:95558898-95558920 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1100915955 12:99422092-99422114 TATAAATTACCCAGCAAAGCAGG + Intronic
1101203874 12:102465782-102465804 CAAACATTAGCCGGGCAAGGTGG + Intronic
1101380001 12:104206228-104206250 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1101447137 12:104745024-104745046 CAAAAATTACCCAGGCATGATGG - Intronic
1101633023 12:106513890-106513912 CAAACATTAGCCAGGAATGGTGG + Intronic
1101668012 12:106837792-106837814 CAAAAATTAGCCAGGCATGCTGG - Intronic
1101741298 12:107502215-107502237 CAAAAATTAGCCAGGCAAGGCGG - Intronic
1102055555 12:109894029-109894051 CAAACATTAGCCAGGCATGGTGG + Intergenic
1102093076 12:110210584-110210606 CAAAAATTAGCCAGGCAAGGTGG + Intronic
1102246395 12:111359117-111359139 CAAAAATTACCCAGGCATGGTGG - Intergenic
1102398149 12:112605220-112605242 CAAACATTAGCCAGGCATGGTGG + Intronic
1102406461 12:112678042-112678064 CAAACATTAGCCAGGCATGGTGG + Intronic
1102689261 12:114747626-114747648 AAAACATGTCCCAGGAAAGCCGG - Intergenic
1102697118 12:114808638-114808660 CAAAAATTACCCAGGCATGGTGG - Intergenic
1102781758 12:115571621-115571643 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
1102830993 12:115999260-115999282 CAAAAATTAGCCAGGCATGCTGG + Intronic
1102862809 12:116351231-116351253 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1103303136 12:119943378-119943400 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1103357080 12:120329643-120329665 CAAAAATTATCCAGGCATGCTGG - Intergenic
1103372754 12:120432064-120432086 CAAAAATTAGCCAGGCAAGTTGG + Intergenic
1103417529 12:120753473-120753495 CAAACATTAGCCAGGAGTGGTGG - Intergenic
1103434734 12:120916001-120916023 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1103458015 12:121081721-121081743 CAAACATTAGCCAGGAGTGGTGG + Intergenic
1103490227 12:121312409-121312431 CAAATATTACCCAGGTAGCCAGG + Intronic
1103759622 12:123239114-123239136 CAAAAATTAGCCAGGCATGCTGG + Intronic
1103876318 12:124130294-124130316 CAAATATTACCCAGGCATGGTGG - Intronic
1104036605 12:125101917-125101939 CAAAAATTACCCAGGCATGGTGG - Intronic
1104042110 12:125137332-125137354 CAAAAATTAGCCAGGCATGCTGG - Intronic
1104192823 12:126499621-126499643 AAAACATTACCCAGGCATGGTGG + Intergenic
1104259758 12:127171867-127171889 CAAACATTAGCCAGGCATGGTGG - Intergenic
1104320584 12:127747329-127747351 CAAACATTAACCAGGCATGGTGG - Intergenic
1104468968 12:129013489-129013511 CAAACATTATCCATGAAAACAGG + Intergenic
1104720347 12:131041844-131041866 GAAAAATAACCCAGGAAAGGAGG - Intronic
1104774909 12:131385308-131385330 CAAAAATTAACCAGGAATGGTGG - Intergenic
1105045872 12:133002774-133002796 CAAAAATTAGCCAGGCATGCTGG - Intronic
1105300441 13:19129324-19129346 CAAAAATTAGCCAGGCAAGATGG + Intergenic
1105351479 13:19620160-19620182 CAAAAATTACCCAGGCATGATGG - Intergenic
1105434564 13:20365412-20365434 CAAAAATTACCCAGGCATGGTGG + Intergenic
1105434585 13:20365548-20365570 CAAAAATTACCCAGGCATGGTGG + Intergenic
1105434606 13:20365684-20365706 CAAAAATTACCCAGGCATGGTGG + Intergenic
1105574202 13:21635021-21635043 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
1105688926 13:22816107-22816129 CAAACATTAGCCAGGCGAGGTGG - Intergenic
1105783821 13:23728117-23728139 CAAAAATTACCCAGGCATGGTGG + Intergenic
1105861392 13:24418373-24418395 CAAAAATTACCCAGGCATGGTGG - Intergenic
1105869773 13:24494344-24494366 AAAACATTACCCAGGAATGGTGG - Intronic
1105952205 13:25239679-25239701 CAAACATTAGCCAGGCATGGTGG + Intergenic
1106017765 13:25885263-25885285 CAAAAATTAGCCAGGCATGCTGG - Intronic
1106061488 13:26297146-26297168 GAACAATTACCAAGGAAAGCAGG + Intronic
1106095346 13:26638372-26638394 GAGACATTTCCCAGAAAAGCTGG + Intronic
1106260247 13:28060267-28060289 AAAACATTAGCCAGGAATGGTGG + Intronic
1106354707 13:28969931-28969953 CAAAAATTAGCCAGGCATGCTGG - Intronic
1106509529 13:30400956-30400978 CAAACATTAGCCAGGCATGGTGG + Intergenic
1106550221 13:30764659-30764681 CAAAAATTAGCCAGGTATGCTGG + Intergenic
1106783390 13:33082870-33082892 CAAACATTAGCCAGGCATGGTGG + Intergenic
1106882379 13:34145594-34145616 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1107068481 13:36243345-36243367 CAAAAATTAGCCAGGAATGGTGG + Intronic
1107079732 13:36362052-36362074 CAAACAATACCCATGTCAGCCGG + Intronic
1107391867 13:39973165-39973187 CTAACATGTCCCAGGAAAGAGGG - Intergenic
1107591269 13:41909209-41909231 CAAACATTAGCCAGGCATGGTGG - Intronic
1107618375 13:42197095-42197117 CAAAAATTAGCCAGGCATGCTGG + Intronic
1107672805 13:42763836-42763858 CAAAAATTACCCAGGCATGGTGG + Intergenic
1107733012 13:43367517-43367539 CAAGGATCACCCAGGATAGCCGG + Intronic
1107937204 13:45355123-45355145 CAAAAATTACCCAGGCGTGCTGG - Intergenic
1108022170 13:46138797-46138819 CAAAAATTAGCCAGGTATGCTGG - Intronic
1108283706 13:48884827-48884849 CAAAAATTAGCCAGGAGTGCTGG + Intergenic
1108351025 13:49590877-49590899 CAAAAATTAGCCAGGCAAGATGG + Intergenic
1108387294 13:49911617-49911639 CAAAAATTAGCCAGGAGAGGTGG - Intergenic
1108688289 13:52839769-52839791 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
1108931876 13:55835260-55835282 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1109634518 13:65096730-65096752 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1110169344 13:72482290-72482312 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1110197075 13:72802312-72802334 AAAACATTATCCAGGACAACAGG - Intronic
1110228879 13:73147703-73147725 CAAACATTAGCCAGGCACGATGG + Intergenic
1110270310 13:73581775-73581797 CAAACATTACCCAGGCGTGGTGG + Intergenic
1110276572 13:73647876-73647898 CAAACATTAGCCAGGCATGATGG + Intergenic
1111246866 13:85551748-85551770 CAAACATTAGCCAGGCATGGTGG + Intergenic
1111343422 13:86917569-86917591 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1111534765 13:89588985-89589007 CAAACAAAACACAGCAAAGCTGG + Intergenic
1111701235 13:91692794-91692816 CAAAAATTACCCAGGCATGGTGG - Intronic
1112245247 13:97727669-97727691 CAAACATTAGCCAGGCATGGTGG - Intergenic
1112252857 13:97799614-97799636 CAAACATGAGCCATGAAATCTGG - Intergenic
1112369218 13:98780336-98780358 CAAAAATTACCCAGGCATGATGG - Intergenic
1112370773 13:98791551-98791573 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1112438861 13:99410696-99410718 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1112478202 13:99751371-99751393 CAAACATTAGCCAGGTATGGTGG - Intronic
1112519972 13:100086569-100086591 CAAACATTAGCCAGGCATGGTGG - Intergenic
1112527910 13:100169850-100169872 CAAAAATTAGCCAGGCAAGGTGG - Intronic
1113366097 13:109677355-109677377 CAAAAATTAGCCAGGAATGTTGG + Intergenic
1113586452 13:111469318-111469340 CAAACATTAGCCAGGCATGGTGG - Intergenic
1113630875 13:111882824-111882846 CCAACATGACACACGAAAGCAGG - Intergenic
1113724113 13:112585617-112585639 CAAAAATTAGCCAGGAGTGCTGG + Intronic
1114150163 14:20029769-20029791 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1114300364 14:21371027-21371049 CAAAAATTATTCAGGAAGGCTGG - Intronic
1114303723 14:21401735-21401757 CAAAAATTAGCCAGGAATGGTGG - Intronic
1114467285 14:22932071-22932093 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1115219954 14:31049115-31049137 CAAAAATTAGCCAGGCATGCCGG + Intronic
1115241574 14:31255347-31255369 CAAACATTAGCCAGGCATGGTGG + Intergenic
1115550420 14:34499889-34499911 CATAAATTACCCAGGAATGGTGG + Intergenic
1115631844 14:35253179-35253201 CAAAAATTAGCCAGGTATGCTGG + Intronic
1115658732 14:35469026-35469048 CAAAAATTACCCAGGCATGGTGG + Intergenic
1115710048 14:36040447-36040469 CAAACATTAGCCAGGCATGGTGG - Intergenic
1115817771 14:37181236-37181258 CAAACATTAGCCAGGAGTGGTGG - Intergenic
1116219832 14:42069347-42069369 CAAAAATTAGCCAGGGATGCTGG + Intergenic
1116347971 14:43820716-43820738 CAACCTTCACCCAAGAAAGCAGG - Intergenic
1116361906 14:44010297-44010319 CCAACAATACCCACGAAAGCGGG + Intergenic
1116491302 14:45506710-45506732 CAAAAATTACCCAGGCATGGTGG - Intergenic
1116578386 14:46605782-46605804 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1116878723 14:50142158-50142180 TAAAAATTACCCAGGCATGCTGG - Intronic
1116935062 14:50731375-50731397 CAAAAATTACCCAGGCATGGTGG + Intronic
1117530393 14:56655235-56655257 CAAAAATTAGCCAGGCAAGGTGG + Intronic
1117743503 14:58843698-58843720 CAAACATTAGCCAGGCATGGTGG + Intergenic
1118189782 14:63570020-63570042 CAAAAATTACCCAGGCATGGTGG + Intergenic
1118262817 14:64263502-64263524 CAAAAATTACCCAGGCATGGTGG + Intronic
1118391415 14:65298902-65298924 CAAACATTAGCCAGGCATGGTGG + Intergenic
1118754080 14:68825488-68825510 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1118993403 14:70816302-70816324 CAAAAATTAGCCAGGTAAGGTGG + Intergenic
1119125713 14:72124382-72124404 AACACAATACACAGGAAAGCAGG + Intronic
1119241549 14:73064545-73064567 CAAAAATTAGCCAGGAATGGTGG - Intronic
1119253727 14:73180135-73180157 CAAAAATTACCCAGGCATGGTGG - Intronic
1119351001 14:73965568-73965590 CAAAAATTAGCCAGGAATGGTGG + Exonic
1119363312 14:74069988-74070010 CAAAAATTAGCCAGGAATGGTGG - Intronic
1119397071 14:74334375-74334397 AAAACATTACCCAGGCATGGCGG + Intronic
1119455087 14:74748254-74748276 CAAAAATTACCCAGGCATGGTGG + Intergenic
1119470607 14:74895745-74895767 CAAAAATTACCCAGGCATGGTGG + Intronic
1119671964 14:76526726-76526748 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1119813155 14:77541179-77541201 CAAAAATTACCCAGGCATGGTGG - Intronic
1120167375 14:81215880-81215902 CAAAAATTAGCCAGGCATGCTGG + Intronic
1120411625 14:84164441-84164463 CTAACATGACCCAGTAACGCTGG - Intergenic
1121065212 14:90957215-90957237 CAAAAATTACCCAGGCATGGTGG - Intronic
1121085171 14:91140516-91140538 CAAACATTAGCCAGGCATGATGG + Intronic
1121149103 14:91614508-91614530 CAAAAATTAGCCAGGAATGGTGG + Intronic
1121351540 14:93177284-93177306 CAAAAATTAGCCAGGAATGATGG + Intergenic
1121896118 14:97649459-97649481 CACATATTAGCCAGGAAAGTGGG + Intergenic
1122694578 14:103546515-103546537 CACAAATTACCCAGGAGGGCCGG + Intergenic
1122989016 14:105228014-105228036 CAAATACCACCCAGCAAAGCCGG + Intronic
1123175539 14:106414260-106414282 CAAAAATTACCCAGGCATGGTGG - Intergenic
1123223564 14:106879072-106879094 CAAACATTAGCCAGGCATGGTGG + Intergenic
1202906279 14_GL000194v1_random:74217-74239 CAAAAATTAGCCAGGCACGCTGG - Intergenic
1124361090 15:29036865-29036887 CAAAAATTAGCCAGGCAAGGTGG + Intronic
1124623099 15:31290402-31290424 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1124838560 15:33219930-33219952 CAAACATTAGCCAGGCATGGTGG + Intergenic
1125635110 15:41181400-41181422 CAAAAATTAGCCAGGTATGCTGG - Intergenic
1125646999 15:41281009-41281031 CAAAAATTACCCAGGTATGGTGG - Exonic
1125904909 15:43382514-43382536 GAAACATTATACAGGACAGCTGG - Intronic
1125913952 15:43467934-43467956 CAAAAATTAGCCAGGCATGCTGG - Intronic
1125961362 15:43832596-43832618 CAAAAATTACCCAGGCATGGTGG - Intronic
1126711105 15:51457017-51457039 CAAAAATTAGCCAGGCACGCTGG + Intronic
1127013511 15:54656570-54656592 CAAAAATTACCCAGGTATGGTGG - Intergenic
1127028446 15:54834279-54834301 CAAACATTAGCCAGGCATGGTGG - Intergenic
1127054654 15:55119181-55119203 CAAAGATTAGCCAGGCAAGGTGG - Intergenic
1127062946 15:55206056-55206078 CAAAAATTAGCCAGGAATGGTGG + Intronic
1127211306 15:56777451-56777473 CAAACATTAGCCAGGCATGGTGG + Intronic
1127401172 15:58587573-58587595 CAAACTTAACCCAGGAACGAAGG + Intergenic
1127402271 15:58601307-58601329 CAAAAATTAGCCAGGAATGATGG + Intronic
1127774913 15:62257037-62257059 CAAAAATTACCCAGGAGTGGTGG + Intergenic
1127795593 15:62435692-62435714 CAAAAATTAGCCAGGCAAGGTGG - Intronic
1128016392 15:64351724-64351746 CAAAAATTAGCCAGGTATGCTGG + Intronic
1128070737 15:64795091-64795113 CAAACATTAGCCAGGCATGGTGG + Intergenic
1128144394 15:65324610-65324632 CAAAAATTACCCAGGCATGGTGG - Intergenic
1128165919 15:65464528-65464550 CAAAAATTACCCAGGCATGGAGG + Intronic
1128188901 15:65671540-65671562 CAAAAATTACCCAGGCATGGTGG - Intronic
1128281669 15:66399747-66399769 CAAAAATTACCCAGGCATGGTGG - Intronic
1128354312 15:66913924-66913946 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1128425248 15:67536523-67536545 CAAAAATTACCCAGGCATGGTGG - Intergenic
1128459615 15:67856677-67856699 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1128586508 15:68856301-68856323 CAAAAATTACCCAGGCATGGTGG - Intronic
1128663016 15:69516371-69516393 CAAAAATTAGCCAGGTATGCTGG - Intergenic
1128964789 15:72047921-72047943 CAAAAATTAGCCAGGCAAGGTGG - Intronic
1129098835 15:73238999-73239021 CAAAAATTACCCAGGCATGGTGG - Intronic
1129251743 15:74312957-74312979 CAAACAATGCCCTGGAAGGCTGG + Intronic
1129374619 15:75121008-75121030 CAAAAATTACCCAGGAATGATGG + Intergenic
1129419910 15:75416476-75416498 CAAAAATTAGCCAGGCATGCTGG - Intronic
1129443469 15:75599515-75599537 CCAACAGTAGCCAGGGAAGCAGG - Intronic
1129527165 15:76226429-76226451 CAAACATTAGCCAGGCATGGTGG + Intronic
1129563184 15:76592974-76592996 CATTCATTACCCTGGAAAGGGGG + Intronic
1129626984 15:77211693-77211715 CAAACATTAGCCAGGCATGGTGG + Intronic
1129808384 15:78483935-78483957 CAAAAATTACCCAGGAATGATGG - Intronic
1130025142 15:80264484-80264506 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1130129924 15:81132122-81132144 CAAAAATTACCCAGGCATGGTGG + Intronic
1130431795 15:83855856-83855878 CAAAAATTAGCCAGGCATGCTGG + Intronic
1130537151 15:84794627-84794649 CAAAAATTAGCCAGGAATGGTGG - Intronic
1130829732 15:87587135-87587157 CAAAAATTACCCAGGCATGGTGG + Intergenic
1130845794 15:87744206-87744228 AAAAAATTACCCAGGCATGCTGG + Intergenic
1131008130 15:88995246-88995268 TAAACATTACCCGGGCAAGGTGG + Intergenic
1132100993 15:99023475-99023497 CAAACATTAGCCAGGCATGGTGG - Intergenic
1132481435 16:168110-168132 CAAAAATTAGCCAGGAATGGCGG - Intergenic
1133123985 16:3632736-3632758 CAAAAATTACCCAGGCATGGTGG - Intronic
1133406921 16:5531950-5531972 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1133444172 16:5846018-5846040 CAAAAATTACCCAGGCATGGAGG + Intergenic
1133551979 16:6865153-6865175 CAAAAATTACCCAGGAGTGGTGG - Intronic
1133671211 16:8022789-8022811 CAAAAATTAGCCAGGGATGCTGG - Intergenic
1133795580 16:9043688-9043710 CAAACATTAGCCAGGCATGATGG - Intergenic
1133834835 16:9358703-9358725 CAAAAATTAGCCAGGCACGCTGG - Intergenic
1133931605 16:10237206-10237228 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1133931981 16:10240174-10240196 CAAAAATTATCCAGGCAAGGTGG - Intergenic
1134047589 16:11112512-11112534 AAAAGATTACCCAGGAATGATGG + Intronic
1134127090 16:11623505-11623527 CAAAAATTAGCCAGGCAAGGTGG + Intronic
1134176661 16:12012559-12012581 CAAACATTAGCCAGGCATGGGGG - Intronic
1134178129 16:12025147-12025169 CAAACATTAGCCAGGCATGGTGG + Intronic
1134262485 16:12663211-12663233 CAAAAATTAGCCAGGCATGCTGG - Exonic
1134272312 16:12743850-12743872 CAAACATTACCCAGGAGTGGTGG + Intronic
1134380059 16:13715874-13715896 CCAACAGTCTCCAGGAAAGCTGG + Intergenic
1134418808 16:14067982-14068004 CAAAAATTACCCAGGCATGGTGG - Intergenic
1134439569 16:14290511-14290533 CAAAAATTACCCAGGTATGGTGG + Intergenic
1134455353 16:14391341-14391363 CAAAGATTACCCAGGTGAGGTGG - Intergenic
1134567550 16:15264469-15264491 CAAACATTAGCCAGGCATGGTGG - Intergenic
1134621865 16:15695353-15695375 CAAAAATTAGCCAGGAATGGTGG + Intronic
1134658265 16:15964094-15964116 CAAACATTAGCCAGGCATGATGG - Intronic
1134689519 16:16182097-16182119 CCAACATTACTCAGCAAGGCAGG + Intronic
1134734941 16:16492213-16492235 CAAACATTAGCCAGGCATGGTGG + Intergenic
1134752829 16:16639798-16639820 CAAACATTAGCCAGGCAAGGTGG - Intergenic
1134798858 16:17066224-17066246 CAAAAATTACCCAGGCATGGTGG - Intergenic
1134822181 16:17255853-17255875 CAAAAATTATCCAGGAGAGGTGG + Intronic
1134932581 16:18220006-18220028 CAAACATTAGCCAGGCATGGTGG - Intergenic
1134993229 16:18719278-18719300 CAAACATTAGCCAGGCAAGGTGG + Intergenic
1135044315 16:19142369-19142391 CAAAAATTACCCAGGCATGGTGG - Intronic
1135075325 16:19388383-19388405 CAAAAATTACCCAGGCATGGTGG + Intergenic
1135122698 16:19780192-19780214 CAAAAATTAGCCAGGCAAGGTGG - Intronic
1135170044 16:20175992-20176014 CAAAAATTAGCCAGGTATGCTGG - Intergenic
1135184413 16:20302875-20302897 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
1135378355 16:21970736-21970758 CAAAAATTAGCCAGGAATGGTGG - Intronic
1135574766 16:23577011-23577033 CAAACATTAGCCAGGCATGGTGG - Intergenic
1135581618 16:23632289-23632311 CAAAAATTACCCAGGCATGGTGG + Intronic
1135611289 16:23869867-23869889 CAAAAATTAGCCAGGCATGCTGG + Intronic
1136045609 16:27612604-27612626 CAAAGATTATCCAGGCAAGGTGG + Intronic
1136312301 16:29420920-29420942 CAAAAATTAGCCAGGAACGGTGG + Intergenic
1136341215 16:29644764-29644786 GAAACATCACGCAGGAAAGTGGG - Intergenic
1136353845 16:29730348-29730370 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1136538639 16:30915308-30915330 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1136616397 16:31401105-31401127 CAAAAATTAGCCAGGCAAGGTGG + Intronic
1136847101 16:33585462-33585484 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1136867731 16:33770220-33770242 CAAACATTAGCCAGGCATGCTGG + Intergenic
1137263302 16:46848325-46848347 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1137435900 16:48453974-48453996 CAAAAATTACCCAGGCATGGTGG + Intergenic
1137807949 16:51325273-51325295 CAAACATTAGCCAGGCATGGTGG + Intergenic
1138139361 16:54554568-54554590 CAACCTGTATCCAGGAAAGCTGG + Intergenic
1138415531 16:56869478-56869500 CAAAAATTAGCCAGGCATGCTGG - Intronic
1138580119 16:57935525-57935547 CAAAAATTAGCCCGGAAAGGTGG + Intronic
1138797314 16:59984981-59985003 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1138912356 16:61416780-61416802 CAAAAATTACCCAGGCATGGTGG - Intergenic
1139037040 16:62959594-62959616 CAAACATTAGCCAGGCATGATGG - Intergenic
1139241890 16:65401553-65401575 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1139250389 16:65489893-65489915 CACATACTACCCAGGAAAGATGG + Intergenic
1139273432 16:65704696-65704718 CAAAAATTACCCAGGCATGGTGG + Intergenic
1139382998 16:66546075-66546097 CAAAAATTAGCCAGGAATGGTGG + Intronic
1139481894 16:67235375-67235397 CAAAAATTACCCAGGTATCCTGG + Intronic
1139568243 16:67793462-67793484 CAAACATTAGCCAGGCATGGTGG - Intronic
1139740107 16:69028110-69028132 CAAAAATTACCCAGGCATGGTGG - Intronic
1139761087 16:69185398-69185420 CAAACATTAGCCAGGCATGGTGG - Intronic
1139817120 16:69683944-69683966 CAAAAATTACCCAGGTATGATGG + Intronic
1139871085 16:70109133-70109155 TAAAAATTACCCAGGAATGGTGG - Intergenic
1139871149 16:70109641-70109663 AAAAAATTACCCAGGAATGGTGG + Intergenic
1140103886 16:71941735-71941757 CAAAAATTACCCAGGCATGGTGG - Intronic
1140114172 16:72027281-72027303 CAAAAATTAGCCAGGCACGCTGG - Intronic
1140290077 16:73645115-73645137 CAGATATTACCAGGGAAAGCTGG + Intergenic
1140375721 16:74444231-74444253 AAAAAATTACCCAGGAATGGTGG - Intergenic
1140375786 16:74444739-74444761 TAAAAATTACCCAGGAATGGTGG + Intergenic
1140716619 16:77732173-77732195 CAAAAATTAGCCAGGCATGCTGG + Intronic
1140799500 16:78472654-78472676 CAAAAATTAGCCAGGAATGGTGG + Intronic
1140863001 16:79035689-79035711 CAAACATTAGCCAGGCATGGTGG - Intronic
1140969480 16:79999234-79999256 CAAAAATTAGCCAGGCAAGTTGG - Intergenic
1141064877 16:80906172-80906194 CAAAAATTACCCAGGCATGGTGG + Intergenic
1141184383 16:81776705-81776727 CAAAAATTACCCAGGCATGGTGG - Intronic
1141424134 16:83934551-83934573 AAGACCTTAGCCAGGAAAGCTGG - Intronic
1141433430 16:83983019-83983041 CAAAAATTACCCAGGAGTGGTGG - Intronic
1141516942 16:84551614-84551636 CAAAAATTACCCAGGCATGGCGG + Intronic
1142007545 16:87696820-87696842 AAAACATTACCCAGAAAAAAAGG - Exonic
1142295949 16:89222514-89222536 CAAAAATTAGCCAGGCATGCTGG - Intronic
1142344643 16:89546237-89546259 CAAAAATTAGCCAGGCAAGACGG - Intronic
1142368321 16:89662944-89662966 CAAAAATTACCCAGGCATGGTGG - Intronic
1203104429 16_KI270728v1_random:1345983-1346005 CAAACATTAGCCAGGCATGCTGG - Intergenic
1203108809 16_KI270728v1_random:1434117-1434139 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1203129085 16_KI270728v1_random:1616385-1616407 CAAACATTAGCCAGGCATGCTGG + Intergenic
1142673572 17:1499338-1499360 CAAACATTAGCCAGGCATGGTGG + Intronic
1142837958 17:2603300-2603322 CAAAAATTACCCAGGCATGGTGG - Intronic
1143000757 17:3793699-3793721 CAAAAATTAGCCAGGAGTGCTGG - Intronic
1143113215 17:4565200-4565222 CAAAAATTACCCAGGCATGGTGG - Intergenic
1143169403 17:4918829-4918851 CAAAAATTACCCAGGCATGGTGG + Intergenic
1143370576 17:6436390-6436412 CAAAAATTACCCAGGCATGGTGG + Intergenic
1143533500 17:7521109-7521131 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1143614959 17:8044267-8044289 CAAAAATTAGCCAGGCATGCTGG + Intronic
1143638581 17:8181736-8181758 CAAAAATTACCCAGGCATGGTGG + Intergenic
1143759742 17:9092438-9092460 CAAAAATTACCCAGGCATGGTGG - Intronic
1144037807 17:11383088-11383110 CAAAAATTAACCAGGCAAGGTGG - Intronic
1144171039 17:12660297-12660319 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1144234044 17:13239428-13239450 CAAAAATTACCCAGGCATGATGG + Intergenic
1144279028 17:13705969-13705991 CAAACATTAGCCAGGTATGGTGG - Intergenic
1144288272 17:13800574-13800596 CAAAAATTACCCAGGCATGGTGG - Intergenic
1144453081 17:15397367-15397389 CAAAAATTACCCAGGCATGGTGG + Intergenic
1144539196 17:16122787-16122809 CAAAAATTAACCAGGTATGCTGG - Intronic
1144645022 17:16966989-16967011 CAAAAATTAGCCAGGCATGCTGG - Intronic
1144757517 17:17688750-17688772 CAAACATTAGCCAGGCATGGTGG - Intronic
1145053484 17:19682208-19682230 CAAAAATTAGCCAGGCAAGGTGG + Intronic
1145359485 17:22200558-22200580 CAAACATTAGCCAGGCATGGTGG - Intergenic
1145837603 17:27966442-27966464 CAAACATTAGCCAGGCATGGTGG - Intergenic
1146023707 17:29301205-29301227 CAAACATTATCCAGGTGAGCCGG - Intergenic
1146038886 17:29432624-29432646 CAAAAATTAGCCAGGCAGGCCGG - Intronic
1146047926 17:29525842-29525864 CAAAAATTACCCAGGCATGGTGG + Intronic
1146173118 17:30647992-30648014 CAAAAATTACCCAGGCATGGTGG + Intergenic
1146296920 17:31657539-31657561 CAAAAATTAGCCAGGAACGGTGG + Intergenic
1146346578 17:32064025-32064047 CAAAAATTACCCAGGCATGGTGG + Intergenic
1146509245 17:33431449-33431471 CAAAAATTACCCAGGCATGGTGG + Intronic
1146615614 17:34355223-34355245 CAAAAATTACCCAGGCATGGTGG - Intergenic
1146700833 17:34958289-34958311 CAAACATTAGCCAGGCATGATGG + Intronic
1146729461 17:35181636-35181658 CAAACATTAGCCAGGCATGGTGG + Intronic
1146737792 17:35253848-35253870 CAAAAATTAGCCAGGCAAGGTGG - Intronic
1146874884 17:36401537-36401559 CAAAAATTAGCCAGGCATGCTGG - Intronic
1147039759 17:37709400-37709422 CAAAAATTAGCCAGGAATGGTGG - Intronic
1147064504 17:37911342-37911364 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1147739409 17:42662150-42662172 CAAACATTATCCAGGCATGGTGG + Intronic
1148177784 17:45582814-45582836 CAAACATTAGCCAGGCGTGCTGG + Intergenic
1148234550 17:45959626-45959648 CAAAAATTACCCAGGCATGGTGG + Intronic
1148360172 17:47005175-47005197 AAAACATTTCCAAGGAAAACAGG - Intronic
1148532267 17:48405651-48405673 CAAACATTAGCCAGGCATGGTGG - Intronic
1148583963 17:48763646-48763668 CAAACATTAGCCAGGAACAGTGG + Intronic
1148595352 17:48850003-48850025 CAAAAATTAGCCAGGAGACCGGG + Intronic
1148632774 17:49125310-49125332 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1148640934 17:49186676-49186698 CAAACATTAGCCAGGCATGCTGG + Intergenic
1148840855 17:50495965-50495987 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1148908530 17:50927154-50927176 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1148947866 17:51281023-51281045 CAAAAATTAGCCAGGCATGCTGG + Intronic
1149152548 17:53585977-53585999 CAAACATTACCCAGGCATGGTGG + Intergenic
1149249534 17:54752499-54752521 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1149487439 17:57053892-57053914 CAAAAATTACCCAGGCATGGTGG + Intergenic
1149550988 17:57539537-57539559 CAAAAATTAGCCAGGAACGGTGG + Intronic
1149764920 17:59267820-59267842 CAAAAATTAGCCAGGCAAGGTGG - Intronic
1149879386 17:60273123-60273145 CAAAAATTAGCCAGGCATGCTGG - Intronic
1149936637 17:60813383-60813405 CAAAGATTAGCCAGGCAAGGTGG - Intronic
1150174566 17:63037659-63037681 CAAAAATTAGCCAGGCATGCTGG + Intronic
1150268976 17:63850194-63850216 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1150351759 17:64450630-64450652 CAAAAATTACCCAGGCATGGTGG - Intronic
1150370921 17:64637277-64637299 CAAAAATTAGCCAGGAATGGTGG - Intronic
1150441034 17:65191592-65191614 CAAAAATTAGCCAGGAATGGTGG + Intronic
1150490941 17:65573870-65573892 CAAAAATTAGCCAGGAATGGTGG + Intronic
1150589910 17:66553132-66553154 CAAAAATTAGCCAGGCATGCTGG - Intronic
1150599628 17:66639538-66639560 CAAAAATTACCCAGGCATGGTGG - Intronic
1150654206 17:67029177-67029199 CAAAAATTACCCAGGCATGGTGG + Intronic
1150786546 17:68167874-68167896 AAAACATTTCCAAGGAAATCAGG + Intergenic
1150795849 17:68235980-68236002 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1150807590 17:68331395-68331417 GAAAAATTAGCCAGGCAAGCTGG - Intronic
1151033155 17:70765475-70765497 CAAACATTAGCCAGGCATGGTGG - Intergenic
1151066233 17:71153103-71153125 CAAACATTAGCCAGGTATGGTGG + Intergenic
1151148227 17:72061494-72061516 CAAAAATTAGCCAGGAGAGGTGG + Intergenic
1151312451 17:73301984-73302006 CAAAAATTAGCCAGGCAGGCAGG - Intronic
1151667383 17:75553110-75553132 TAAACATTTCCCAGGAAAAGGGG - Intronic
1151688610 17:75665535-75665557 CAAAAATTACCCAGGCATGGTGG + Intronic
1151818875 17:76486260-76486282 CAAACATTACCCAGGCATGGTGG - Intronic
1151845366 17:76650384-76650406 CAAAAATTAGCCAGGCGAGCTGG - Intergenic
1152005962 17:77681324-77681346 CAAACATTAGCCAGGCATGGTGG + Intergenic
1152043767 17:77922584-77922606 CAAACATTAGCCAGGCATGGCGG - Intergenic
1152220097 17:79059159-79059181 CAAAAATTACCCAGGCATGGTGG - Intergenic
1152342325 17:79731943-79731965 CAAACATTAGCCAGGCATGATGG + Intronic
1152367292 17:79863733-79863755 CAAACATTAGCCAGGCATGGTGG - Intergenic
1152656428 17:81521522-81521544 CAAACATTAGCCAGGCATGGTGG - Intronic
1152714636 17:81892673-81892695 CAAACATTAGCCAGGTATGGTGG - Intronic
1152848974 17:82620279-82620301 CAAACATTAGCCAGGCATGGCGG + Intronic
1153009147 18:522134-522156 CAAAAATTACCCAGGCATGGTGG - Intergenic
1153505694 18:5795903-5795925 AAAACATGATCCAGGAGAGCAGG - Intergenic
1153623170 18:6998878-6998900 CAAAAATTAGCCAGGCAAGGTGG + Intronic
1153695545 18:7637013-7637035 CAAAAATTAACCAGGCAAGGTGG + Intronic
1153986491 18:10355588-10355610 CAAAGATAGCCCAGGAAAGTAGG + Intergenic
1154237251 18:12617561-12617583 CAAACATTAGCCAGGCATGGTGG - Intronic
1154471113 18:14702697-14702719 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1154978116 18:21479032-21479054 CAAAAATTAACCAGGCAAGGTGG - Intronic
1155033925 18:22008202-22008224 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1155061332 18:22231581-22231603 CAAACATTAGCCAGGCATGGTGG + Intergenic
1155329566 18:24701041-24701063 CAAAAATTACCCAGGCATGGTGG - Intergenic
1155462088 18:26093932-26093954 CAAAAATTACCCAGGCATGGCGG - Intergenic
1155960894 18:31993857-31993879 CAAACATTAGCCAGGCATGGTGG + Intergenic
1156191687 18:34727715-34727737 CAAAAATTAGCCAGGGAAGGTGG - Intronic
1156258291 18:35420731-35420753 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1156327715 18:36089289-36089311 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1156604603 18:38651558-38651580 AAAACATTACCCAGGCATGGTGG + Intergenic
1156813103 18:41275524-41275546 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1156963258 18:43058734-43058756 CAAAAATTACCCAGGCATGGTGG + Intronic
1157072818 18:44429214-44429236 CAAAAATTAGCCAGGAATGATGG + Intergenic
1157167572 18:45372157-45372179 CAAAAATTAGCCAGGAATGGTGG + Intronic
1157511833 18:48280818-48280840 AAAAAATTACCTAGGAAAGCTGG - Intronic
1157663389 18:49465508-49465530 CAGGCAATACCCAGGAATGCTGG - Intergenic
1157669143 18:49513588-49513610 CAAAAATTACCCAGGCATGGTGG - Intergenic
1157851760 18:51060784-51060806 CAAACATTAGCCAGGCATGGTGG - Intronic
1158337757 18:56432405-56432427 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
1158360768 18:56670661-56670683 CAAACATTAGCCAGGCGAGGTGG - Intronic
1158392700 18:57056559-57056581 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1158431952 18:57397133-57397155 CAAAAATTACCCAGGCATGGTGG + Intergenic
1158708534 18:59816735-59816757 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1159047037 18:63378606-63378628 CAAAAATTACCCAGGCATGGTGG - Intergenic
1159052078 18:63429889-63429911 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1159572789 18:70138124-70138146 CAAAAATTACCCAGGCATGGTGG + Intronic
1159757498 18:72383888-72383910 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1159884524 18:73891575-73891597 CAAACATCACACAGGCAAGCGGG - Intergenic
1160065511 18:75570492-75570514 CAAACATTAGCCAGGCATGGTGG + Intergenic
1160468157 18:79100535-79100557 CAAACATTAATCAAAAAAGCTGG - Intronic
1161033192 19:2069349-2069371 AAAACATTACCCAGGCATGGTGG + Intergenic
1161175169 19:2837834-2837856 CAAACATTAGCCAGGCATGGTGG + Intergenic
1161213820 19:3082929-3082951 CAAACATTAGCCAGGCATGGTGG - Intergenic
1161293957 19:3510285-3510307 CAAACATTAGCCAGGTATGGTGG - Intronic
1161330001 19:3682219-3682241 CAAACATTAGCCAGGCATGGGGG + Intronic
1161364908 19:3872911-3872933 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1161441435 19:4293912-4293934 CAAACATTACCCAGGCGTGGTGG - Intronic
1161493274 19:4574507-4574529 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
1161505876 19:4643124-4643146 CAAAAATTACCCAGGCATGGTGG + Intronic
1161542934 19:4863002-4863024 CAAACATTAGCCAGGCATGATGG + Intronic
1161546334 19:4882736-4882758 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1161651504 19:5488475-5488497 TAAACATTAGCCAGGTAGGCCGG - Intergenic
1161840469 19:6677256-6677278 CAAAAATTACCCAGGCAAGGTGG + Intergenic
1161865062 19:6827425-6827447 CAAAAATTAGCCAGGAATGGTGG - Intronic
1161920119 19:7259664-7259686 CAAACATTAGCCAGGCATGGTGG + Intronic
1161921799 19:7271855-7271877 AAAACATTAGCTAGGAATGCTGG + Intronic
1162005591 19:7776580-7776602 CAAACATTAGCCAGGCATGGTGG + Intergenic
1162090082 19:8273826-8273848 CAAACATTAGCCAGGCATGGTGG - Intronic
1162092316 19:8288689-8288711 CAAACATTAGCCAGGCATGGTGG - Intronic
1162312938 19:9918029-9918051 CAAAAATTACCCAGGCATGGTGG - Intronic
1162324120 19:9988676-9988698 CAAAAATTACCCAGGAGTGGTGG + Intronic
1162436257 19:10661226-10661248 CAAAAATTAGCCAGGAATGGTGG + Intronic
1162445256 19:10718677-10718699 CAGACTTCACCCACGAAAGCTGG - Intronic
1162541974 19:11302374-11302396 CAAACATTAGCCAGGCATGGTGG + Intronic
1162617378 19:11813316-11813338 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1162680878 19:12340179-12340201 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1162764092 19:12907636-12907658 CAAAAATTACCCAGGCATGGTGG + Intronic
1162805201 19:13134521-13134543 CAAAAATTAGCCAGGTAAGGTGG - Intronic
1162848914 19:13415586-13415608 CAAAAATTACCCAGGCATGGTGG + Intronic
1162956127 19:14099137-14099159 CAAAAATTAGCCAGGCAAGGGGG + Intronic
1162989302 19:14292069-14292091 CAAAAATTACCCAGGCATGGTGG - Intergenic
1163076697 19:14899056-14899078 CAAAAATTACCCAGGCATGGTGG - Intergenic
1163476854 19:17531684-17531706 CAAAAATTACCCAGGCATGGTGG - Intronic
1163488056 19:17600900-17600922 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1163521419 19:17794260-17794282 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1163574938 19:18105212-18105234 CAAAAATTAGCCAGGCATGCTGG + Intronic
1163624732 19:18382656-18382678 CAAAAATTACCCAGGCATGGTGG + Intronic
1163845488 19:19636049-19636071 CAAACATTAACCAGGCATGGTGG + Intronic
1163911097 19:20193506-20193528 CAAACATTATCCGGGCATGCTGG + Intronic
1163937165 19:20457550-20457572 CAAAGATTACCCAGGCATGGTGG - Intergenic
1163964481 19:20731931-20731953 CAAAAATTAGCCAGGCAAGGTGG + Intronic
1164089795 19:21939387-21939409 CAAAAATTAGCCAGGCATGCTGG - Intronic
1164225303 19:23240161-23240183 CAAAAATTACCCAGGCGAGGTGG + Intronic
1164253929 19:23510714-23510736 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1164279494 19:23757021-23757043 CAAACATTAGCCAGGCATGGTGG - Intronic
1164729557 19:30492407-30492429 CAAACATTCCCCAGAAATGATGG - Intronic
1164849994 19:31473691-31473713 CAAACATTAGCCAGGCATGGTGG + Intergenic
1164870292 19:31637796-31637818 AAAACATTAGCCAGGAATGGTGG + Intergenic
1164872583 19:31658479-31658501 CAGACATTGCCCAAGGAAGCTGG + Intergenic
1164894529 19:31860842-31860864 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1165033459 19:33015270-33015292 CAAAAATTAACCAGGCATGCTGG + Intronic
1165129658 19:33623580-33623602 GAAAGGTTACCCAGGAAAGTGGG - Intronic
1165202566 19:34157112-34157134 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1165232319 19:34394864-34394886 CAAAAATTAGCCAGGCAAGGTGG - Intronic
1165301919 19:34975554-34975576 CAAACATTAGCCAGGCATGGTGG + Intergenic
1165323736 19:35101851-35101873 CAAAAATTAGCCAGGAGAGGTGG + Intergenic
1165471214 19:36005864-36005886 CAAAAATTAGCCAGGAATGGTGG + Intronic
1165500552 19:36185844-36185866 CAAAAATTACCCAGGCATGGTGG - Intronic
1165535059 19:36437155-36437177 CAAACATTAGCCAGGCATGGTGG - Intergenic
1165590146 19:36961954-36961976 AAAACATTACCCAGGCATGGTGG - Intronic
1166009529 19:39931921-39931943 CAAAAATTAGCCAGGAATGGTGG + Intronic
1166190106 19:41171034-41171056 CAAAAATTATCCAGGCATGCTGG + Intergenic
1166461825 19:42994509-42994531 CAAAAATTACCCAGGCATGGTGG + Intronic
1166479105 19:43154471-43154493 CAAAAATTACCCAGGCATGGTGG + Intronic
1166521236 19:43481639-43481661 CAAACATTAGCCAGGCATGGTGG + Intronic
1166710440 19:44933621-44933643 CAAACATTAGCCAGGCATGGTGG + Intergenic
1166930849 19:46300506-46300528 CAAAAATTACCCAGGCATGGTGG + Intronic
1166977764 19:46614722-46614744 CAAAAATTAGCCAGGTAAGCTGG + Intergenic
1167070157 19:47217034-47217056 CAAAAATTACCCAGGAGTGGTGG - Intergenic
1167330493 19:48852778-48852800 CAAAAATTAGCCAGGAATGGTGG + Intronic
1167337187 19:48894183-48894205 CAAAAATTAGCCAGGCAAGGGGG - Intronic
1167519841 19:49947734-49947756 CAAAAATTAGCCAGGCATGCTGG + Intronic
1167604095 19:50471115-50471137 CAAACATTAGCCAGGGATGGTGG - Intronic
1167608750 19:50496041-50496063 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1167632580 19:50634734-50634756 CAAAAATTAGCCAGGCATGCTGG - Intronic
1167687656 19:50966646-50966668 CAAAAATTAGCCAGGCAAGGTGG + Intronic
1167749240 19:51369911-51369933 CAAAAATTAGCCAGGCTAGCCGG + Intergenic
1167827143 19:51984022-51984044 CAAAAATTAGCCAGGCAAGGTGG + Intronic
1167910312 19:52696621-52696643 CAAACATTAGCCAGGCATGGAGG + Intergenic
1167911130 19:52702474-52702496 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1167925272 19:52816366-52816388 AAAAAATTAGCCAGGCAAGCCGG + Intronic
1168225155 19:54989317-54989339 CAAAAATTAGCCAGGCAAGATGG + Intronic
1168360788 19:55738173-55738195 CAAACATTACCCAGGAAAGCAGG - Exonic
1168477938 19:56691318-56691340 CAAAAATTACCCAGGCATGGTGG - Intergenic
1168560805 19:57381515-57381537 CAAAAATTAGCCAGGCAAGGTGG - Intronic
1168648384 19:58076536-58076558 CAAAAATTACCCAGGCATGGTGG + Intronic
925001376 2:405463-405485 CAAAAATTAGCCAGAAAAGCTGG - Intergenic
925221169 2:2142837-2142859 CAAACATTAGCCAGGCATGGTGG - Intronic
925229237 2:2217528-2217550 CAAAAATTAGCCAGGCATGCTGG + Intronic
925684129 2:6453601-6453623 CAAAAATTACCCAGGTATGGTGG + Intergenic
925858036 2:8149462-8149484 CAAAAATTAACCAGGTATGCTGG + Intergenic
926046101 2:9710796-9710818 CAAAAATTATCCAGGCATGCTGG - Intergenic
926125449 2:10269142-10269164 CAAAAATTACCCAGGCATGGTGG - Intergenic
926240552 2:11081401-11081423 CAAAAATTACCCAGGCATGGTGG - Intergenic
926387665 2:12353171-12353193 CAATCATAACCTAGGAAAGTGGG - Intergenic
926832564 2:16979447-16979469 CAAAAATTAGCCAGGAATGGTGG + Intergenic
926841787 2:17089197-17089219 CACACTTGAGCCAGGAAAGCAGG + Intergenic
927147375 2:20175163-20175185 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
927365556 2:22291739-22291761 CAAAAATTACCCAGGCAAGGTGG + Intergenic
927464528 2:23327122-23327144 CAAAAATTAGCCAGGCATGCTGG + Intergenic
927560787 2:24071450-24071472 CAAAAATTAGCCAGGCATGCTGG + Intronic
927603419 2:24464291-24464313 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
927662997 2:25008667-25008689 CTAAAATTACCCAGGCAAGGTGG - Intergenic
927716706 2:25357899-25357921 CAAACATTAGCCAGGTATGATGG + Intergenic
927774732 2:25893772-25893794 CAAACATTAGCCAGGCATGGTGG + Intergenic
927959217 2:27230083-27230105 CAAAAATTACCCAGGCATGGTGG + Intronic
927989820 2:27440162-27440184 CAAAAATTACCCAGGCATGGTGG - Intronic
928423467 2:31158364-31158386 CAGACCATACCCAGCAAAGCAGG + Intergenic
928541499 2:32288655-32288677 CAAAAATTAGCCAGGCATGCTGG + Intronic
928544973 2:32321280-32321302 CAAACATTAGCCAGGTATGGTGG + Intergenic
928668392 2:33575162-33575184 CAAACATTAGCCAGGCATGGTGG + Intergenic
929152486 2:38759767-38759789 CAAATATTAGCCAGGCATGCTGG + Intronic
929329310 2:40660685-40660707 CAAACATTAGCCAGGCATGGTGG + Intergenic
929592537 2:43156591-43156613 CAAACATTAGCCAGGCATGATGG - Intergenic
929621530 2:43359525-43359547 CAAAAATTAGCCAGGCATGCTGG + Intronic
929649066 2:43659709-43659731 CAAAAATTACCCAGGCATGATGG - Intronic
929654282 2:43715121-43715143 CAAAAATTAACCAGGCATGCTGG + Intronic
929660854 2:43782827-43782849 CAAAAATTACCCAGGCATGGTGG + Intronic
930073346 2:47387210-47387232 CAAAAATTAGCCAGGAATGGTGG - Intronic
930086437 2:47500936-47500958 CAAAAATTAGCCAGGCAAGGAGG - Intronic
930356509 2:50327800-50327822 CAAAAATTAGCCAGGCAAGGTGG - Intronic
930372724 2:50524324-50524346 CAAAAATTAGCCAGGCATGCTGG + Intronic
930743995 2:54862184-54862206 CAAAAATTAGCCAGGCAAGGTGG + Intronic
930798442 2:55418783-55418805 AAAACGTTACCTAGGAAAGAAGG + Intronic
930841160 2:55847101-55847123 CAAACATTAGCCAGGGATGGTGG + Intergenic
931338799 2:61378018-61378040 CAAAAATTAGCCAGGCATGCTGG + Intronic
931348277 2:61466757-61466779 CAAAAATTAGCCAGGCAAGGAGG + Intronic
931519005 2:63074636-63074658 CAAAAATTACCCAGGCATGGTGG - Intergenic
931619599 2:64196466-64196488 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
931930613 2:67129425-67129447 AAAACAGTTCCCAGGAAACCAGG + Intergenic
931999228 2:67868783-67868805 CAAAAATTACCCAGGCATGGTGG - Intergenic
932030008 2:68173733-68173755 CAAAAATTAGCCAGGCAAGGTGG - Intronic
932155598 2:69413892-69413914 CAAAAATTACCCAGGCATGGTGG + Intronic
932560029 2:72859380-72859402 CAAAAATTAGCCAGGCATGCTGG + Intergenic
932652898 2:73579210-73579232 CAAAAATTACCCAGGCATGGTGG - Intronic
932911421 2:75809961-75809983 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
933516396 2:83309194-83309216 CCTATATTACCCAGGAAAGTGGG - Intergenic
933625113 2:84589557-84589579 CAAAAATTACCCAGGCATGGTGG + Intronic
933936948 2:87213697-87213719 CAAACATTAGCCAGGCATGGTGG + Intergenic
934119506 2:88826326-88826348 CAAACATTACCCAGACATGGTGG + Intergenic
934174878 2:89569973-89569995 CAAAAATTACCCAGGCATGGTGG - Intergenic
934285195 2:91644325-91644347 CAAAAATTACCCAGGCATGGTGG - Intergenic
934500340 2:94856372-94856394 CAAAAATTAGCCAGGCATGCTGG + Intergenic
934732965 2:96670952-96670974 CAAAAATTACCCAGGCATGGTGG + Intergenic
934749803 2:96786262-96786284 CAAAAATTAGCCAGGAATGGTGG + Intronic
934971115 2:98765197-98765219 CAAAAATTAGCCAGGCAAGATGG + Intergenic
935027277 2:99289305-99289327 CAAACATTAGCCAGGCATGGTGG + Intronic
935061830 2:99615354-99615376 CAAACAGTGCCCAGGACAGGCGG - Intronic
935115656 2:100133778-100133800 CAAAAATTACCCAGGCATGGTGG + Intronic
935125655 2:100220281-100220303 CAAACATTAGCCAGGCATGGTGG - Intergenic
935155147 2:100478112-100478134 CAAACATTAGCCAGGCATGGTGG - Intronic
935740319 2:106141608-106141630 CAAAAATTACCCAGGCATGGTGG - Intronic
935751356 2:106236992-106237014 CAAAAATTACCCAGGCATGGTGG + Intergenic
935996863 2:108783460-108783482 CAAACTATACTCAGGAAAGCTGG + Intronic
936356195 2:111752127-111752149 CAAACATTAGCCAGGCATGGTGG - Intergenic
936409785 2:112247420-112247442 CAAAAATTAGCCAGGCAAGGTGG + Intronic
936595332 2:113841856-113841878 CAAAAATTAGCCAGGAATGGTGG - Intergenic
936841781 2:116778461-116778483 CAAAAATTAGCCAGGAATGATGG + Intergenic
937186861 2:120051977-120051999 CAAACATTAGCCAGGCACGGTGG - Intronic
937198499 2:120181133-120181155 CAAAAATTAGCCAGGCATGCTGG + Intergenic
937406839 2:121637731-121637753 CAAAAATTAGCCAGGAATGGTGG + Intronic
937492648 2:122386171-122386193 CAAAAATTAGCCAGGTAAGGTGG - Intergenic
937887556 2:126910259-126910281 CAAAAATTAGCCAGGCAAGCTGG - Intergenic
937998354 2:127712242-127712264 CAAAAATTAGCCAGGCAAGGTGG + Intronic
938095808 2:128462437-128462459 CAAACATTAGCCAGGCATGGTGG + Intergenic
938373620 2:130789867-130789889 CAAAAATTACCCAGGCATGGTGG - Intergenic
938598983 2:132818098-132818120 CAAAAATTAGCCAGGCATGCTGG - Intronic
938811724 2:134860108-134860130 CAAAAATTAGCCAGGCATGCTGG + Intronic
938871876 2:135486664-135486686 CAAAAATTAGCCAGGCATGCTGG - Intronic
938947337 2:136225130-136225152 CAAAAATTAGCCAGGAATGGTGG - Intergenic
939161435 2:138595130-138595152 CAAAAATTAACCAGGCAAGGTGG - Intergenic
939452387 2:142390950-142390972 CAAACATTAGCCAGGCATGGTGG - Intergenic
939497554 2:142942022-142942044 CAAAAATTACCCAGGCATGGTGG + Intronic
939931882 2:148245376-148245398 AAAACATTAGCCAGGAATGGTGG - Intronic
939939590 2:148333703-148333725 CAAAAATTAGCCAGGTAAGGTGG + Intronic
940061645 2:149577527-149577549 CAAAAATTAGCCAGGAATGGTGG + Intronic
940459224 2:153941146-153941168 CAAAAATTAGCCAGGCAAGGTGG - Intronic
940920738 2:159303521-159303543 CAAAAATTACCCAGGCATGGTGG - Intergenic
940982421 2:160018477-160018499 CAAAAATTAGCCAGGCATGCTGG + Intronic
941194198 2:162426059-162426081 CAAACATTAGCCAGGTATGGTGG + Intronic
941289814 2:163661547-163661569 CAAAAATTAGCCAGGCAAGGTGG - Intronic
941314949 2:163980860-163980882 CAAAAATTAGCCAGGAATGGTGG - Intergenic
941642359 2:168002443-168002465 CCAACATTTCCCTGGAGAGCTGG + Intronic
941755845 2:169184911-169184933 AAAAAATTAGCCAGGAAAGGTGG - Intronic
941797300 2:169613771-169613793 CAAAAATTAGCCAGGCATGCTGG + Intronic
941943989 2:171074473-171074495 CAAAAACTAACCAGGCAAGCTGG + Intronic
942011555 2:171767777-171767799 CAAGCATTAGCCAGGAGAGGTGG - Intergenic
942037958 2:172029632-172029654 CAAATATTTTCCAGAAAAGCAGG + Intronic
942039867 2:172049135-172049157 CAAACATTAGCCAGGCATGGTGG - Intronic
942164603 2:173229982-173230004 CAAAAATTAGCCAGGCATGCTGG - Intronic
942244034 2:173990877-173990899 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
942469961 2:176250150-176250172 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
942676057 2:178427946-178427968 CAAACATTAGCCGGGCAAGGTGG - Intergenic
943003469 2:182359832-182359854 CAAACATTAGCCGGCAAAGAAGG + Intronic
943051932 2:182923423-182923445 CAAAAATTACCCAGGTATGATGG - Intronic
943235221 2:185309197-185309219 CAAAAATTAGCCAGGAATGGTGG - Intergenic
943377120 2:187091389-187091411 CAAGCACTACCCAGGAGAGAAGG + Intergenic
943663193 2:190580755-190580777 CTGACATTACCCAGGATAACAGG + Intergenic
943714657 2:191137188-191137210 CAAACATTAGCCAGGCATGGTGG + Intronic
943723540 2:191229943-191229965 CAAACATTAGCCAGGCATGGTGG - Intergenic
943864246 2:192908338-192908360 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
943904939 2:193487084-193487106 CAAAAATTACCCAGGTATGATGG - Intergenic
943907100 2:193513762-193513784 CAAAAATTAGCCAGGCATGCTGG + Intergenic
944087166 2:195862881-195862903 CAAAAATTAGCCAGGAATGGTGG + Intronic
944187086 2:196960899-196960921 CAAACATTAGCCAGGCATGGTGG + Intergenic
944214892 2:197245105-197245127 CAAAAATTAGCCAGGAATGGTGG + Intronic
944652477 2:201844994-201845016 CAAAAATTAGCCAGGCATGCTGG + Intronic
944673762 2:202017828-202017850 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
945099208 2:206248981-206249003 CAAACATTAGCCAGGCATGATGG - Intergenic
945602467 2:211885320-211885342 AAAGCTTTACCCAGAAAAGCTGG + Intronic
945707206 2:213250045-213250067 AAACCATTACTCAGGAATGCTGG - Intergenic
945852093 2:215021000-215021022 AAAACATTAGCCAGGAATGCAGG - Intronic
945904355 2:215574611-215574633 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
946590926 2:221246377-221246399 CAAAGATTACCCAGGCATGGTGG - Intergenic
946626267 2:221614911-221614933 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
946671910 2:222114114-222114136 CAAAAATTACCCAGGCATGATGG - Intergenic
947147124 2:227078393-227078415 CAAAAATTAGCCAGGTGAGCTGG - Intronic
947204241 2:227645761-227645783 CAAAAATTAGCCAGGCATGCTGG - Intergenic
947588089 2:231369443-231369465 CAAAAATTACCCAGGCATGGTGG - Intronic
948016106 2:234692114-234692136 CAAAAATTAGCCAGGAATGGTGG + Intergenic
948071729 2:235133300-235133322 CAAACATTAGCCAGGTATGGTGG + Intergenic
948088393 2:235269548-235269570 CAAAAATTAGCCAGGTACGCTGG - Intergenic
948216283 2:236235844-236235866 CAAAAATTACCCAGGCATGTTGG - Intronic
948400425 2:237680826-237680848 CAAAAATTAGCCAGGCAAGGTGG + Intronic
948603595 2:239121116-239121138 CAAAAATTAGCCAGGCAAGGTGG - Intronic
1168742258 20:201779-201801 CAAAAATTATCCAGGAATGATGG + Intergenic
1168762376 20:357884-357906 CAAAAATTACCCAGGCATGGTGG + Intronic
1169276674 20:4237814-4237836 CAAAAATTAGCCAGGAATGGTGG - Intronic
1169317616 20:4606303-4606325 GAAACATTAGCCAGGCAAGGTGG - Intergenic
1169427427 20:5507485-5507507 CAAAAATTAACCAGGAATGGTGG + Intergenic
1169732149 20:8798042-8798064 CAAACATTAGTCAGGCATGCTGG + Intronic
1169820690 20:9706629-9706651 CAAAAATTAGCCAGGAATGGTGG - Intronic
1170364184 20:15581967-15581989 CAAAAATTACCCAGGCATGATGG + Intronic
1170643438 20:18176147-18176169 CAAAAATTAGCCAGGCATGCTGG + Intronic
1170754365 20:19186181-19186203 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1171003335 20:21437311-21437333 CCAACATTTTCCAGAAAAGCGGG - Intergenic
1171468672 20:25352142-25352164 CAAAAATTAGCCAGGAATGGTGG - Intronic
1171891561 20:30723062-30723084 CAAAAATTAGCCAGGCACGCTGG + Intronic
1171972926 20:31575584-31575606 CAAAAATTAGCCAGGAATGGTGG + Intronic
1172145630 20:32755946-32755968 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1172260375 20:33559324-33559346 CAAAAATTAGCCAGGCATGCTGG - Intronic
1172370921 20:34390600-34390622 CAAACATTAGCCAGGTATGGTGG - Intronic
1172405260 20:34683787-34683809 AAAACATTAGCCAGGAATGGTGG + Intergenic
1172473457 20:35218849-35218871 AAAAAATTACCCAGGAATGGTGG - Intergenic
1172511756 20:35505498-35505520 CAAAAATTAGCCAGGTATGCTGG + Intronic
1172685059 20:36747163-36747185 CAAAAATTACCCAGGCATGGTGG - Intergenic
1173296153 20:41760082-41760104 CAAAAATTACCCAGGCATGGTGG - Intergenic
1173377828 20:42505452-42505474 CAAAAATTACCCAGGCATGGTGG - Intronic
1173590370 20:44220357-44220379 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1173611526 20:44371670-44371692 CAAAAATTAGCCAGGCATGCTGG + Intronic
1173625951 20:44473221-44473243 CAAACATTAACCAGGCATGGTGG - Intergenic
1174300051 20:49575167-49575189 CAAAAATTAGCCAGGAATGCTGG + Intergenic
1174431779 20:50475317-50475339 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1174527435 20:51184890-51184912 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1174590318 20:51639931-51639953 CAAAAATTACCCAGGCATGGTGG + Intronic
1174675856 20:52354880-52354902 CAAAAATTACCCAGGCATGGTGG - Intergenic
1174776993 20:53352619-53352641 CAAAAATTAACCAGGCAAGGTGG + Intronic
1174786928 20:53441732-53441754 CAAAAATTAGCCAGGCAAGGTGG - Intronic
1174799635 20:53552537-53552559 CAAAAATTACCCAGGCATGGTGG + Intergenic
1174824649 20:53758448-53758470 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1175071059 20:56334299-56334321 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1175097046 20:56549452-56549474 CAAAAATTACCCAGGCATGGTGG + Intergenic
1175131117 20:56790377-56790399 CAAACATTAGCCAGGCATGGTGG + Intergenic
1175238465 20:57528688-57528710 CAAATATTATCCAAGAACGCGGG - Intergenic
1175397655 20:58677961-58677983 CAAACATTGCTTAGGAAAGAGGG + Exonic
1175433341 20:58923503-58923525 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1175436664 20:58956871-58956893 AAAACATTACCCAGGCATGGTGG - Intergenic
1175502178 20:59458388-59458410 CAAACATTAGCCAGGCATGGTGG - Intergenic
1175633333 20:60560186-60560208 CAAAAATTACCCGGGCATGCTGG + Intergenic
1175887624 20:62301793-62301815 CAAAAATTAGCCAGGTATGCTGG - Intergenic
1176174861 20:63716180-63716202 CAAAAATTAGCCAGGTATGCTGG - Intronic
1176190515 20:63807495-63807517 CAAAAATTAGCCAGGTATGCTGG - Intronic
1176274901 20:64259539-64259561 CAAAAATTAGCCAGGCATGCTGG - Intronic
1176345158 21:5737189-5737211 TAAAAATTACCCAGGCAAGGTGG - Intergenic
1176351972 21:5857773-5857795 TAAAAATTACCCAGGCAAGGTGG - Intergenic
1176444276 21:6805381-6805403 CAAAAATTAGCCAGGAATGATGG + Intergenic
1176499669 21:7587266-7587288 TAAAAATTACCCAGGCAAGGTGG + Intergenic
1176539479 21:8135259-8135281 TAAAAATTACCCAGGCAAGGTGG - Intergenic
1176558430 21:8318304-8318326 TAAAAATTACCCAGGCAAGGTGG - Intergenic
1176625631 21:9088995-9089017 CAAAAATTAGCCAGGCACGCTGG - Intergenic
1177027205 21:15934280-15934302 CAAAAATTACCCAGGCATGGTGG + Intergenic
1177051748 21:16244289-16244311 CAAAAATTACCCAGGCATGGTGG + Intergenic
1177394520 21:20515133-20515155 CAAAAATTAACCAGGCAAGGTGG - Intergenic
1178157466 21:29871914-29871936 CAAAAATTAGCCAGGCATGCTGG - Intronic
1178280398 21:31277490-31277512 CAAAAATTACCCAGGCATGATGG + Intronic
1178285900 21:31325129-31325151 CAAAAATTAGCCAGGAATGGTGG + Intronic
1178294185 21:31395083-31395105 CAAACATTAGCCAGGCATGGTGG + Intronic
1178299742 21:31442383-31442405 CAAAAATTACCCAGGCATGGTGG - Intronic
1178332664 21:31712679-31712701 CAAACATTAGCCAGGCATGGTGG - Intronic
1178445474 21:32637559-32637581 CAAAAATTACCCAGGCATGGTGG - Intronic
1178539283 21:33435728-33435750 CAAAAATTACCCAGGCATGGTGG + Intronic
1178562047 21:33647646-33647668 CAAACATTAGCCAGGCATGGTGG - Intronic
1178795608 21:35741626-35741648 CAAAAATTACCCAGGCATGGTGG + Intronic
1178969564 21:37160342-37160364 CAAATATTGCCCAGCTAAGCAGG + Intronic
1179179382 21:39032214-39032236 CAAACATTAGCCAGGCATGGGGG + Intergenic
1179773038 21:43638303-43638325 CAAAAATTACCCAGGCATGGTGG + Intronic
1179899511 21:44381752-44381774 CAAACATTATCCAGGCATGGTGG + Intronic
1180243972 21:46534011-46534033 CAATCACTAGCCAGGAGAGCGGG - Exonic
1180287856 22:10767008-10767030 CAAAAATTACCCAGGCACGGTGG + Intergenic
1180351709 22:11810984-11811006 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1180386492 22:12181088-12181110 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1180634748 22:17255281-17255303 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1181113672 22:20617588-20617610 AAAACATTAGCCAGGCATGCAGG - Intergenic
1181591520 22:23888342-23888364 CAAAAATTAGCCAGGCTAGCCGG - Intronic
1181642806 22:24213369-24213391 CAAACATTAGCCAGGCATGGTGG - Intergenic
1181975882 22:26729361-26729383 CAAAAATTACCCAGGCATGGTGG - Intergenic
1182222491 22:28770132-28770154 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1182252858 22:29015515-29015537 CAAAAATTACCCAGGCATGGTGG + Intronic
1182561561 22:31163824-31163846 CAAAAATTAGCCAGGCAAGGTGG - Intronic
1182587624 22:31354147-31354169 CAAAAATTAGCCAGGTAAGGTGG + Intergenic
1182656510 22:31894690-31894712 CAAAAATTACCCAGGCATGGTGG + Intronic
1183023724 22:35048184-35048206 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
1183126872 22:35790853-35790875 CAAAAATTAGCCAGGAATGATGG + Intronic
1183210481 22:36448312-36448334 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
1183384482 22:37507124-37507146 CAAAAATTAGCCAGGAATGGTGG + Intronic
1183449729 22:37886414-37886436 CAAAAATTAGCCAGGCAAGATGG + Intronic
1183476269 22:38037743-38037765 CAAAAATTAGCCAGGAATGGTGG - Intronic
1183681811 22:39335410-39335432 CAAAAATTAGCCAGGAATGGCGG - Intergenic
1183783779 22:40017383-40017405 CAAACATTAGCCAGGCATGATGG - Intronic
1184011645 22:41753168-41753190 CAAAAATTAGCCAGGAATGGTGG - Intronic
1184017498 22:41797148-41797170 CAAAAATTAGCCAGGCATGCTGG - Intronic
1184125685 22:42485173-42485195 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1184371564 22:44085455-44085477 CAAAAATTAGCCAGGAATGGTGG - Intronic
1184494139 22:44827493-44827515 CAAACATTAGCCAGGCATGGCGG - Intronic
1184588851 22:45467361-45467383 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1184779726 22:46641223-46641245 CAAAAATTACCCAGGCATGGAGG - Intronic
1184936478 22:47727319-47727341 CAAACATTAGCCAGGCATGGTGG - Intergenic
949554105 3:5137589-5137611 CAAAAATTACCCAGGCATGGTGG - Intronic
949597396 3:5562446-5562468 CAAACATTACAGTGGAAAACTGG - Intergenic
949900436 3:8810383-8810405 CAAAAATTAGCCAGGAATGGTGG + Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
949998726 3:9640071-9640093 CAAAAATTACCCAGGGATGGTGG - Intergenic
950002129 3:9665127-9665149 CAAAAATTAGCCAGGCAAGGTGG + Intronic
950050307 3:9983517-9983539 CAAAAATTAGCCAGGCATGCTGG + Intronic
950243903 3:11397607-11397629 CAAAAATTAGCCAGGCAAGATGG - Intronic
950246036 3:11419399-11419421 CAAAAATTAGCCAGGAATGGTGG + Intronic
950385843 3:12659273-12659295 CAAAAATTAGCCAGGCAAGGTGG + Intronic
950411118 3:12838252-12838274 CAAAAATTAGCCAGGAATGGTGG + Intronic
950986001 3:17367425-17367447 AAAAAATTACCTTGGAAAGCTGG + Intronic
951482646 3:23178298-23178320 CAAAAATTAGCCAGGCATGCTGG - Intergenic
951726190 3:25762970-25762992 CAAAAATTAGCCAGGAGAGATGG + Intronic
951852809 3:27161850-27161872 CAAAAATTAGCCAGGAATGGTGG + Intronic
952147946 3:30553957-30553979 CAAAAATTACCCAGGCATGGTGG + Intergenic
952297770 3:32076213-32076235 CAAAAATTAGCCAGGCAAGGTGG + Intronic
952367572 3:32688442-32688464 CAAAAATTAGCCAGGCATGCTGG + Intronic
952450652 3:33429480-33429502 CAAACATTAGCCAGGCATGGTGG - Intronic
952486031 3:33811036-33811058 CAAACATTAGCCAGGCATGGTGG - Intronic
952562527 3:34611765-34611787 CAAAAATTAGCCAGGCATGCTGG + Intergenic
952783301 3:37126180-37126202 CAAAAATTAGCCAGGCACGCTGG - Intronic
952791005 3:37200773-37200795 CAAAAATTAGCCAGGAATGGTGG - Intergenic
953052482 3:39358217-39358239 CAAAAATTACCCAGGCATGGTGG + Intergenic
953153036 3:40342693-40342715 CAAAAATTAGCCAGGCATGCTGG - Intergenic
953183623 3:40618785-40618807 CAGCCAATACCCAGGAAAGAAGG + Intergenic
953365765 3:42343272-42343294 CAAACATTAGCCAGGCATGGTGG + Intergenic
953552654 3:43916055-43916077 CAAAAATTAGCCAGGCATGCTGG - Intergenic
953594795 3:44300279-44300301 CAAAAATTACCCAGGCATGGTGG + Intronic
953743959 3:45558981-45559003 CAAACATTAGCCAGGCATGGTGG + Intronic
953747465 3:45586080-45586102 CAAATATTAACCAGGAATGGTGG - Intronic
953935268 3:47036400-47036422 CAAACATTAGCCAGGCATGGTGG + Intronic
953948711 3:47171032-47171054 CAAAAATTACCCGGGCATGCTGG + Intergenic
953952755 3:47204432-47204454 CAAAAATTACCCAGGCATGGTGG - Intergenic
953975072 3:47376296-47376318 CAAACATTAGCCAGGCATGGTGG - Intergenic
954186596 3:48921584-48921606 CAAAAATTAGCCAGGAATGGTGG - Intronic
954246172 3:49333310-49333332 CAAAAATGAGCCAGGAATGCTGG + Intronic
954308220 3:49743073-49743095 CAAAAATTAGCCAGGAATGGTGG + Intronic
954623342 3:52008166-52008188 CAAAAATTAGCCAGGTATGCTGG - Intergenic
954858340 3:53666002-53666024 GACACATTACACAGGAAATCGGG - Intronic
955174346 3:56598308-56598330 CAAAAATTACCCAGGCATGGTGG - Intronic
955284081 3:57622021-57622043 CAAAAATTAGCCAGGCATGCTGG + Intergenic
955350681 3:58190949-58190971 AAAACATTAGCCAGGCATGCTGG - Intergenic
955928372 3:64030504-64030526 CAAAAACTACCCAAAAAAGCCGG - Intergenic
955994017 3:64659313-64659335 CAAAAATTAGCCAGGCATGCTGG + Intronic
956154923 3:66285610-66285632 CAAAAATTAGCCAGGAGTGCTGG - Intronic
956421820 3:69093796-69093818 TAAAAATTAGCCAGGCAAGCTGG + Intronic
956440712 3:69278006-69278028 CAAAAATTAGCCAGGCAAGGTGG - Intronic
956444511 3:69312744-69312766 CAAAAATTACCCCGGCAAGGTGG + Intronic
956627226 3:71278626-71278648 CAAACATTAGCCAGGTATGGTGG + Intronic
956821203 3:72955923-72955945 CAAAAATTAGCCAGGAATGATGG + Intronic
956822464 3:72966129-72966151 CAAACATTAGCCAGGCATGGAGG - Intronic
957299061 3:78367378-78367400 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
958012233 3:87894407-87894429 CAAAAATTACCCAGGCATGGTGG - Intergenic
958194974 3:90232615-90232637 CAAACATTAGCCAGGCATGGTGG + Intergenic
958418329 3:93903515-93903537 CAAACATTAGCCAGGCATGGTGG + Intronic
958539378 3:95450430-95450452 CAAAAATTAGCCAGGAATGGTGG + Intergenic
959090547 3:101898067-101898089 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
959286255 3:104415042-104415064 CAAAAATTAGCCAGGCATGCTGG - Intergenic
959589775 3:108065656-108065678 CAAAAATTACCCAGGCATGGTGG + Intronic
959627188 3:108465772-108465794 CAAAAATTAGCCAGGAATGGTGG + Intronic
959661055 3:108868679-108868701 CAAAAATTAGCCAGGCAGGCCGG + Intergenic
959702467 3:109310952-109310974 CAAACATTATCCAGGCATGGTGG - Intronic
960000931 3:112731138-112731160 CAAAAATTAGCCAGGCATGCTGG + Intergenic
960127968 3:114021511-114021533 CAAACATTATCCAGGTATACAGG + Intronic
960296332 3:115949104-115949126 CAAAAATTACCCAGGCATGGTGG + Intronic
960833796 3:121882194-121882216 CAAAAATTAGCCAGGCATGCTGG + Intronic
960839278 3:121939956-121939978 CAAAAATTAGCCAGGAATGGTGG - Intronic
960850894 3:122052719-122052741 CAAAAATTAGCCAGGCATGCTGG - Intergenic
961147278 3:124605008-124605030 CAAAAATTAGCCAGGCATGCTGG + Intronic
962258763 3:133889585-133889607 CAAACATTAGCCAGGCATGGTGG - Intronic
962711644 3:138091463-138091485 CAAAAATTAGCCAGGAACGGTGG + Intronic
962935439 3:140076375-140076397 CAAAAATAACCCAGGAAGTCTGG - Intronic
963181507 3:142362119-142362141 CAAAAATTAGCCAGGAATGGTGG - Intronic
963808728 3:149753332-149753354 CAAACATTAGCCAGGCATGGTGG - Intergenic
963895079 3:150676963-150676985 CAAAAATTAGCCAGGTAAGGTGG - Intronic
964011715 3:151899631-151899653 CAAACATTAGCCAGGCATGGTGG - Intergenic
964014888 3:151932886-151932908 CAAACATTAGCCAGGCATGGTGG + Intergenic
964072720 3:152654237-152654259 CAAAAATTAGCCAGGAATGGTGG - Intergenic
964280498 3:155059100-155059122 AAAAAATTACCCAGGCATGCTGG + Intronic
964290646 3:155176671-155176693 AAAAAATTACCCAGGCATGCTGG + Intronic
965254602 3:166389628-166389650 CAAACATTAGCCAGGAGTGGTGG - Intergenic
965453605 3:168869759-168869781 CAAAAATTACCCAGGCATGGTGG + Intergenic
965497245 3:169413540-169413562 CAAACACTACCCTGCAAAGGGGG + Intronic
965588323 3:170339525-170339547 CAAACATTAGCCAGGCATGGTGG - Intergenic
965650846 3:170931381-170931403 CAAAAATTAGCCAGGAATGGTGG + Intergenic
965770769 3:172179212-172179234 CAAACATTAGCCAGGCATGGTGG - Intronic
965850336 3:173015214-173015236 CAAAAATTAGCCAGGCATGCTGG - Intronic
966144974 3:176800798-176800820 CAAAAATTAGCCAGGAATGGTGG + Intergenic
966195896 3:177313401-177313423 CAAAAATTAGCCAGGCAGGCAGG - Intergenic
966203471 3:177380878-177380900 CAAAAATTAGCCAGGTAAGGTGG - Intergenic
966210745 3:177450809-177450831 CAAAAATTAGCCAGGAATGGTGG + Intergenic
966341618 3:178931222-178931244 GAAACATTCCCCTGGAAAACTGG + Intergenic
966533434 3:181005178-181005200 CAAAAATTACCCAGGCATGGTGG + Intergenic
966667520 3:182488494-182488516 CAAAAATTAGCCAGGCATGCTGG + Intergenic
966794151 3:183698037-183698059 CAAACAATGCCCCGGAGAGCGGG - Intronic
966860165 3:184227239-184227261 AAAAAATTACCCAGGCATGCTGG + Intronic
966935239 3:184703396-184703418 AAAACATTACCCAGGCATGGTGG + Intergenic
967376765 3:188812706-188812728 CAAAAATTACCCAGGAATGAGGG - Intronic
967380980 3:188857664-188857686 CACAAAATTCCCAGGAAAGCAGG + Intronic
967588711 3:191246451-191246473 CAAAAATTACCCAGGCATGGTGG + Intronic
967709139 3:192685662-192685684 CAGAAATTTCCCAGGAAAACCGG + Intronic
967866758 3:194196399-194196421 CAAAAATTAGCCAGGAGAGGTGG + Intergenic
968073112 3:195800123-195800145 CAAAAATTACCCAGGCATGGTGG + Intronic
968110660 3:196044044-196044066 CAAAAATTAGCCAGGAATGGTGG + Intronic
968116038 3:196090593-196090615 CAAACATTAGCCAGGCATGGTGG + Intergenic
968160388 3:196422045-196422067 CAAAAATTATCCAGGCAAGGTGG + Intronic
968171629 3:196514892-196514914 CAAAAATTACCCAGGCATGGTGG - Intronic
968189329 3:196656016-196656038 CAAAAATTACCCAGGCATGGTGG + Intronic
968507934 4:980431-980453 CAAAAATTAGCCAGGAATGGTGG + Intronic
968847624 4:3054865-3054887 CAAACATTAGCCAGGCGTGCTGG - Intergenic
968854997 4:3113480-3113502 CAAACATTAGCCAGGCATGGTGG - Intronic
969273802 4:6121045-6121067 CAAAAATTAGCCAGGCAAGGTGG + Intronic
969482124 4:7452291-7452313 CAAAAATTACCCAGGCATGGTGG - Intronic
969758313 4:9164871-9164893 CAAAAATTACCCAGGCACGATGG - Intergenic
970152942 4:13108993-13109015 AAATCATTCCCCAGGAAATCTGG + Intergenic
970437840 4:16052631-16052653 CAAACATTAGCCAGGCATGTTGG - Intronic
970693129 4:18642883-18642905 CAAAAATTAGCCAGGCATGCTGG + Intergenic
970812597 4:20112786-20112808 CAAAAATTACCCAGGCATGGTGG + Intergenic
971020908 4:22534296-22534318 GTGACATTACCCAGGAAAGCTGG - Intergenic
971167619 4:24200356-24200378 CAAAAATTAGCCAGGAATGGTGG + Intergenic
971246827 4:24936956-24936978 CAAAAATTACCTCGGAAACCAGG - Intronic
971307210 4:25494009-25494031 CAAACATTAGCCAGGCATGGTGG - Intergenic
971651351 4:29279457-29279479 CAAAGAGTACCCGAGAAAGCCGG - Intergenic
971706585 4:30051107-30051129 CAAAAATTAGCCAGGAATGGTGG + Intergenic
971988956 4:33866167-33866189 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
972121032 4:35703064-35703086 CAAACATTTCACAGTAAAACAGG + Intergenic
972354033 4:38263886-38263908 CAAAAATTACCCAGGCATGGTGG - Intergenic
972482037 4:39506076-39506098 CAAAAATTAGCCAGGCAAGGTGG + Intronic
972547413 4:40093753-40093775 CAAAAATTAGCCAGGAGCGCTGG - Intronic
972554810 4:40171258-40171280 CAAAAACTAGCCAGGAAACCAGG + Intergenic
972581871 4:40402493-40402515 CAAAAATTACCCAGGCGTGCTGG - Intergenic
972786558 4:42331828-42331850 CAAAAATTAGCCAGGCATGCTGG + Intergenic
973131279 4:46651977-46651999 CAAAAATTAGCCAGGCAAGTTGG + Intergenic
973203312 4:47530606-47530628 CAAAAATTACCCAGGCATGGTGG - Intronic
973319749 4:48797955-48797977 CCAGCATTACCCTAGAAAGCTGG - Intergenic
973589909 4:52430590-52430612 CAAAAATTACCCAGGCATGGTGG + Intergenic
973657334 4:53062217-53062239 CAAAAATTAGCCAGGCAAGGTGG + Intronic
973848460 4:54937101-54937123 CAAAAATTAGCCAGGAATGGTGG + Intergenic
973889621 4:55356159-55356181 CAAAAATTAGCCAGGCATGCTGG - Intronic
974251802 4:59394491-59394513 CATACATTCCCCTGGAAAGGGGG - Intergenic
974862073 4:67534261-67534283 CAAAAATTAACCAGGAATGGTGG + Intronic
975167766 4:71197060-71197082 CAAAAATTACCCAGGCATGGTGG + Intronic
975371614 4:73595344-73595366 CAAAAATTACCCAGGCATGGTGG - Intronic
975397312 4:73891763-73891785 CAAACATTAGCCAGACAAGGTGG - Intergenic
975653666 4:76619907-76619929 CAAAAATTACCCAGGAGTGGTGG + Intronic
975655767 4:76639680-76639702 AAAACTTTACCCAGGAATACTGG - Intronic
975702496 4:77079754-77079776 CAAAAATTACCCAGGCACGGTGG - Intergenic
975772580 4:77743752-77743774 CAAAAATTAGCCAGGCAAGGTGG - Intronic
976423615 4:84874258-84874280 CAAAAATTACCCAGGCATGGTGG + Intronic
976436879 4:85028581-85028603 CAAAAATTAGCCAGGAATGGTGG - Intergenic
976656699 4:87496369-87496391 CAAAAATTACCCAGGCATGGTGG - Intronic
976818731 4:89180487-89180509 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
976973179 4:91133944-91133966 CAAAAATTAGCCAGGCAAGGTGG + Intronic
977650184 4:99460600-99460622 CAAAAATTACCCAGGCATGGTGG - Intergenic
978114765 4:105005889-105005911 CAAACATTAGCCAGGCATGGTGG - Intergenic
978222125 4:106289614-106289636 CAAAAATTACCCAGGCATGGTGG + Intronic
978387010 4:108186504-108186526 CAAACATTAGCCAGGCATGGTGG - Intergenic
978432022 4:108642747-108642769 CAAAAATTAGCCAGGTAAGGTGG + Intergenic
978504097 4:109437775-109437797 CAAAAATTACCCAGGAGTGGTGG - Intronic
979005096 4:115284372-115284394 GAAAAATTACCCAGGATAACAGG - Intergenic
979080889 4:116339763-116339785 CAAAAATTAGCCAGGCATGCTGG - Intergenic
979277734 4:118832048-118832070 CAAAAATTACCCAGGCATGGTGG + Intronic
979323381 4:119350674-119350696 CAAAAATTAGCCAGGCATGCTGG - Intergenic
979327986 4:119401223-119401245 CAAAAATTAGCCAGGAATGGTGG - Intergenic
979613964 4:122720296-122720318 CAAAAATTAGCCAGGCATGCTGG + Intergenic
979713563 4:123809754-123809776 CAAAAATTAGCCTGGAATGCTGG + Intergenic
979767909 4:124484249-124484271 CAAACATGACAGAGGAAACCTGG - Intergenic
979940493 4:126756601-126756623 CCAACAGTAACTAGGAAAGCTGG + Intergenic
979952301 4:126908123-126908145 CAAAAATTACCCAGGCGTGCTGG - Intergenic
979966646 4:127084545-127084567 CAAACATTAGCCAGGAGTGGTGG - Intergenic
980173455 4:129316806-129316828 CAAAAATTAGCCAGGCATGCTGG + Intergenic
980350353 4:131675910-131675932 CAAAAATTAGCCAGGCATGCTGG + Intergenic
981513744 4:145585238-145585260 CAAAAATTAGCCAGGAATGTTGG + Intergenic
981529516 4:145738295-145738317 CAAAAATTACCCAGGAGTGGTGG + Intronic
981692219 4:147522383-147522405 CAAAAATTAGCCAGGCATGCTGG + Intronic
981794396 4:148579767-148579789 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
982104454 4:151999410-151999432 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
982397828 4:154931090-154931112 CAATCATAACTCAGTAAAGCTGG - Intergenic
982539904 4:156655281-156655303 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
982714999 4:158797545-158797567 CAAACATTAGCCAGGTATGGTGG + Intronic
982742945 4:159076986-159077008 CAAAAATTACCCAGGCATGGTGG - Intergenic
982946552 4:161631462-161631484 CAAAAATTAGCCAGGAATGGTGG + Intronic
983071700 4:163275507-163275529 TAAACTTTACCCAGGTAATCTGG - Intergenic
983202723 4:164879595-164879617 CAAAAATTACCCAGGAGTGGTGG - Intronic
983241208 4:165235351-165235373 CAAAAATTAGCCAGGCATGCTGG - Intronic
983245808 4:165285557-165285579 CAAAAATTAGCCAGGAATGGTGG - Intronic
983456906 4:167976537-167976559 CAAAAATTAACCAGGAATGATGG + Intergenic
983567900 4:169174212-169174234 CAAAAATTAGCCAGGTATGCTGG - Intronic
983746066 4:171202070-171202092 CAAAAATTACCCAGGCATGGTGG - Intergenic
984163848 4:176285257-176285279 CTAATAGTTCCCAGGAAAGCTGG - Intergenic
984174087 4:176394994-176395016 CAAACATTAGCCAGGCATGGTGG - Intergenic
984370280 4:178855445-178855467 CAAAAATTAGCCAGGAGTGCTGG + Intergenic
984774023 4:183464768-183464790 CAAAAATTACCCAGGCATGGTGG + Intergenic
984822478 4:183893997-183894019 CAAAAATTAGCCAGGCACGCTGG + Intronic
984833548 4:183998692-183998714 CAAAAATTAGCCAGGCATGCTGG - Intronic
984849451 4:184141377-184141399 CCAACATGACTGAGGAAAGCAGG + Intronic
985204788 4:187523659-187523681 CAAAAATTACCCAGGCATGATGG + Intergenic
985498181 5:222798-222820 AAAACTTTACCCAAGAAAACTGG - Intronic
986323617 5:6654583-6654605 CAAAAATTAACCAGGTAAGATGG - Intronic
986431089 5:7681922-7681944 TAAACTTTACCCAGGAAAAAGGG - Intronic
986699030 5:10387453-10387475 CAAAAATTAGCCAGGCATGCTGG - Intronic
987039578 5:14049331-14049353 CAAACATTAGCCAGGCATGGTGG + Intergenic
987212885 5:15702083-15702105 CAAAAATTAGCCAGGAGTGCTGG + Intronic
987233553 5:15920102-15920124 CAAAAATTAGCCAGGTATGCTGG + Intronic
987555397 5:19440366-19440388 CAAACATTAGCCAGGCATGGTGG - Intergenic
987754159 5:22078631-22078653 CAAACAGAACCCAGAGAAGCAGG + Exonic
987825927 5:23030415-23030437 CAAACATTAGCCAGGCATGGTGG + Intergenic
988178741 5:27762465-27762487 CAAAAATTAGCCAGGTATGCTGG + Intergenic
988457546 5:31399997-31400019 CAAAAATTACCCAGGCATGGTGG - Intergenic
988488723 5:31689219-31689241 CAAACATTAGCCAGGCATGCTGG - Intronic
988513409 5:31884738-31884760 CAAAAATTAGCCAGGAATGGTGG - Intronic
988598159 5:32614483-32614505 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
988737450 5:34036797-34036819 CAAAAATTAGCCAGGCATGCTGG + Intronic
988776934 5:34485464-34485486 AAAACATTACCCAGGTATGGTGG - Intergenic
988928215 5:36010297-36010319 CAAAAATTACCCAGGCATGGTGG + Intergenic
989135410 5:38149537-38149559 CAAAAATTAGCCAGGAGTGCTGG + Intergenic
989206503 5:38814467-38814489 CAAAAATTAGCCAGGAATGCTGG + Intergenic
989405738 5:41058608-41058630 CAAAAATTAGCCAGGCATGCTGG - Intronic
989695510 5:44195859-44195881 CAAAAATTAGCCAGGCATGCTGG + Intergenic
989703198 5:44295557-44295579 CAAAAATTACCCAGGCATGGTGG + Intergenic
990005827 5:50943340-50943362 CAAACATTAGCCAGGCATGGTGG + Intergenic
990315853 5:54582637-54582659 AAAACATTAACCAGGCATGCTGG + Intergenic
990371720 5:55126344-55126366 CAAAAATTACCCAGGCATGGTGG + Intronic
990568350 5:57053015-57053037 TAAACGTTACGCAAGAAAGCAGG + Intergenic
991487420 5:67151918-67151940 AAAAAATTAGCCAGGAAAGGTGG - Intronic
991649641 5:68838751-68838773 CAAAAATTACCCAGGCATGGTGG + Intergenic
991995804 5:72385509-72385531 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
992284589 5:75220945-75220967 CAAAAATTACCCAGGCATGGTGG + Intronic
992412135 5:76516026-76516048 CAAACATTATCCAGGCATGGTGG - Intronic
992471874 5:77065733-77065755 CAAACATTAGCCAGGCATGTTGG - Intergenic
992593931 5:78326475-78326497 CAAAAATTAGCCAGGAGCGCTGG - Intergenic
992626304 5:78638515-78638537 CAAACAATACCATGGAATGCTGG + Intronic
993092569 5:83444234-83444256 CAAAAATTATCCAGGCATGCTGG + Intergenic
993123300 5:83801620-83801642 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
993169728 5:84402829-84402851 CAAAAATTACCCAGGCATGGTGG - Intergenic
993410381 5:87566819-87566841 AAAACAGGACCCAGGAAAACAGG - Intergenic
994084403 5:95742916-95742938 CAAAAATTAGCCAGGCATGCTGG + Intronic
994084548 5:95743859-95743881 CAAAAATTACCCAGGCATGGTGG - Intronic
994554961 5:101287704-101287726 CAAAAATTACCCAGGAGTGGTGG + Intergenic
994981903 5:106886015-106886037 CAAAAATTACCCAGGCATGGTGG + Intergenic
995408255 5:111826685-111826707 CAAAAATTAGCCAGGTATGCTGG - Intronic
995720962 5:115132378-115132400 CAAAAATTAGCCAGGCATGCTGG + Intronic
995972286 5:117986752-117986774 CAAAAATTACCCAGGTATGGTGG + Intergenic
996027568 5:118665316-118665338 CAAAAATTACCCAGGCATGGTGG + Intergenic
996098233 5:119421420-119421442 CAAAAATTAGCCAGGAATGGTGG - Intergenic
996443667 5:123519204-123519226 CAACAATTAGCCAGGAAAGGTGG - Intronic
996550122 5:124721783-124721805 CAAAAATTACCCAGGCGAGGTGG + Intronic
996733618 5:126738874-126738896 CAAAAATTAGCCAGGAATGGTGG - Intergenic
997317521 5:132949869-132949891 TAAAAATTAGCCAGGAAAGGTGG + Intronic
997525359 5:134549502-134549524 CAAAAATTAGCCAGGCAAGGTGG + Intronic
997680198 5:135744887-135744909 CAAAAATTAGCCAGGAGAGGTGG + Intergenic
997740697 5:136251208-136251230 CAAGCAATAACTAGGAAAGCAGG + Intronic
998030997 5:138867902-138867924 CAAAAATTAGCCAGGCAACCTGG - Intronic
998142323 5:139707106-139707128 CAAAAATTACCCAGGCATGGTGG + Intergenic
998665311 5:144290140-144290162 CAAAAATTATCCAGGCAAGGAGG + Intronic
998837507 5:146217117-146217139 CAAAAATTAGCCAGGCAAGGTGG - Intronic
999177111 5:149639418-149639440 CAAAAATTAGCCAGGAATGGCGG - Intergenic
999217799 5:149950177-149950199 CAAAAATTAGCCAGGCAAGATGG + Intergenic
999470106 5:151847564-151847586 CAAACATTAGCCAGGCATGACGG + Intronic
999560566 5:152797191-152797213 CAAACATTAGCCAGGAATGGTGG + Intergenic
999636200 5:153625217-153625239 GAAACATAGCCCAGGAATGCTGG + Intronic
999645048 5:153709531-153709553 CAAAGATAACCCAGTAAAGAGGG + Intronic
999680571 5:154055756-154055778 AAAAAATTAGCCAGGAAAGGTGG - Intronic
999741529 5:154558397-154558419 CAAAAATTACCCAGGTATGGTGG + Intergenic
999804372 5:155068160-155068182 CAAAAATTACCCAGGTATGGTGG - Intergenic
999819325 5:155209759-155209781 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1000079773 5:157833786-157833808 CAAAAATTATCCAGGCAAGGTGG + Intronic
1000222218 5:159224942-159224964 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1000351218 5:160354424-160354446 CAAAAATTAGCCAGGAATGGTGG + Intronic
1000617154 5:163439188-163439210 CAAAGATGGCCAAGGAAAGCAGG + Intronic
1000714439 5:164623228-164623250 CAAAAATTACCCAGGCATGGTGG + Intergenic
1000828022 5:166070318-166070340 CAAAAATTACCCAGGCATGGTGG - Intergenic
1001258334 5:170202811-170202833 AAAACATTAGCCAGGTATGCTGG - Intergenic
1001337003 5:170807099-170807121 AAAACATTACCCAGGCATGATGG - Intronic
1001492738 5:172167005-172167027 CAAAAATTAGCCAGGCAAGATGG + Intronic
1001509267 5:172307494-172307516 CAAACATTAGCCAGGTATGGTGG + Intergenic
1001613583 5:173023690-173023712 CAAAAATTAGCCAGGCAAGGTGG + Intronic
1002225410 5:177719031-177719053 CAAAAATTATCCAGGCAAGGTGG - Intronic
1002260202 5:177987949-177987971 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1002262232 5:178001772-178001794 CAAAAATTAGCCAGGATTGCTGG - Intergenic
1002277293 5:178112440-178112462 CAAACATTAGCCAGGCATGGTGG - Intergenic
1002628168 5:180547884-180547906 CAAAAATTAGCCAGGTATGCTGG - Intronic
1002667015 5:180832303-180832325 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1002717713 5:181238647-181238669 CAAAAATTACCCAGGAGTGATGG + Intronic
1002855812 6:1037255-1037277 CAAACATTAGCCAGGCATGGTGG + Intergenic
1003062082 6:2871705-2871727 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1003405647 6:5825015-5825037 CAAAAATTACCCAGGCATGGTGG - Intergenic
1003541796 6:7024610-7024632 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1003579409 6:7326052-7326074 GAAACATTAGCCAGGTATGCTGG - Intronic
1004110272 6:12711061-12711083 CAAACTTCGCTCAGGAAAGCAGG + Intergenic
1004468915 6:15910922-15910944 CAAACATTAGCCAGGCATGATGG - Intergenic
1004501320 6:16212786-16212808 CAAAAATTACCCAGGCATGGTGG + Intergenic
1004704750 6:18114077-18114099 CAAAAATTAGCCAGGCACGCTGG + Intergenic
1004780033 6:18898079-18898101 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1005013721 6:21358759-21358781 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1005176137 6:23046920-23046942 CAAACAGTTCTCATGAAAGCAGG + Intergenic
1005260829 6:24057449-24057471 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1005341414 6:24847102-24847124 CAAAAATTAGCCAGGAATGGAGG - Intronic
1005733180 6:28718592-28718614 CAAAAATTACCCAGGAGTGGTGG + Intergenic
1006258547 6:32850214-32850236 CAACCATTTCCCAGTAAAGGAGG + Intronic
1006322487 6:33328340-33328362 CAAAAATTAGCCGGGAAAGTTGG - Intronic
1006331822 6:33397136-33397158 CAAAAATTACCCAGGCATGGTGG - Intronic
1006549068 6:34805438-34805460 CAAACATTAGCCAGGCATGGTGG + Intronic
1007377404 6:41466315-41466337 CAAACATTAGCCAGGCATGGTGG + Intergenic
1007532786 6:42557638-42557660 CAAACATTAGCCAGGCATGGTGG - Intergenic
1007607635 6:43128143-43128165 CAAACAGCACCCTGGAAAGATGG - Intronic
1007799310 6:44378616-44378638 CAAAAATTAGCCAGGCAAGATGG + Exonic
1007897191 6:45375052-45375074 CAAAAATTAGCCAGGCATGCTGG + Intronic
1008012904 6:46488022-46488044 CAAACATCACACAGCAAATCAGG + Intronic
1008072336 6:47110304-47110326 CAAAAATTACCCAGGCATGGTGG + Intergenic
1008198405 6:48554591-48554613 CAAACATTAGCCAGGCATGGTGG + Intergenic
1008562726 6:52737867-52737889 CAAACATTACCCAGGCGTGATGG - Intergenic
1008696555 6:54045193-54045215 CAAAAATTACCCAGGCATGGTGG + Intronic
1008891174 6:56492715-56492737 CAAAAATTAGCCAGGCATGCTGG + Intronic
1008970144 6:57357746-57357768 CAAACATTAGCCAGGAGTGGTGG - Intronic
1009430226 6:63558022-63558044 CAAAAATTACCCAGGCATGGTGG - Intronic
1009520438 6:64675580-64675602 CAAACATTAGCCAGGTATGGGGG - Intronic
1009533936 6:64856451-64856473 CAAAAATTACCCAGGCATGGTGG - Intronic
1009588834 6:65639695-65639717 CAAAAATTGCCATGGAAAGCAGG + Intronic
1009849462 6:69177507-69177529 CAAACATTAGCCAGGCATGGTGG - Intronic
1009931302 6:70180033-70180055 CAAAAATTACCCAGGCATGGTGG - Intronic
1010215671 6:73399097-73399119 CAAAAATTAGCCAGGTGAGCTGG - Intronic
1010280961 6:74021925-74021947 CAAAAATTACCCAGGCATGGTGG - Intergenic
1010434285 6:75812169-75812191 TAAACATTAGCCAGGAATGATGG - Intronic
1010534036 6:77003584-77003606 CAAACATTAGCCAGGTATGGTGG + Intergenic
1010825354 6:80466643-80466665 CAACCATTCCCCAATAAAGCTGG + Intergenic
1010891841 6:81322704-81322726 CAAAAATTACCCAGGCATGGTGG - Intergenic
1010954893 6:82078890-82078912 CAAAAATTATCCAGGTATGCTGG - Intergenic
1010998084 6:82556443-82556465 CAAACAATATCCAGGGAAGAGGG + Intergenic
1011187884 6:84699169-84699191 CAAAAATTACCCAGGCATGATGG + Intronic
1011273036 6:85599497-85599519 CAAAAATTAGCCAGGCATGCTGG + Intronic
1011373145 6:86661836-86661858 AAAACATTCCCCATGAGAGCTGG - Intergenic
1011475489 6:87747117-87747139 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1011542141 6:88442092-88442114 CAAATATTAGACAGGGAAGCAGG + Intergenic
1011595332 6:89010539-89010561 CAAACATTACCCAGGCATGATGG + Intergenic
1011629999 6:89313762-89313784 CAAAAATTAGCCAGGCATGCTGG + Intronic
1011686983 6:89831347-89831369 CAAAAATTAGCCAGGCATGCTGG - Intronic
1011820828 6:91251982-91252004 CAAAAATTACCCAGGGATGGTGG - Intergenic
1012166020 6:95953149-95953171 CAAAAATTACCCAGGCATGGTGG + Intergenic
1012446072 6:99308142-99308164 CAAAAATTACCCAGGCATGGTGG + Intronic
1012873968 6:104703952-104703974 CAAAAATTACCCAGGCATGGTGG + Intergenic
1012889223 6:104879897-104879919 CAAAAATTACCCAGGCATGGTGG - Intergenic
1012952881 6:105537881-105537903 CAAAAATTAGCCAGGCAAGGGGG + Intergenic
1012966559 6:105680755-105680777 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1013081049 6:106813505-106813527 CAAACATTCCCCTTGAAAACTGG + Intergenic
1013096136 6:106946604-106946626 CAAAAATTACCCAGGCATGGTGG + Intergenic
1013125050 6:107175057-107175079 CAAAAATTAGCCAGGCATGCTGG + Intronic
1013150077 6:107437370-107437392 CAAAAATTAACCAGGCAAGGTGG + Intronic
1013317540 6:108956837-108956859 CAAACATTAGCCAGGCATGGTGG + Intronic
1013334301 6:109139782-109139804 CAAAAATTAGCCAGGCAGGCTGG - Intronic
1013604348 6:111733932-111733954 CAAACATTAGCCAGGCATGGTGG + Intronic
1013679393 6:112507195-112507217 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
1014029688 6:116686055-116686077 AAAACATTACCCAGGCATGGTGG - Intronic
1014282343 6:119455753-119455775 TAAAGATTACCCATGGAAGCAGG - Intergenic
1014309559 6:119783005-119783027 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1014440793 6:121471578-121471600 CAAAAATTATCCAGGCAAGGTGG + Intergenic
1014444699 6:121513827-121513849 CAAAAATTACCCAGGAGTGGTGG + Intergenic
1014451926 6:121591923-121591945 CAAAAATTACCCAGGCATGGTGG - Intergenic
1014552096 6:122800901-122800923 CAAAAATTACCCAGGCATGGTGG - Intronic
1014700779 6:124685004-124685026 CTAACCTTACCCAGGAAGTCAGG - Intronic
1014830690 6:126099592-126099614 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1015132732 6:129832248-129832270 CAAAAATTAGCCAGGCATGCTGG - Intronic
1015411666 6:132900385-132900407 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
1015510923 6:134037505-134037527 CAAAAATTACCCAGGTATGGTGG - Intronic
1015893881 6:137998126-137998148 CAAAAATTACCCAGGCATGGTGG + Intergenic
1016051869 6:139538131-139538153 CAAAAATTACCCAGGCATGGTGG + Intergenic
1016681028 6:146829523-146829545 CAAACATTAGCCAGGAGTGGTGG - Intergenic
1016754218 6:147666089-147666111 CAAACATTAGCCAGGCATGTTGG - Intronic
1016920032 6:149283555-149283577 CAAAAATTAGCCAGGCAAGGTGG + Intronic
1017070133 6:150568716-150568738 CAAACATTAGCCAGGCTTGCTGG + Intergenic
1017091799 6:150765338-150765360 CAAAAATTACCCAGGCATGATGG + Intronic
1017134636 6:151137131-151137153 CAAACATTAGCCAGGCATGGTGG + Intergenic
1017167132 6:151419215-151419237 CAAAAATTAGCCAGGAATGGTGG - Intronic
1017431638 6:154377032-154377054 CAAAAATTAGCCAGGAGAGGTGG + Intronic
1017486042 6:154902664-154902686 CAAAAATTACCCAGGCATGGTGG + Intronic
1017491403 6:154948750-154948772 CAAAAATTAGCCAGGCAAGATGG - Intronic
1017652387 6:156595381-156595403 CAAAAATTACCCAGGCATGGTGG + Intergenic
1017674564 6:156799627-156799649 CAAATATTACCCAGGCATGGTGG - Intronic
1017847374 6:158270995-158271017 CAAAAATTACCCAGGCATGGTGG + Intronic
1017849753 6:158294882-158294904 CAAAAATTAGCCAGGCATGCTGG - Intronic
1017903273 6:158736633-158736655 CAAACATTAGCCAGGCATGGTGG + Intronic
1017921488 6:158876651-158876673 CAAACATTACCCAGGCCTGATGG - Intronic
1018154362 6:160971931-160971953 TAAACATTAGCCAGGAATGGTGG + Intergenic
1018252335 6:161883347-161883369 CAAAAATTAGCCAGGCAAGGTGG + Intronic
1018299832 6:162389327-162389349 CAATCATTACCTAGGGAAGAAGG - Intronic
1018388102 6:163322725-163322747 CAATCATTACCCAGGCATGGTGG + Intergenic
1018427296 6:163694903-163694925 CACTCAACACCCAGGAAAGCAGG + Intergenic
1018581929 6:165315309-165315331 CAAAAATTAGCCAGGTATGCCGG - Intergenic
1019096166 6:169581478-169581500 CAAATATTATCAAGAAAAGCAGG + Intronic
1019221459 6:170476484-170476506 CAAACTTTTCCCAAGAAAGTTGG - Intergenic
1019541231 7:1552128-1552150 CAAAAATTAGCCAGGCAAGGTGG - Intronic
1019608836 7:1925281-1925303 CAGAAATTACCCAGAAAATCAGG + Intronic
1020047621 7:5054250-5054272 CAAAAATTAGCCAGGCATGCTGG + Intronic
1020063519 7:5170097-5170119 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1020119291 7:5493974-5493996 CAAAAATTAGCCAGGCAGGCCGG + Intronic
1020127407 7:5540783-5540805 CAAAAATTACCCAGGTATGGTGG + Intronic
1020205315 7:6109986-6110008 CAAAAATTACCCAGGCATGGTGG - Intronic
1020234070 7:6341843-6341865 CAAACATTACCCAGGCATGGTGG + Intronic
1020506198 7:8991885-8991907 CAAAAATTACCCAGGCATGGTGG - Intergenic
1020760701 7:12265237-12265259 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1020933210 7:14426905-14426927 CAAACATTAGCCAGGCACGGTGG + Intronic
1020992414 7:15216313-15216335 TAACAATTCCCCAGGAAAGCAGG - Intronic
1021211115 7:17853787-17853809 CAAAAATTAGCCAGGCATGCTGG + Intronic
1021270287 7:18576507-18576529 CAAAAATTAGCCAGGCATGCTGG + Intronic
1021358076 7:19678591-19678613 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1021497202 7:21289025-21289047 CAAACATTAGCCAGGCATGGTGG + Intergenic
1021520384 7:21534228-21534250 CAAAAATTACCCAGGCATGGTGG - Intergenic
1021723140 7:23524334-23524356 CAAAAATTAGCCAGGCAAGGTGG - Intronic
1021728829 7:23576779-23576801 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1021812393 7:24415480-24415502 CAAAAATTAGCCAGGAAAGGTGG + Intergenic
1021895423 7:25230453-25230475 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1022000867 7:26224806-26224828 AAAACATTAGCCAGGAATGGTGG + Intergenic
1022067591 7:26875479-26875501 AAAACATTATAAAGGAAAGCAGG + Intronic
1022116160 7:27262764-27262786 CAAACATTAGCCAGGCATGGTGG - Intergenic
1022474042 7:30698915-30698937 CACACATTAAGCAGCAAAGCAGG + Intronic
1022590881 7:31661558-31661580 CAAACATTAGCCAGGCATGGTGG + Intergenic
1023013082 7:35940588-35940610 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1023139284 7:37084907-37084929 CAAAAATTAGCCAGGTATGCTGG - Intronic
1023369542 7:39499371-39499393 CAAAAATTAGCCAGGAACGGTGG - Intergenic
1023371073 7:39512713-39512735 CAAACATTAGCCAGGTATGGTGG - Intergenic
1023442332 7:40196985-40197007 CAAAAATTAGCCAGGCAAGGTGG - Intronic
1023553146 7:41390255-41390277 GAAATATTCCCCAGCAAAGCGGG + Intergenic
1023949481 7:44831012-44831034 CAAACATTAGCCAGGCATGGTGG + Intronic
1023958886 7:44910563-44910585 CAAACATTAGCCAGGCATGGTGG + Intergenic
1024664538 7:51533080-51533102 CAAACATTAGCCAGGCATGGTGG - Intergenic
1024736814 7:52313988-52314010 CAAACATTAGCCAGGCATGGCGG - Intergenic
1024793141 7:52990156-52990178 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1024951487 7:54865513-54865535 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
1025111549 7:56221135-56221157 CAAACATTAGCCAGGCATGGTGG + Intergenic
1025126364 7:56348174-56348196 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1025211576 7:57022074-57022096 CAAACATTAGCCAGGCATGGTGG - Intergenic
1025660380 7:63554753-63554775 CAAACATTAGCCAGGCATGGTGG + Intergenic
1025728485 7:64089268-64089290 CAAAAACTAGCCAGGAATGCTGG - Intronic
1025865459 7:65376597-65376619 CAAAAATTACCCAGGCATGGTGG - Intronic
1025901278 7:65747035-65747057 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1025908778 7:65810703-65810725 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1025930625 7:65990781-65990803 CAAACATTAGCCAGGTATGGTGG + Intergenic
1025989707 7:66487275-66487297 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1026044986 7:66900905-66900927 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1026074928 7:67157436-67157458 CAAACATTAGCCAGGCATGGTGG - Intronic
1026195983 7:68174152-68174174 CAAAAATTAGCCAGGCACGCTGG - Intergenic
1026222661 7:68413921-68413943 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
1026591300 7:71697968-71697990 CAAACATTAGCCAGGCATGGTGG + Intronic
1026614838 7:71892483-71892505 CAAAAATTAGCCAGGAATGGTGG + Intronic
1026663260 7:72320680-72320702 CAAAAATTACCCAGGCATGGTGG + Intronic
1026713616 7:72766772-72766794 CAAAAATTACCCAGGCATGGTGG + Intronic
1026888265 7:73967219-73967241 AAAGAATTACACAGGAAAGCTGG - Intergenic
1026893914 7:73999312-73999334 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1027045621 7:74989407-74989429 CAAAAATTACCCAGGCATGGTGG - Intronic
1027206436 7:76103618-76103640 CAAACATTAGCCAGGCATGATGG + Intergenic
1027334260 7:77131563-77131585 CAAAGATTACCCAGGCATGGTGG + Intronic
1027401178 7:77809377-77809399 CAAAAATTACCCAGGCATGTTGG - Intronic
1027487382 7:78779059-78779081 AAAACATTAGCCAGGCAAGGTGG - Intronic
1027517700 7:79163326-79163348 CAAAAATTAGCCAGGAATGGTGG - Intronic
1027518338 7:79170323-79170345 AAAACATTAGCCAGGAATGGTGG - Intronic
1027611609 7:80368451-80368473 CAAAAATTACCCAGGCATGGTGG - Intergenic
1027695086 7:81400668-81400690 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1028193578 7:87879099-87879121 CAAAAATTACCCAGGAGTGGTGG - Intronic
1028224442 7:88233641-88233663 CAAAAATTACCCAGGCATGGTGG - Intergenic
1028579200 7:92387481-92387503 CAAAAATTACCCAGGCATGGTGG + Intronic
1028918034 7:96281236-96281258 CAAAAATTACCCAGGCATGGTGG + Intronic
1029137544 7:98384849-98384871 CAAACATTACCCAGGCGTGGTGG - Intronic
1029141793 7:98416514-98416536 CAAAAATTACCCAGGCATGGTGG - Intergenic
1029230775 7:99066623-99066645 CAAAAATTAGCCAGGCAAGGTGG + Intronic
1029270922 7:99375907-99375929 CAAAAATTACCCAGGCATGGTGG + Intronic
1029294236 7:99526705-99526727 CAAAAATTACCCGGGCATGCTGG - Intronic
1029387192 7:100251063-100251085 CAAAAATTACCCAGGCATGGTGG + Intronic
1029553243 7:101249737-101249759 CAAACATTAGCCAGGCAAGGTGG + Intronic
1029781590 7:102740035-102740057 CAAAGATTACCCAGGTATGGTGG - Intergenic
1029833821 7:103288931-103288953 CAAACATTACCCAGGCACAGTGG + Intergenic
1030079515 7:105765179-105765201 CAAACATTAGCCAGGCATGGTGG + Intronic
1030485403 7:110159816-110159838 CAAACATTAGCCAGGCATGGTGG + Intergenic
1031206356 7:118763081-118763103 CAAATGATACCCAGGAAACCAGG - Intergenic
1031763239 7:125740771-125740793 CAAACATTAGCCAGGCATGATGG - Intergenic
1031850343 7:126855626-126855648 CAAAAATTAGCCAGGCATGCTGG - Intronic
1031907813 7:127480169-127480191 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1032140737 7:129327616-129327638 CAAAAATTAGCCAGGCAAGGTGG - Intronic
1032411005 7:131693206-131693228 CCTGCATCACCCAGGAAAGCAGG - Intergenic
1032549644 7:132772404-132772426 CAAACATTAGCCAGGCATGGTGG - Intergenic
1032549705 7:132772809-132772831 CAAACATTAGCCAGGCACGGTGG - Intergenic
1032583496 7:133125517-133125539 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1032608769 7:133388495-133388517 CAAAAATTAGCCAGGAATGGTGG + Intronic
1033061988 7:138118563-138118585 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1033071093 7:138202970-138202992 CAAACATTAGCCAGGCATGGTGG + Intergenic
1033074481 7:138235574-138235596 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1033089843 7:138375414-138375436 CAAACATTAGCCAGGCATGGTGG + Intergenic
1033145182 7:138865073-138865095 CAAAAATTAGCCAGGCAAGGTGG + Intronic
1033161269 7:138999259-138999281 AAAAAATTAGCCAGGCAAGCTGG - Intergenic
1033224224 7:139548031-139548053 CAAAAATTACCCAGGCATGGTGG - Intergenic
1033334004 7:140436962-140436984 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1033573390 7:142656173-142656195 AAAACATTGACCAGAAAAGCAGG + Intergenic
1033756365 7:144400688-144400710 CAAACATTAGCCAGACATGCTGG - Intronic
1033854059 7:145535256-145535278 CAAAAATTACCCAGGCATGGTGG - Intergenic
1033964607 7:146959565-146959587 CAAAAATTACCCAGGCATGGTGG + Intronic
1034013246 7:147553816-147553838 CAAAAATTAGCCAGGCATGCTGG + Intronic
1034067943 7:148154782-148154804 CAAAAATTACTCAGGCATGCTGG + Intronic
1034081374 7:148280764-148280786 CAAAAATTAGCCAGGCAAGATGG + Intronic
1034134290 7:148751393-148751415 CAAAAATTAGCCAGGAATGGTGG + Intronic
1034180905 7:149137017-149137039 CAAAAATTAGCCAGGCATGCTGG - Intronic
1034387475 7:150752604-150752626 CAAAAATTACCCAGGTATGGTGG + Intergenic
1034521983 7:151627471-151627493 CAAAAATTAGCCAGGCATGCTGG + Intronic
1034637066 7:152575880-152575902 CAAAAATTACCCGGGAATGGTGG + Intergenic
1034649803 7:152681021-152681043 CAAACATTAGCCAGGCATGGTGG + Intergenic
1034803278 7:154066210-154066232 CAAAAATTAGCCAGGCATGCTGG - Intronic
1035199350 7:157250472-157250494 CAAAAATTAGCCAGGAATGGTGG - Intronic
1035418672 7:158709510-158709532 CAAAAATTACCCAGGCATGGTGG + Intergenic
1035434888 7:158852272-158852294 CAAACATTAGCCAGGCATGGTGG - Intergenic
1036000226 8:4594350-4594372 CAAAAATTAGCCAGGCATGCTGG - Intronic
1036130521 8:6105239-6105261 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1036254482 8:7194263-7194285 CAAAAATTACCCAGGCATGGTGG + Intergenic
1036363013 8:8093225-8093247 CAAAAATTACCCAGGCATGGTGG - Intergenic
1036363185 8:8094840-8094862 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1036407275 8:8466350-8466372 CAAAAATTACCCAGGCATGGTGG + Intergenic
1036684616 8:10901206-10901228 CAAAAATTACCCAGGCATGGTGG - Intronic
1036741186 8:11363145-11363167 CAAAAATTACCCAGGCATGATGG + Intergenic
1036909337 8:12741229-12741251 CAAACATTAGCCAGGCACGGGGG + Intronic
1037030604 8:14099570-14099592 CAAATATTAGCCAGGAATGGTGG + Intronic
1037126026 8:15350814-15350836 CAAAAATTAGCCAGGAATGTTGG + Intergenic
1037155225 8:15691586-15691608 GAAACATTCCCCTTGAAAGCTGG - Intronic
1037200605 8:16248422-16248444 CAAACATTAGCCAGGCATGGTGG + Intronic
1037218146 8:16483639-16483661 AAAACATTATCCAGGAATGGTGG + Intronic
1037419583 8:18687918-18687940 CAAAAATTACCCAGGCATGGTGG - Intronic
1037465385 8:19154695-19154717 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1037514304 8:19615149-19615171 CAAAAATTAACCAGGCATGCTGG + Intronic
1037656590 8:20888906-20888928 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1037824414 8:22152587-22152609 CAAAAATTACCCAGGCATGGTGG + Intronic
1037837952 8:22225322-22225344 CAAAAATTAGCCAGGAATGGTGG + Intronic
1037852952 8:22347677-22347699 CAAAAATTAGCCAGGCATGCTGG - Intronic
1038009259 8:23461369-23461391 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1038010254 8:23470051-23470073 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
1038026765 8:23597787-23597809 CAAAAATTACCCAGGCATGTTGG - Intergenic
1038066405 8:23968043-23968065 CAAAAATTAGCCAGGTATGCTGG - Intergenic
1038166734 8:25092778-25092800 CAAACATTAGCCAGGCATGGTGG - Intergenic
1038298348 8:26317829-26317851 CAGAGATTACCCAGGATTGCAGG + Intronic
1038313367 8:26462858-26462880 CAAAAATTAGCCAGGCAAGGTGG - Intronic
1038553210 8:28487544-28487566 CAAAAATTACCCAGGCATGGTGG - Intronic
1038579335 8:28733968-28733990 CAAACATTAGCCAGGCATGGTGG - Intronic
1038634087 8:29271549-29271571 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
1038711815 8:29954015-29954037 CAAACAATATCCAGGAACTCTGG + Intergenic
1038722208 8:30047166-30047188 CAAACATTAGCCAGGCATGGTGG - Intergenic
1038739431 8:30203870-30203892 CAAAAATTACCCAGGCATGCTGG + Intergenic
1038781105 8:30569045-30569067 GGTTCATTACCCAGGAAAGCTGG + Intronic
1038795859 8:30708804-30708826 AAAAAATTACCCAGGCATGCTGG + Intronic
1039253787 8:35695885-35695907 CAAACATTAGCCAGGCATGGTGG - Intronic
1039474938 8:37834737-37834759 CAAAAATTACCCAGGAGTGTTGG + Intronic
1039668531 8:39566248-39566270 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1039848201 8:41341191-41341213 CAAAAATTAACCAGGAATGGTGG + Intergenic
1039867960 8:41522147-41522169 CAAAAATTACCCAGGCATGGTGG + Intergenic
1039960230 8:42240820-42240842 CAAACATTAGCCAGGCATGGTGG + Intergenic
1040000125 8:42568620-42568642 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1040013910 8:42684985-42685007 CAAAAATTAACCAGGCATGCTGG + Intergenic
1040036955 8:42879825-42879847 CAAACATTAGCCAGGCACGGTGG - Intronic
1040080539 8:43280439-43280461 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1040419957 8:47229771-47229793 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1041261190 8:56021819-56021841 CAAAAATTAGCCAGGAATGGCGG + Intergenic
1041656366 8:60354755-60354777 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1041717831 8:60948232-60948254 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1042305660 8:67329071-67329093 CAAAAATTAGCCAGGCATGCTGG + Intronic
1042424424 8:68631110-68631132 CAAACATTAGCCAGGCATGGTGG + Intronic
1042549594 8:69982600-69982622 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1042823886 8:72960719-72960741 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1042920451 8:73914310-73914332 CAAAAATTAGCCAGGAATGATGG + Intergenic
1043011462 8:74886524-74886546 CAAAAATTACCCAGGCATGGTGG + Intergenic
1043077774 8:75723504-75723526 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1043356050 8:79414250-79414272 CAAACATTAGCCAGGCATGGTGG + Intergenic
1043529252 8:81131612-81131634 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
1043554404 8:81414220-81414242 GAAACATTCCCCTTGAAAGCTGG + Intergenic
1043848543 8:85189520-85189542 CAAAAATTACCCAGGCATGGTGG - Intronic
1044084964 8:87933182-87933204 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1044086796 8:87952586-87952608 AAAAAATTAGCCAGGAATGCTGG - Intergenic
1044117656 8:88354245-88354267 CAAAAATTAGCCAGGAATGATGG - Intergenic
1044338209 8:91014913-91014935 CAAATATAACCCAATAAAGCTGG + Intronic
1044391278 8:91654943-91654965 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1044545847 8:93458471-93458493 CCAACATCACCCAGCAAAGGAGG + Intergenic
1044697450 8:94937286-94937308 CAAATATTACCCAGGTATGGTGG + Intronic
1045075928 8:98567903-98567925 CAAAAATTACCCAGGCATGGTGG + Intronic
1045128083 8:99116584-99116606 CAAAAATTACCCAGGCATGGTGG - Intronic
1045129582 8:99134498-99134520 TAAATATTAAGCAGGAAAGCAGG - Intronic
1045198362 8:99952944-99952966 CAAAAATTAGCCAGGCAAGATGG - Intergenic
1045257055 8:100534917-100534939 CAAAAATTACCCAGGCATGGTGG - Intronic
1045272764 8:100675984-100676006 CAAAAATTACCCAGGCATGGTGG + Intergenic
1045459683 8:102414683-102414705 CAAAAATTACCCAGGCATGGTGG - Intergenic
1045474393 8:102540739-102540761 CAAAAATTAGCCAGGAATGATGG - Intergenic
1045646394 8:104303838-104303860 CAAAAATTAATCAGTAAAGCAGG - Intergenic
1046268349 8:111860095-111860117 CAAATATTAGCCAGGCATGCTGG - Intergenic
1046377762 8:113409233-113409255 CAAAAATTAGCCAGGCATGCTGG - Intronic
1046897214 8:119485934-119485956 CAAAAATTACCCAGGCATGGTGG + Intergenic
1046910774 8:119623776-119623798 CAAAAATTACCCAGGCATGGGGG - Intronic
1047378045 8:124322841-124322863 CAAAAATTAGCCAGGAATGATGG + Intronic
1047387554 8:124424156-124424178 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1047484576 8:125317347-125317369 CAAACATTAGCCAGGCATGGTGG - Intronic
1047491110 8:125375411-125375433 CAAAAATTAGCCAGGAATGATGG + Intergenic
1047578260 8:126182513-126182535 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1047600974 8:126425677-126425699 CAAAAATTACCCAGGCACGATGG + Intergenic
1047738531 8:127788227-127788249 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1047760562 8:127951048-127951070 CAAAAATTACCCAGGCATGGTGG - Intergenic
1047817834 8:128484148-128484170 CAAACATTAGCCAGGCATGGTGG - Intergenic
1047936550 8:129786178-129786200 CAAAAATTAGCCAGGAATGGTGG + Exonic
1048025353 8:130581814-130581836 CAAAAATTACCCAGGCATGGTGG - Intergenic
1048229188 8:132620485-132620507 CAAAAATTAGCCAGGAATGGTGG - Intronic
1048834326 8:138503939-138503961 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1049170118 8:141154713-141154735 CAAAAATTACCCAGGCATGGTGG - Intronic
1049469542 8:142769241-142769263 GTAAAATCACCCAGGAAAGCGGG + Intronic
1049740457 8:144238581-144238603 CTAAGATCACCCAAGAAAGCAGG - Intronic
1049971844 9:828623-828645 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1050144594 9:2553136-2553158 AAAACATTACATGGGAAAGCAGG + Intergenic
1050160570 9:2714643-2714665 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1050207934 9:3217420-3217442 CAAAAATTACCCAGGCATGGTGG - Intergenic
1050238593 9:3610779-3610801 CAAAAATTAGCCAGGCAAGATGG - Intergenic
1050348902 9:4720849-4720871 AAAACTATACCCAGGAAACCTGG + Intronic
1050466169 9:5926458-5926480 CAAACATTAGCCAGGTATGGTGG - Intronic
1050560819 9:6832878-6832900 CAAAAATTAGCCAGGCAAGGTGG - Intronic
1050725083 9:8640081-8640103 AAAACATTACCCAGGCATGGTGG - Intronic
1050733394 9:8735294-8735316 CAAAAATTACCCAGGCATGGTGG - Intronic
1050876059 9:10638064-10638086 AGACCATTACCCAGGAAAGAGGG + Intergenic
1050897048 9:10896597-10896619 CAAACATTAGCCAGGACTGATGG + Intergenic
1050928824 9:11299562-11299584 CAAAAATTAGCCAGGTAAGGTGG + Intergenic
1050962389 9:11751415-11751437 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1051048640 9:12905577-12905599 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1051285106 9:15488174-15488196 CAAAAATTACCCAGGCACGGTGG + Intronic
1051317343 9:15855364-15855386 CAAACAGTAACCAAGAGAGCTGG - Intronic
1051386864 9:16518751-16518773 CAAACATTAGCCAGGCATGGTGG - Intronic
1051465321 9:17369832-17369854 CAAACATTAGCCAGGCATGGTGG + Intronic
1051617436 9:19019574-19019596 CAAAAATTACCCAGGCATGGTGG + Intronic
1051645278 9:19262237-19262259 CAAAAATTAGCCAGGCATGCTGG - Intronic
1052809628 9:33045690-33045712 CAAAAATTAGCCAGGCATGCTGG + Exonic
1052839194 9:33277041-33277063 CAAAAATTACCCAGGCATGGTGG + Intronic
1052906091 9:33835297-33835319 CAAAAATTACCCAGGCATGGTGG - Intronic
1052998629 9:34565253-34565275 CCATTATTACCCAGGCAAGCTGG + Intronic
1053021310 9:34696333-34696355 CAAAAATTAGCCAGGCACGCTGG + Intergenic
1053103927 9:35394441-35394463 CAAACATTAGCCAGGTGTGCTGG + Intronic
1053156371 9:35782959-35782981 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1053205422 9:36182310-36182332 CAAAAATTACCCAGGTATGGCGG + Intergenic
1053210742 9:36225480-36225502 CAAAAATTAGCCAGGCATGCTGG + Intronic
1053229049 9:36390288-36390310 CAAACATTAGTCAGAAAAGCTGG + Intronic
1053656825 9:40224172-40224194 CAAAAATTAGCCAGGCATGCTGG - Intronic
1053907194 9:42853455-42853477 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1054357271 9:64072688-64072710 CAAAAATTAGCCAGGCACGCTGG - Intergenic
1054368944 9:64370453-64370475 CAAAAATTAGCCAGGCATGCTGG - Intronic
1054527772 9:66152055-66152077 CAAAAATTAGCCAGGCATGCTGG + Intronic
1054676574 9:67860208-67860230 CAAAAATTAGCCAGGCATGCTGG - Intronic
1054789559 9:69243014-69243036 CAAAAATTACCCAGGCATGGTGG - Intronic
1054826102 9:69575067-69575089 CAAAAATTAGCCAGGAGAGGTGG - Intronic
1054838585 9:69708713-69708735 CAAACATTAGCCAGGCATGGTGG - Intergenic
1054869156 9:70033233-70033255 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1054990267 9:71317486-71317508 CAAAAATTATCCAGGTATGCTGG + Intronic
1055064550 9:72105458-72105480 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1055103111 9:72485385-72485407 CAAACATTAACCAGGACTGGTGG + Intergenic
1055111767 9:72566820-72566842 TGACCATAACCCAGGAAAGCGGG - Intronic
1055298672 9:74860509-74860531 CAAAAATTAGCCAGGCATGCTGG - Intronic
1055912513 9:81368540-81368562 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1055952532 9:81743688-81743710 CAAAAATTACCCAGGCATGGTGG - Intergenic
1056214523 9:84394712-84394734 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1056238472 9:84619622-84619644 CAAACATTAGCCAGACATGCTGG - Intergenic
1056342827 9:85654688-85654710 CAAAAATTACCCGGGAATGGTGG + Intronic
1056843740 9:90019452-90019474 CAACCATAAGTCAGGAAAGCAGG - Intergenic
1056962670 9:91140253-91140275 CAAAAATTACCCAGGCATGGTGG + Intergenic
1057584250 9:96315270-96315292 CAAACATTAGCCAGGCATGGTGG - Intergenic
1057774313 9:97993786-97993808 CAAAAATTAGCCAGGCAAGATGG - Intronic
1057906133 9:98984942-98984964 CAAAAATTATCCAGGCATGCTGG - Intronic
1058475741 9:105330836-105330858 CAAACATTACAGAGGACAGCTGG - Intronic
1058574178 9:106382231-106382253 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1058917154 9:109578689-109578711 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1058966019 9:110039094-110039116 CAAAAATTAGCCAGGCATGCTGG + Intronic
1059342843 9:113609169-113609191 CAAACATTAGCCAGGCAAGGTGG + Intergenic
1059475716 9:114546014-114546036 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
1060079717 9:120631635-120631657 CAAAAATTACCCAGGCATGGTGG - Intronic
1060122173 9:121003136-121003158 CAAAAATTAGCCAGGCGAGCTGG + Intronic
1060285269 9:122245837-122245859 CAAAAATTACCCGGGCATGCTGG + Intronic
1060285717 9:122249916-122249938 CAAAAATTAGCCAGGCATGCTGG + Intronic
1060290600 9:122299230-122299252 CAAAAATTACCCAGGCATGGTGG + Intronic
1060506413 9:124201399-124201421 CAAAAATTACCCAGGCATGGTGG - Intergenic
1060772444 9:126342357-126342379 CACCCACTACCCAGGCAAGCAGG - Intronic
1060955871 9:127639255-127639277 CAAACATTAGCCAGGCATGGTGG - Intronic
1060969212 9:127728640-127728662 CAAACATTAGCCAGGCATGGTGG + Intronic
1061308191 9:129744722-129744744 CAAACATTAGCCAGGAGTGGTGG + Intronic
1061345111 9:130017675-130017697 CAAAAATTACCCAGGTATGGTGG + Intronic
1061688545 9:132304843-132304865 CAAACATTAGCCAGGCATGGTGG + Intronic
1061689158 9:132311117-132311139 CAAACATTAGCCAGGCATGGTGG - Intronic
1061866691 9:133494936-133494958 CATACAAGACCCAGGAAAACAGG - Intergenic
1062030156 9:134358600-134358622 CAAACAGGAGCCTGGAAAGCAGG - Intronic
1062223060 9:135430296-135430318 CAAAAATTACCCAGGCATGGTGG + Intergenic
1062232923 9:135492427-135492449 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1062469260 9:136695267-136695289 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1203748800 Un_GL000218v1:59426-59448 CAAAAATTAGCCAGGCACGCTGG - Intergenic
1203460763 Un_GL000220v1:34699-34721 TAAAAATTACCCAGGCAAGGTGG - Intergenic
1185493603 X:537716-537738 CAAAAATTACCCAGGCATGGTGG - Intergenic
1185500339 X:591975-591997 CAAACATTAGCCAGGCATGGTGG + Intergenic
1185550353 X:979076-979098 CAAAAATTACCCAGGCATGGTGG + Intergenic
1185662385 X:1737615-1737637 CAAAAATTAGCCAGGTGAGCTGG - Intergenic
1185800028 X:3002123-3002145 CAAACATTAGCCAGGCATGGTGG - Intergenic
1185920564 X:4087437-4087459 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1185989040 X:4872358-4872380 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1186268435 X:7858100-7858122 CAAAAATTACCCAGGTGAGGAGG - Intergenic
1186350694 X:8736027-8736049 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1186630805 X:11346554-11346576 CAAAAATTAGCCAGGCATGCTGG + Intronic
1186744838 X:12556955-12556977 CAAAAATTAGCCAGGAATGGTGG - Intronic
1187176747 X:16902848-16902870 CAAAAATTAACCAGGAATGGTGG - Intergenic
1187179222 X:16927622-16927644 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1187194654 X:17071628-17071650 CAAACATTTCCCAGAAAAGGAGG - Intronic
1187365110 X:18660359-18660381 CAAACATTAGCCAGGCATGGTGG - Intronic
1187442105 X:19329707-19329729 AAAACATTAGCCAGGTATGCTGG - Intergenic
1187489541 X:19738002-19738024 CAAACATTTCCCATGAGAGGTGG + Intronic
1187508395 X:19895915-19895937 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1187912153 X:24120866-24120888 CAAAAATTACCCAGGCATGTTGG + Intergenic
1188393032 X:29644717-29644739 CAAAAATTAGCCAGGCAAGGTGG - Intronic
1188459050 X:30401762-30401784 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
1188995820 X:36883798-36883820 CAAACATTTGGCAGGAAAGTTGG + Intergenic
1189264232 X:39701405-39701427 AAAACATTACCCAGGCATGGTGG + Intergenic
1189810902 X:44779829-44779851 CAAAAATTCCCCAGGAATGGTGG - Intergenic
1189813324 X:44800747-44800769 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
1190032613 X:46988990-46989012 CAAAAATTACCCAGGCACGGTGG - Intronic
1190067251 X:47249791-47249813 CAAAAATTACCCAGGCATGGTGG + Intergenic
1190255713 X:48760907-48760929 CAAAAATTACCCAGGCATGGTGG - Intergenic
1190258140 X:48780077-48780099 CAAAAATTAGCCAGGAACGGTGG + Intergenic
1190311282 X:49118584-49118606 CAAAAATTAACCAGGCATGCTGG + Intronic
1190482789 X:50894170-50894192 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1191867232 X:65713930-65713952 CAAAAATTAGCCAGGCAAGGTGG - Intronic
1192073897 X:67970652-67970674 CAAACATTAGCCAGGCATGGTGG + Intergenic
1192427503 X:71090393-71090415 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1192504546 X:71673190-71673212 CAAACATTAGCCAGGAGTGGTGG - Intergenic
1192740862 X:73891450-73891472 CAAAAATTAGCCAGGCATGCTGG + Intergenic
1193570256 X:83132696-83132718 AAAACATTCCCCTTGAAAGCTGG + Intergenic
1193912513 X:87323262-87323284 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1194037791 X:88899852-88899874 CAAAAATTACCCAGGCATGGTGG + Intergenic
1194102795 X:89727653-89727675 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1194497207 X:94631374-94631396 AAAAAATTTCCCAGAAAAGCAGG + Intergenic
1194706470 X:97181217-97181239 CAAAAATTACCCAGGCATGGTGG - Intronic
1194713102 X:97259099-97259121 CAAAAATTACCCAGGCATGGTGG + Intronic
1194759424 X:97776785-97776807 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1195215759 X:102700119-102700141 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1195659520 X:107364163-107364185 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1195799257 X:108688587-108688609 CAAAAATTAGCCAGGCATGCTGG - Intronic
1195898418 X:109772337-109772359 CAAACATTAGCCAGGTAAGGTGG + Intergenic
1195969632 X:110459120-110459142 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
1196276958 X:113777793-113777815 CAAAAATTAGCCAGGCATGCTGG - Intergenic
1196643396 X:118089926-118089948 CAAATATTAGCCAGGAATGGTGG + Intronic
1196691291 X:118561710-118561732 CAAAAATTACCCAGGCATGGTGG + Intronic
1196744859 X:119062518-119062540 GCAACATTTCCCAGGAGAGCTGG + Intergenic
1196802114 X:119552999-119553021 CAAAAATTACCCAGGTATGATGG + Intronic
1196810288 X:119623684-119623706 CAAAAATTAGCCAGGAATGGTGG + Intronic
1196835127 X:119806874-119806896 CAAAAATTAGCCAGGCAAGGTGG + Intergenic
1196974021 X:121138980-121139002 CAAAAATTACCCAGGCACGGTGG + Intergenic
1197200872 X:123747530-123747552 CAAAAATTAGCCAGGCAAGGTGG - Intergenic
1197229580 X:123989754-123989776 CAAAAATTACCCAGGCATGGTGG - Intronic
1197698735 X:129579905-129579927 CAGACATTAGCCAGTAAAGGTGG - Intronic
1197790795 X:130251959-130251981 CAAAAATTACCCAGGCATGATGG + Intronic
1198036183 X:132803559-132803581 CAAAAATTAGCCAGGAATGGTGG - Intronic
1198069411 X:133133367-133133389 CAATCATTCCACAGTAAAGCTGG + Intergenic
1198090152 X:133320883-133320905 CAAAAATTACCCAGGCATGATGG + Intronic
1198465533 X:136901528-136901550 CAAACATTAGCCAGGCATGGTGG - Intergenic
1199174004 X:144763519-144763541 CAAACATTAGCCAGGAGTGGTGG + Intergenic
1199814513 X:151386028-151386050 CCAACATCACCCAGGAAAGGAGG - Intergenic
1199892599 X:152101818-152101840 CAAAAATTAACCAGGCAAGGTGG + Intergenic
1200455473 Y:3385639-3385661 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1200782688 Y:7231257-7231279 CAAAAATTACCCAGGTATGGTGG - Intergenic
1200784492 Y:7248047-7248069 CAAAAATTAGCCAGGAATGGTGG + Intergenic
1200875392 Y:8149048-8149070 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1201162157 Y:11174459-11174481 CAAAAATTAGCCAGGCACGCTGG - Intergenic
1201420919 Y:13797660-13797682 CAAAAATTAGCCAGGAATGGTGG - Intergenic
1201538593 Y:15080759-15080781 CAAAAATTACCCAGGCATGGTGG + Intergenic
1201559052 Y:15296334-15296356 CAAACATTAGCCAGGTATGATGG - Intergenic
1201622230 Y:15972883-15972905 TATAAATTACCCTGGAAAGCTGG + Intergenic
1202188653 Y:22217634-22217656 CAAAAATTAGCCAGGAACGGTGG - Intergenic
1202240097 Y:22758192-22758214 CAAAAATTAACCAGGAATGGTGG + Intergenic
1202393083 Y:24391954-24391976 CAAAAATTAACCAGGAATGGTGG + Intergenic
1202477702 Y:25278163-25278185 CAAAAATTAACCAGGAATGGTGG - Intergenic