ID: 1168362956

View in Genome Browser
Species Human (GRCh38)
Location 19:55758065-55758087
Sequence GTATCTACACATATGCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168362956_1168362960 24 Left 1168362956 19:55758065-55758087 CCTGCATGCATATGTGTAGATAC No data
Right 1168362960 19:55758112-55758134 CATGTGGCAGATTATATTATAGG No data
1168362956_1168362958 -4 Left 1168362956 19:55758065-55758087 CCTGCATGCATATGTGTAGATAC No data
Right 1168362958 19:55758084-55758106 ATACGGTATGTGTGTATACATGG No data
1168362956_1168362959 8 Left 1168362956 19:55758065-55758087 CCTGCATGCATATGTGTAGATAC No data
Right 1168362959 19:55758096-55758118 TGTATACATGGACATACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168362956 Original CRISPR GTATCTACACATATGCATGC AGG (reversed) Intergenic
No off target data available for this crispr