ID: 1168361893

View in Genome Browser
Species Human (GRCh38)
Location 19:55748227-55748249
Sequence AGGCAGTCCCAGAAATTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168361893_1168361897 30 Left 1168361893 19:55748227-55748249 CCATGAAATTTCTGGGACTGCCT No data
Right 1168361897 19:55748280-55748302 GCCGAGAAACAATTGTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168361893 Original CRISPR AGGCAGTCCCAGAAATTTCA TGG (reversed) Intergenic
No off target data available for this crispr