ID: 1168363911

View in Genome Browser
Species Human (GRCh38)
Location 19:55768065-55768087
Sequence GTATCTACACATATGCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168363911_1168363914 8 Left 1168363911 19:55768065-55768087 CCTGCATGCATATGTGTAGATAC No data
Right 1168363914 19:55768096-55768118 TGTATACATGGACATACATGTGG No data
1168363911_1168363913 -4 Left 1168363911 19:55768065-55768087 CCTGCATGCATATGTGTAGATAC No data
Right 1168363913 19:55768084-55768106 ATACGGTATGTGTGTATACATGG No data
1168363911_1168363915 24 Left 1168363911 19:55768065-55768087 CCTGCATGCATATGTGTAGATAC No data
Right 1168363915 19:55768112-55768134 CATGTGGCAGATTATATTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168363911 Original CRISPR GTATCTACACATATGCATGC AGG (reversed) Intergenic
No off target data available for this crispr