ID: 1168368359

View in Genome Browser
Species Human (GRCh38)
Location 19:55809543-55809565
Sequence CTGAAGCGGCAGATGGACAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168368359_1168368365 14 Left 1168368359 19:55809543-55809565 CCCTTGTCCATCTGCCGCTTCAG 0: 1
1: 0
2: 2
3: 10
4: 128
Right 1168368365 19:55809580-55809602 TCCAGCATAAGATGGCGACTCGG 0: 1
1: 0
2: 0
3: 2
4: 50
1168368359_1168368364 6 Left 1168368359 19:55809543-55809565 CCCTTGTCCATCTGCCGCTTCAG 0: 1
1: 0
2: 2
3: 10
4: 128
Right 1168368364 19:55809572-55809594 ACACGTGATCCAGCATAAGATGG 0: 1
1: 0
2: 0
3: 6
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168368359 Original CRISPR CTGAAGCGGCAGATGGACAA GGG (reversed) Exonic
900181400 1:1312592-1312614 CTGAAGCGGGAGATGGCGCAGGG - Exonic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
909247046 1:73299597-73299619 CTGCAGCAGCAAATGGACTAAGG - Intergenic
911122233 1:94308321-94308343 CTGAAGCAGCGGATGGGGAAGGG - Intergenic
912514984 1:110211572-110211594 CTGAAGGAGGAGATGGCCAAGGG + Exonic
913169963 1:116222778-116222800 CTGAGGCTGCAGAAGGACACTGG + Intergenic
913530174 1:119728377-119728399 CTGGAAGGACAGATGGACAATGG - Intronic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
920676086 1:208039706-208039728 ATCAAGCAGCAGATGGAGAAGGG - Exonic
921583674 1:216924446-216924468 CTGAAGGGGCTGCTGGACACTGG - Intronic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
924813674 1:247424707-247424729 CTGAAACAGCAGATGGAGAGTGG + Exonic
1065454862 10:25896524-25896546 CTGAAACAGCAGATCGACAATGG - Intergenic
1065791187 10:29262424-29262446 GTGAAAAGGCAGATGGAGAAAGG - Intergenic
1067432151 10:46251814-46251836 TGGAAGCCACAGATGGACAAGGG - Intergenic
1067441078 10:46309530-46309552 TGGAAGCCTCAGATGGACAAGGG + Intronic
1067577726 10:47418793-47418815 TGGAAGCCTCAGATGGACAAGGG + Intergenic
1067709548 10:48637178-48637200 CTGAAGCTGCAGATGGAGACAGG + Intronic
1072982954 10:100115133-100115155 CTGCAGCGGCAGCTGGACTGGGG - Intergenic
1076740241 10:132479282-132479304 CTGGAGCAGGAGCTGGACAAGGG + Intergenic
1077215361 11:1393250-1393272 CTGATGGGGCACAGGGACAAAGG - Intronic
1077958104 11:7043161-7043183 CTGAAGCAGCAAATGGAGAAGGG + Exonic
1078050361 11:7960500-7960522 CTGCAGGGGCAGATGGAGAGAGG - Exonic
1081597192 11:44467385-44467407 CTGAGGCTGCAGATGGCCAAGGG + Intergenic
1084150779 11:67287007-67287029 CTGAAGCCAGAGATGGCCAAGGG - Intergenic
1087194656 11:95293356-95293378 CCAAAGCGGCAGAGGGTCAAGGG - Intergenic
1089689389 11:120177828-120177850 CTGAAGCTGCAGAGAGACAAAGG + Intronic
1090075360 11:123577344-123577366 CTGCAGCGGCAGATGGAGAGAGG - Intronic
1090723984 11:129505287-129505309 CTGAAGCTGCAAATGCAGAAAGG + Intergenic
1091704759 12:2686195-2686217 CTGAAGCGACAGAAGGACCGAGG + Exonic
1095594120 12:43939579-43939601 CTGAAGTGGCAGTAGGAGAAGGG - Intronic
1096021335 12:48328191-48328213 CAGAAGAGGTAGATGAACAAGGG - Intergenic
1100934561 12:99648256-99648278 CTGCAGCGGCAACTGTACAAAGG + Exonic
1101398121 12:104365894-104365916 CTGAACCGGCAGCTGGACTCAGG + Intergenic
1103842324 12:123875267-123875289 CTGAAGCTGCTGTTGGAAAAAGG + Exonic
1104710559 12:130982806-130982828 CTGAAGTGGAAGCTGGAGAAGGG + Intronic
1106343340 13:28852275-28852297 CTGGAGAGACAGATGAACAAAGG - Intronic
1106360761 13:29028511-29028533 CTGAAGCAGCAGAGTGAGAAAGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108454370 13:50598194-50598216 CTGCAGGGGCAGAAGGGCAAGGG - Intronic
1109643186 13:65218718-65218740 ATGAAGTTGAAGATGGACAATGG + Intergenic
1110458078 13:75712250-75712272 CTGAAGTGGCAGGTGGAGCAGGG + Intronic
1114805474 14:25830779-25830801 CTGAAGGGGATTATGGACAATGG - Intergenic
1114969450 14:28006967-28006989 ATGAGGTGACAGATGGACAAAGG - Intergenic
1116466903 14:45244503-45244525 ATGAAGTGACAGAAGGACAAAGG - Intronic
1120663859 14:87282513-87282535 CTGAAGAGGCAGATGGTTTAGGG + Intergenic
1121365317 14:93303787-93303809 TTGAAGCAACAGATGGAAAATGG + Intronic
1122728533 14:103777504-103777526 CTGTGGCGGCAGATGGGCTATGG - Intronic
1125483310 15:40095168-40095190 CTGAGGCGGGAGAAGGCCAAAGG - Intronic
1140806275 16:78535179-78535201 CAGAGGCTGCAGATGGACACAGG + Intronic
1141212883 16:81997331-81997353 CAGAAGAGGGAGATGGTCAAAGG - Exonic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1147024512 17:37568602-37568624 CTGAAGTTTAAGATGGACAAAGG + Intronic
1148790829 17:50171728-50171750 CTCAAGGGGCTGGTGGACAAGGG - Intronic
1152212654 17:79010519-79010541 CTGAAGGTGCAGATGGGCAGGGG - Intergenic
1152626365 17:81389547-81389569 CTGGAGGGGCAGCAGGACAATGG + Intergenic
1158699814 18:59735662-59735684 CTGAGGTGGCTGATGGATAAAGG + Intergenic
1160580456 18:79881679-79881701 CTGAATCTGGAGATGGACTATGG - Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1166864228 19:45826374-45826396 CTGAGGAGGAAGATGGAGAAGGG + Intronic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
1168368359 19:55809543-55809565 CTGAAGCGGCAGATGGACAAGGG - Exonic
927098251 2:19764444-19764466 CTGGAGCCCCAGATGGACATGGG + Intergenic
928530404 2:32185495-32185517 CTGAAGAGGCATATCGACCAAGG + Intronic
932038751 2:68276217-68276239 CTGAAGTGGCAGAGAGAGAATGG + Intergenic
935296007 2:101650261-101650283 CTGAAGTGGCATATGGAAAGAGG - Intergenic
935375999 2:102398190-102398212 CAAAAGAGGCAGATGCACAATGG - Exonic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938370130 2:130763438-130763460 CGGAAGCTGCATATGGACAGTGG - Exonic
944685586 2:202114633-202114655 CTGAAGCATCATATTGACAATGG - Intronic
946023958 2:216660706-216660728 CAGCACCGGCAGATGGGCAAGGG + Exonic
947699245 2:232218580-232218602 CTGGAGGGGCAGCAGGACAAGGG + Intronic
1172054750 20:32146434-32146456 CTGAAGCAGCAGATAGCCAGAGG + Intronic
1173997925 20:47353698-47353720 CTGAGGAGGCAGAAGGAAAAAGG + Intronic
1177682385 21:24389333-24389355 CTGAAATGGAAGATGGAGAAAGG - Intergenic
1178401694 21:32291799-32291821 CTGAGGCAGCAGGTGGATAATGG + Exonic
1179026601 21:37683818-37683840 GTGAAGTGGCAGAGGGAGAAAGG + Intronic
1180661703 22:17473161-17473183 CTGAAGCTGCAGAGGGGCAGTGG + Intronic
1182600387 22:31458696-31458718 CTGAAGCCACAGAGGGACACTGG - Intronic
1183902707 22:41018556-41018578 CTGAAGAGGCAGATGGGTAGTGG + Intergenic
950662551 3:14475574-14475596 CTGAAGAGGCTGGTGGAGAAGGG + Intronic
956304581 3:67809766-67809788 CTGAAGCGGGGGATGCACACAGG + Intergenic
957684696 3:83486643-83486665 CTGAATCTGGAGGTGGACAAGGG + Intergenic
958619881 3:96544407-96544429 CTGAAGTGGCAGATGAATAAAGG + Intergenic
960055906 3:113276238-113276260 CAGAAGAGGCAGATTGGCAAAGG + Intronic
961456669 3:127027979-127028001 ATCAAGCAGCAGATGGAGAAGGG + Exonic
961957677 3:130821005-130821027 CAAAAGGGGCAGATGGAGAAAGG + Intergenic
965838414 3:172876755-172876777 CTCAGGCTGCAGATGGACAGAGG - Intergenic
966303874 3:178509244-178509266 CTGAAGGAGCAGATAGTCAAAGG - Intronic
972918690 4:43910460-43910482 CTGAAGTGGCAGATGGTCCCAGG + Intergenic
975822645 4:78287468-78287490 CTGAAAAGGCAGATAGACCAGGG + Intronic
976339919 4:83935437-83935459 TTGAATCAGCAGAAGGACAAAGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
989129106 5:38086968-38086990 CTGACACGCCAGATGGACACTGG + Intergenic
992150260 5:73895543-73895565 CTGAAGTGACAGTGGGACAAAGG + Intronic
992758740 5:79933214-79933236 CTTCAGAGGCAAATGGACAATGG + Intergenic
993554685 5:89321326-89321348 GTGAAGGGGCAGAGGAACAAGGG - Intergenic
994159291 5:96537674-96537696 TTGAAGCGGCAGAAAAACAAAGG + Intronic
996930883 5:128885423-128885445 TGGAAGGGGGAGATGGACAAGGG + Intronic
998340438 5:141413091-141413113 CTGAAGCCACAGAAAGACAAAGG + Intronic
1002077969 5:176720548-176720570 CTGAAGCGGCACATGGGCACGGG - Intergenic
1002556870 5:180048746-180048768 CTGAAGCTACAGATGGCAAAGGG - Intronic
1003015237 6:2462676-2462698 TGGAAGAGGCAGATGGAGAAGGG - Intergenic
1004233243 6:13851487-13851509 CTGAGGAGGCAGAAGGACAAAGG - Intergenic
1014665973 6:124238140-124238162 CTGAGGGGGTAGATGGATAAAGG + Intronic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1020885896 7:13819065-13819087 AAGAAGCAGCAGATGGATAAGGG + Intergenic
1021420252 7:20439023-20439045 CTCAAGAGGCAGATGGTCCATGG - Intergenic
1022518470 7:30990180-30990202 CCAAAGCAGCAGCTGGACAAAGG - Intronic
1029690713 7:102179527-102179549 CTGAAGCAGCACCTGGACAGGGG - Intronic
1032468921 7:132164227-132164249 ATCAAGCAGCAGATGGAGAAGGG - Exonic
1034894482 7:154867333-154867355 CTGTCGCGGCAGAGGCACAAAGG + Intronic
1037666338 8:20973233-20973255 CTGGGCCGGCAGTTGGACAATGG + Intergenic
1039575453 8:38620176-38620198 CTGAATGGGCAGAGGGAAAAAGG - Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1044216408 8:89616286-89616308 GAGAAGCAGCAGATGGACCATGG + Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1047035706 8:120936622-120936644 CTGAAGCTGGAGATGGGTAATGG + Intergenic
1048156034 8:131952784-131952806 CAGGAGTAGCAGATGGACAATGG - Intronic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049379695 8:142305783-142305805 CTCAAGAGGCAGACAGACAAAGG + Intronic
1050335022 9:4582504-4582526 TTGTAGGGGCAGATGGGCAAGGG - Intronic
1051042237 9:12825594-12825616 CTGCAGGGGCAGGTGGACATGGG - Intergenic
1057706536 9:97398995-97399017 CTGGAGGGGGAGATGGACAAAGG - Intergenic
1057738002 9:97684324-97684346 ATGCAGCGATAGATGGACAAGGG + Intronic
1059316252 9:113428185-113428207 CAGCAGCAGCAGATGGAAAAAGG + Exonic
1061113569 9:128593093-128593115 GAGAAGCGGCAGAGGGAGAATGG - Intronic
1061941464 9:133886431-133886453 CTGTGGCGTCAGATGGACATGGG - Intronic
1062554378 9:137107358-137107380 ATGAACCGGCAGATGGAGACGGG + Exonic
1185531098 X:819845-819867 GTGTAGACGCAGATGGACAAGGG - Intergenic
1189733907 X:44049693-44049715 ATGAAGAGGCAGATTGGCAAGGG - Intergenic
1190715924 X:53103532-53103554 CTGAAGTGGCAGAGGGCGAAGGG - Intergenic
1192088999 X:68132883-68132905 CTGAAGCGGCCCATGGACTTCGG + Intronic
1197094325 X:122575008-122575030 CTGAAGCTGCACAGGGAAAACGG + Intergenic
1199007100 X:142713263-142713285 CTGAAGCTGCTGAAGCACAAAGG - Intergenic
1200236185 X:154468862-154468884 ATCAAGCAGCAGATGGAGAAGGG + Exonic
1201900535 Y:19043183-19043205 CTGTAGCTGCAAAAGGACAAGGG - Intergenic