ID: 1168368922

View in Genome Browser
Species Human (GRCh38)
Location 19:55814782-55814804
Sequence CTGGATTATCTAGGACACAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168368917_1168368922 22 Left 1168368917 19:55814737-55814759 CCGCTCTCATGGAGAGAGAACAG 0: 1
1: 0
2: 1
3: 27
4: 236
Right 1168368922 19:55814782-55814804 CTGGATTATCTAGGACACACGGG 0: 1
1: 0
2: 0
3: 5
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168368922 Original CRISPR CTGGATTATCTAGGACACAC GGG Intronic
911242582 1:95482113-95482135 TTGGATTTTCTAGGATAAACAGG + Intergenic
912650279 1:111432599-111432621 CTGGATTATCGGGGACACTTCGG - Intergenic
917480436 1:175407004-175407026 AAGGCTTATCTAGAACACACAGG + Intronic
920676668 1:208042993-208043015 CTGGATTTCCTAGGATACCCTGG + Intronic
921986099 1:221314334-221314356 CTGGATTATCTGGTGCATACAGG - Intergenic
922242007 1:223761643-223761665 CTGGATTGTCCAGGACAGAGTGG - Intronic
923071570 1:230569874-230569896 ATGGTTTATTTTGGACACACGGG + Intergenic
923350746 1:233103264-233103286 CTGGATTATTTATAACACAAAGG - Intronic
924656633 1:245978606-245978628 CTGGAGGATTTAGGACAAACAGG - Intronic
924668343 1:246096957-246096979 CTGGATTATGTAGGAGAAAATGG - Intronic
1068629317 10:59283722-59283744 ATGGATTATCTGTGACACATGGG + Intronic
1070787444 10:79170181-79170203 CTGGCCAATCTGGGACACACTGG + Intronic
1071050549 10:81443251-81443273 CTGGATTATCTGTAACACAAAGG - Intergenic
1071067071 10:81648344-81648366 CTGGAATATCTAAGAAACAAAGG - Intergenic
1073045683 10:100636953-100636975 CTGGCTTATCTACCACTCACTGG - Intergenic
1074495903 10:113979875-113979897 CTGAATTTTCCAGGACACAAAGG + Intergenic
1076203511 10:128576984-128577006 CTGCATTATCCAAGACACAAGGG + Intergenic
1077895425 11:6449923-6449945 CTGAGTGATCTAAGACACACAGG + Intronic
1083832512 11:65241828-65241850 CTGGATTCTCTTGGGCACCCTGG - Intergenic
1084076437 11:66781659-66781681 CTTGAGTAGCTAGGACCCACAGG + Intronic
1085902287 11:80715514-80715536 CTGGTTAATCTTGGAGACACAGG + Intergenic
1088539756 11:110901528-110901550 TTAGATTCTCTAAGACACACAGG + Intergenic
1089051793 11:115552054-115552076 CTGGATAATTTGGGACACAGTGG + Intergenic
1091960196 12:4687690-4687712 CTGGATTATTTCAGACACATAGG + Exonic
1095289337 12:40459382-40459404 TTGGATTATTTAGAACACAAAGG - Intronic
1096240044 12:49954955-49954977 CTGCATTATCTGGGTTACACCGG - Intronic
1096642292 12:53004104-53004126 CTTGATTATATGGGAAACACGGG + Intergenic
1098389042 12:69949728-69949750 CTGGCTTCCCTAGGCCACACTGG - Intronic
1101733663 12:107446719-107446741 GTGGATTATCTGGTAGACACAGG + Intronic
1102940011 12:116932213-116932235 CTGTATTCTCTAGGAGACACTGG + Intronic
1104393496 12:128411195-128411217 CTGAATTACAAAGGACACACAGG - Intronic
1107987117 13:45785208-45785230 CTGCATGGTCTAGGTCACACAGG + Intronic
1113644586 13:111984120-111984142 CTGGGTTATCTAGCTCTCACTGG + Intergenic
1114190387 14:20435971-20435993 CTGGAGTATCTGGGATATACAGG + Intergenic
1114389673 14:22293590-22293612 CTGGATTATTGAGGCCACATAGG - Intergenic
1115447100 14:33503508-33503530 CTGGATTATATAAAGCACACTGG - Intronic
1116647274 14:47544754-47544776 TTGTATTATCTAGTACAGACTGG - Intronic
1118187471 14:63550480-63550502 CCTGAGTAGCTAGGACACACAGG - Intergenic
1121840058 14:97126400-97126422 CTTAATTATCTAAGACACCCAGG - Intergenic
1122591202 14:102852823-102852845 CTTGAGTAGCTAGGACTCACAGG + Intronic
1126458367 15:48889317-48889339 GTGGATTCTCTAGGTGACACTGG + Intronic
1138908197 16:61363759-61363781 CTGGATTTTCTAGTAAACTCAGG + Intergenic
1139759880 16:69176317-69176339 CTCGAGTAGCTAGGAAACACAGG - Intronic
1139847319 16:69930117-69930139 CTGGATCATCCTGGAAACACGGG - Exonic
1140031541 16:71343261-71343283 CTGGAAAATTTAGGACATACTGG + Intergenic
1152052913 17:77996396-77996418 CTGGATTCTCTAGGCTGCACGGG - Intergenic
1157385790 18:47259406-47259428 TTGGCTTCTCTAGGAAACACTGG - Intergenic
1160265264 18:77336408-77336430 CTGGATTATCTGGGGGACCCTGG + Intergenic
1163739591 19:19003252-19003274 CTGAATGATGTAGAACACACAGG + Intronic
1168368922 19:55814782-55814804 CTGGATTATCTAGGACACACGGG + Intronic
927320281 2:21735926-21735948 CAGAATTATTTGGGACACACTGG - Intergenic
932096401 2:68853461-68853483 TTGGAATATCTGGTACACACAGG + Intergenic
932896942 2:75649479-75649501 CTGGCTTCCCTGGGACACACTGG - Intronic
936603948 2:113929264-113929286 CCTGAGTAGCTAGGACACACAGG + Intronic
947854661 2:233314970-233314992 CTGCAGAGTCTAGGACACACAGG - Intronic
1176275924 20:64269160-64269182 CAGGCTTATCCAGGATACACAGG - Intronic
1178017557 21:28367347-28367369 CTGGATTATTTATAACACAAAGG - Intergenic
1179163212 21:38914839-38914861 CCGGGTCATCTGGGACACACTGG - Intergenic
1182220781 22:28756903-28756925 CTGGATTGTTAAGGAGACACAGG - Intronic
1183174540 22:36213095-36213117 CTGGATGAACTAGGACCCCCTGG - Intergenic
955225766 3:57059301-57059323 TTGGCTTCTCTGGGACACACTGG + Intronic
955872995 3:63459564-63459586 TTAGATTATCCAGGACTCACTGG + Intronic
959607329 3:108256445-108256467 CTGGATACTCTAAAACACACAGG - Intergenic
965318903 3:167227044-167227066 TTGCATTAGTTAGGACACACTGG - Intergenic
970826528 4:20282766-20282788 CTGGATTAACAAGAACAAACAGG - Intronic
972577305 4:40363770-40363792 CTGGACTGTCTTGGACAAACTGG + Intergenic
973828742 4:54736930-54736952 TTGGATTCTTTATGACACACTGG + Intronic
977873089 4:102116836-102116858 CTGGATTATTTATAACACACAGG - Intergenic
980639246 4:135553437-135553459 CTGGATTATGCAGAACACACAGG - Intergenic
981406434 4:144375086-144375108 TCTGATTATCCAGGACACACAGG - Intergenic
986417155 5:7540660-7540682 CTGAATATTCCAGGACACACTGG + Intronic
987778878 5:22405970-22405992 CTGGATTATTTAGGAAATAATGG + Intronic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
994402911 5:99304827-99304849 CTTCATTATCTTGGACATACTGG + Intergenic
997918525 5:137954206-137954228 CTGGATCATGTAGGAAACGCTGG + Exonic
999634253 5:153603636-153603658 CTAGAAGATCTAGGACACTCTGG + Intronic
1000311517 5:160049715-160049737 AAGGATTATTTAGGACTCACTGG - Intronic
1000718144 5:164672666-164672688 TGGGATTATTTAGAACACACTGG - Intergenic
1002075311 5:176705042-176705064 GTGGCTTCTCTAGGAAACACAGG - Intergenic
1004867019 6:19863323-19863345 CTGGATTATCCAGCACAGAGAGG + Intergenic
1006435774 6:34025537-34025559 CTGGGTTTTCTAGGGCAGACAGG - Intronic
1010559089 6:77325817-77325839 CTTGATTATCAAGGAGAAACAGG + Intergenic
1010698272 6:79005979-79006001 ATGTGTTATATAGGACACACAGG - Intronic
1017107790 6:150904414-150904436 CTGAATTCACTAGGAGACACAGG + Intronic
1020329061 7:6999844-6999866 CAGGAGTTTCTAGGATACACAGG - Intergenic
1021931410 7:25584926-25584948 CTGGATTACCTTGGACAGTCAGG + Intergenic
1022968441 7:35495636-35495658 CTGCATTATCTAATCCACACAGG - Intergenic
1023245292 7:38196891-38196913 ATGGATCATATAGGGCACACAGG + Intronic
1025736299 7:64150066-64150088 CAGAATTATCTGGGTCACACTGG + Intronic
1025765589 7:64444207-64444229 CAGAATTATCTGGGTCACACTGG + Intergenic
1028840598 7:95425682-95425704 CTGGGTTATCTAGAAGAAACTGG - Intronic
1031309055 7:120171121-120171143 CTGCTTCATCTAGGAAACACTGG + Intergenic
1032135184 7:129270171-129270193 TTGTATTATCTGGGTCACACTGG + Intronic
1034088046 7:148338337-148338359 CTGGATTTTCTAATAGACACAGG - Intronic
1039339400 8:36630375-36630397 CTGAATTAACTTGGTCACACAGG - Intergenic
1040817665 8:51526148-51526170 CTGGATCATCCAGGACAGACAGG + Intronic
1041675203 8:60531422-60531444 CTGGATTATCTATACCTCACAGG + Intronic
1044849221 8:96411378-96411400 CTGGATTATGTAGGATAGTCAGG - Intergenic
1046026400 8:108729413-108729435 CTGGATTATCTCTTATACACTGG - Intronic
1046726829 8:117684779-117684801 TTGGCTTCTCTAGGCCACACTGG + Intergenic
1049184458 8:141242253-141242275 CTGGATTATTTAGAAGACTCTGG - Intronic
1052358670 9:27530154-27530176 GTGGATTTACTAGAACACACTGG + Intergenic
1188472350 X:30554754-30554776 CCTGATTTTCTAGGACCCACAGG + Intergenic
1189075445 X:37909555-37909577 TTGGATTACCTGGGCCACACTGG - Intronic
1200126940 X:153819649-153819671 CTGGAGTATCCAGGACACCTTGG + Intronic