ID: 1168369363

View in Genome Browser
Species Human (GRCh38)
Location 19:55819255-55819277
Sequence GACCCACACACTGTAGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 172}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168369353_1168369363 21 Left 1168369353 19:55819211-55819233 CCACCTCTGCAGGGGTTCCCCAT 0: 1
1: 0
2: 5
3: 25
4: 384
Right 1168369363 19:55819255-55819277 GACCCACACACTGTAGCCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 172
1168369352_1168369363 22 Left 1168369352 19:55819210-55819232 CCCACCTCTGCAGGGGTTCCCCA 0: 1
1: 1
2: 3
3: 19
4: 214
Right 1168369363 19:55819255-55819277 GACCCACACACTGTAGCCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 172
1168369361_1168369363 -10 Left 1168369361 19:55819242-55819264 CCTCCTGAGTAGGGACCCACACA 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1168369363 19:55819255-55819277 GACCCACACACTGTAGCCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 172
1168369360_1168369363 -5 Left 1168369360 19:55819237-55819259 CCTGTCCTCCTGAGTAGGGACCC 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1168369363 19:55819255-55819277 GACCCACACACTGTAGCCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 172
1168369355_1168369363 4 Left 1168369355 19:55819228-55819250 CCCCATCTTCCTGTCCTCCTGAG 0: 1
1: 5
2: 10
3: 116
4: 1195
Right 1168369363 19:55819255-55819277 GACCCACACACTGTAGCCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 172
1168369351_1168369363 23 Left 1168369351 19:55819209-55819231 CCCCACCTCTGCAGGGGTTCCCC No data
Right 1168369363 19:55819255-55819277 GACCCACACACTGTAGCCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 172
1168369356_1168369363 3 Left 1168369356 19:55819229-55819251 CCCATCTTCCTGTCCTCCTGAGT 0: 1
1: 0
2: 4
3: 34
4: 341
Right 1168369363 19:55819255-55819277 GACCCACACACTGTAGCCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 172
1168369357_1168369363 2 Left 1168369357 19:55819230-55819252 CCATCTTCCTGTCCTCCTGAGTA 0: 1
1: 0
2: 3
3: 48
4: 403
Right 1168369363 19:55819255-55819277 GACCCACACACTGTAGCCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 172
1168369354_1168369363 18 Left 1168369354 19:55819214-55819236 CCTCTGCAGGGGTTCCCCATCTT 0: 1
1: 0
2: 0
3: 19
4: 171
Right 1168369363 19:55819255-55819277 GACCCACACACTGTAGCCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168369363 Original CRISPR GACCCACACACTGTAGCCCC TGG Intronic
900905128 1:5551740-5551762 GACTCACTCACTGTAGCACTTGG - Intergenic
901089166 1:6629922-6629944 GACCCAGAACCTGCAGCCCCTGG - Intronic
901730168 1:11273367-11273389 GACCCACTTGCTGTTGCCCCCGG + Exonic
902781110 1:18705630-18705652 GACCCACACTCTGGAGGCCTGGG - Intronic
903183766 1:21618378-21618400 AACCCTCACCCTGTAGCCCTGGG + Intronic
903327586 1:22579872-22579894 GTCCCTCTCACTGTGGCCCCAGG - Intronic
906908909 1:49925391-49925413 GACCCACAGCCTGTACCACCTGG - Intronic
908268078 1:62397725-62397747 GACCCACTACCTGGAGCCCCTGG + Intergenic
908905271 1:69001302-69001324 GACCCATACTTTGCAGCCCCTGG - Intergenic
909051996 1:70777276-70777298 AACCCATACATTGCAGCCCCTGG + Intergenic
909428135 1:75551709-75551731 GACACATACACTGTATCACCAGG + Intronic
917748634 1:178035280-178035302 GACTCTCACACTGTTGCCCAGGG + Intergenic
918813820 1:189156609-189156631 GAGTCTCACACTGTCGCCCCAGG - Intergenic
920659616 1:207904386-207904408 GAGCCACAGACTGTATCACCAGG + Intronic
921853898 1:219960104-219960126 GACCCACACGCTCAAGACCCAGG - Intergenic
922339392 1:224643477-224643499 GACCCACTCACTGTCCCACCAGG - Intronic
922362522 1:224836241-224836263 GAGTCTCACACTGTCGCCCCAGG - Intergenic
922914001 1:229240796-229240818 GCCCCACAGACAGCAGCCCCAGG - Intergenic
1064896793 10:20246262-20246284 GACACACAGACTGTATCCACTGG - Intronic
1067004335 10:42646804-42646826 GACCCACAAAGTGTAGGCCCAGG + Intergenic
1067151350 10:43737405-43737427 CACACACACCCTGTAACCCCAGG + Intergenic
1069777269 10:70934468-70934490 GGCCCACACACTGAACTCCCAGG + Intergenic
1072519340 10:96216515-96216537 GAAGCACACACTGTGGCCCAGGG + Intronic
1072741703 10:97913824-97913846 GGCCCCCACTCTGTAGCCCCTGG + Intronic
1073097112 10:100986705-100986727 GCCCCACCAACTGCAGCCCCAGG - Intronic
1075072593 10:119328608-119328630 AACCCATTCACTGTGGCCCCAGG + Intronic
1075870815 10:125771883-125771905 GACGCACACACTGGAAGCCCTGG - Intronic
1076121675 10:127941345-127941367 GGCCCTGACACAGTAGCCCCAGG + Intronic
1077077494 11:708149-708171 GACCCAAACTCTGAAGCCACAGG + Intronic
1078730742 11:13971712-13971734 CTCCCACACACTTTAGCACCTGG + Intronic
1082784269 11:57308431-57308453 GAGCCACACCCTGCAGACCCTGG - Exonic
1083621118 11:64049901-64049923 GACCAAGACGCTGTGGCCCCGGG + Intronic
1085120415 11:73964126-73964148 GACCAAGACACTGAAGCCCACGG + Intronic
1091368331 11:135039704-135039726 GACCCCCACACTGCAGCCCTGGG - Intergenic
1096787262 12:54024323-54024345 GACCCAAGCACTGGAGCCTCAGG - Intronic
1099283033 12:80676666-80676688 CAACAACACATTGTAGCCCCAGG + Intronic
1101145634 12:101838190-101838212 GATCCTCCCACTGCAGCCCCTGG + Intergenic
1103701064 12:122848964-122848986 GCCCCTCCCACTGTCGCCCCTGG - Intronic
1103793610 12:123488668-123488690 GAGCCACACACAGCAGGCCCAGG + Intronic
1104428568 12:128697781-128697803 GCCCCACACAACATAGCCCCTGG + Intronic
1107078464 13:36348268-36348290 GAGCCAGACCCTGTACCCCCTGG + Intronic
1107556505 13:41520611-41520633 GACCCACAATCTGGAGGCCCAGG + Intergenic
1108292096 13:48972209-48972231 GAACCACACCATGTAGCTCCAGG - Intergenic
1108723214 13:53153147-53153169 GAACCACACATTGTAGCACTTGG + Intergenic
1117052669 14:51877196-51877218 GACCAACACACTCTTGCTCCAGG - Intronic
1117295937 14:54378855-54378877 GACCCACTCACTGGATCACCTGG + Intergenic
1119133732 14:72197517-72197539 TCCCTACCCACTGTAGCCCCAGG - Intronic
1122067445 14:99183669-99183691 GACCCACATACAGTAGGCACTGG + Intronic
1123008233 14:105334626-105334648 TACCCACACACTGGACCCTCAGG - Intronic
1125500142 15:40234506-40234528 TACCCACACACTGGAGCCCTAGG + Intergenic
1125555992 15:40585526-40585548 GAGTCACACTCTGTCGCCCCCGG - Intergenic
1125748846 15:42015096-42015118 GCCCCAGACACTGCAGCCCAGGG - Intronic
1126663058 15:51051294-51051316 GAACTACACACTGTTGGCCCAGG - Intergenic
1127162489 15:56204044-56204066 GACTCTCACTCTGTTGCCCCAGG + Intronic
1128615968 15:69110001-69110023 GGCCCACACTCTGCAGCCCCAGG + Intergenic
1129542810 15:76364708-76364730 GACTTCCACACTGAAGCCCCAGG - Intronic
1130553015 15:84904024-84904046 CACCCACACACAATAGCACCCGG - Intronic
1132310200 15:100851894-100851916 ACCCCCCACACTCTAGCCCCTGG - Intergenic
1132826094 16:1906419-1906441 GAAGCACACACTCTAGCCCTGGG + Intergenic
1134249613 16:12565346-12565368 CACGCACTCACTGAAGCCCCTGG + Intronic
1134803183 16:17104289-17104311 GTCCCACAAGCTGTAGCCCCAGG + Exonic
1135852481 16:25977014-25977036 GGTCCACAAACTGTAGCCCATGG - Intronic
1138373910 16:56549349-56549371 ACCCCACACACCATAGCCCCAGG + Intergenic
1140240961 16:73199769-73199791 CACCCTCTCACTGTAGCACCTGG - Intergenic
1140432577 16:74917173-74917195 GAACCACACACAGTAGTACCTGG - Intronic
1142479312 17:208447-208469 GACCCAGTCCCTGCAGCCCCAGG - Intergenic
1142504533 17:354463-354485 GACCCGCACACCACAGCCCCAGG + Intronic
1145004383 17:19329146-19329168 GACCCACAGGCTGTGGGCCCAGG - Intronic
1145846217 17:28041588-28041610 GACCCACACCTTGTTGCCACTGG + Intergenic
1148563860 17:48621647-48621669 GACCCACGCAGAGAAGCCCCGGG - Exonic
1151399523 17:73846840-73846862 GACCCACAAAATGGGGCCCCTGG + Intergenic
1152969871 18:151262-151284 GATCCTCCCACTGTAGCCTCCGG + Intergenic
1156263601 18:35466992-35467014 GACCCACAGACTGCTGCTCCTGG - Intronic
1158539575 18:58340546-58340568 GACCCTAACACTGTAGCTTCTGG - Intronic
1160218027 18:76950877-76950899 GACATCCACACTGTAGCCCATGG - Intronic
1160857539 19:1224191-1224213 CCCCCAGACACTGTACCCCCCGG - Intronic
1161277920 19:3429162-3429184 CACACACACACACTAGCCCCAGG + Intronic
1162112140 19:8405031-8405053 CACCCACACCCTGAAGACCCTGG + Intronic
1164450847 19:28363095-28363117 GTCCCTCACACTGTAGCCAAAGG - Intergenic
1164709144 19:30343037-30343059 GACCCAGAGACTGCAGACCCTGG - Intronic
1165316683 19:35060338-35060360 GTCCCACAGACTGTGGCCGCAGG + Exonic
1165342402 19:35222474-35222496 GTCCCACACACTCTCGGCCCTGG + Intergenic
1166316694 19:41993459-41993481 CACACACACACTGCAGCCCCAGG + Intronic
1168369363 19:55819255-55819277 GACCCACACACTGTAGCCCCTGG + Intronic
925268113 2:2581404-2581426 GACACCCACAGTGTACCCCCTGG - Intergenic
925988910 2:9237968-9237990 GATCCACACACTGGAGCCACAGG - Intronic
926113070 2:10194973-10194995 AACCCACACACAGTAGCACAGGG - Intronic
926292597 2:11542554-11542576 GACACACTCCCTGTGGCCCCAGG + Intronic
926451554 2:13010512-13010534 GGAGCCCACACTGTAGCCCCAGG + Intergenic
928738648 2:34323309-34323331 GACCCAAACACTGAAGGCCTAGG - Intergenic
929968168 2:46551049-46551071 GACCCCCACACTGGACTCCCAGG + Intronic
933493409 2:83017583-83017605 GATCCACCCACTTTAGCCTCTGG - Intergenic
933639242 2:84741528-84741550 GCCCCACCCTCTTTAGCCCCAGG - Intronic
934943374 2:98518641-98518663 CACTCACAAACTGTAGGCCCTGG - Intronic
935476183 2:103527068-103527090 GACTCACACCCTAAAGCCCCAGG + Intergenic
935673668 2:105576216-105576238 GCGCCGCACACTGTGGCCCCCGG - Intergenic
935883687 2:107592642-107592664 GACCCAGACACTGCAGCCATGGG - Intergenic
938377682 2:130819429-130819451 GACCCACCCGCTGTCGGCCCAGG + Intergenic
942459975 2:176161967-176161989 GAACCACTCACTGGAGCTCCTGG - Intronic
945203947 2:207311830-207311852 GAGCCTCAGACTTTAGCCCCTGG + Intergenic
948265147 2:236630394-236630416 GACACACAGACTGTAGCAGCTGG - Intergenic
948424398 2:237878093-237878115 TACTCACCCACTGCAGCCCCAGG - Intronic
948684533 2:239662041-239662063 GATACCCACACTGTGGCCCCAGG + Intergenic
1169483061 20:6002588-6002610 GCCCCGCACACCGTACCCCCCGG - Intergenic
1174576950 20:51543289-51543311 GAGCCAGACACTGTTGCCCTCGG + Intronic
1175905621 20:62378047-62378069 GATCCATTCACTGTGGCCCCAGG + Intergenic
1176169882 20:63691985-63692007 AAACCACACACTTGAGCCCCTGG - Intronic
1176874428 21:14114404-14114426 GACCCACAAAGTGCAGGCCCAGG + Intronic
1176874770 21:14116828-14116850 GACCCACAAAGTGCAGGCCCAGG + Intronic
1178293360 21:31387792-31387814 GACCCACACACTGCTGCTGCCGG - Intronic
1178319809 21:31596770-31596792 CACCCTGACACTGAAGCCCCTGG - Intergenic
1179916368 21:44480741-44480763 GCCAGACACACTGGAGCCCCTGG + Intergenic
1181612031 22:24021730-24021752 GAGCCTCACTCTGTTGCCCCAGG + Intronic
1183058590 22:35321761-35321783 GACTCACAACCTGTGGCCCCTGG - Intronic
1185203547 22:49523332-49523354 GACCCAGACTTTGTATCCCCTGG + Intronic
950706970 3:14788850-14788872 GAACCAGTCACTGTTGCCCCGGG + Intergenic
954287112 3:49626837-49626859 GAGCCACACATGGTGGCCCCAGG + Intronic
955212795 3:56957718-56957740 GGCCCACACACTTTACCCACTGG - Intronic
956335707 3:68160969-68160991 GACCCACACACTTAACGCCCTGG - Intronic
960055984 3:113276708-113276730 AACCCAAACACAGTAGCCCAGGG - Intronic
960981231 3:123228607-123228629 GACCCACACACTGTGGGCATGGG + Intronic
961368204 3:126414618-126414640 GACCCACACACAGCCGCCCACGG + Intronic
962869487 3:139475715-139475737 GACCCACTCACTCTAGTCCCAGG + Intronic
963697420 3:148578411-148578433 GACAGACACAGTGTAGCCTCTGG + Intergenic
965513434 3:169594387-169594409 GGCCCTCACAATGTAGTCCCTGG + Intronic
968903972 4:3443376-3443398 GGCCTCCACACAGTAGCCCCAGG - Exonic
968970204 4:3789751-3789773 CACCCTCACACCGTACCCCCTGG + Intergenic
969097908 4:4747962-4747984 GACCGTCACAATGAAGCCCCTGG + Intergenic
969535844 4:7755679-7755701 GAGCCACACAGTGAAGCCCTGGG + Intergenic
978441457 4:108738540-108738562 GACCCAGACACTGGAGGCCTGGG + Intergenic
979273172 4:118786448-118786470 GCTGCACACACTGTAGACCCTGG + Intronic
979356542 4:119712408-119712430 GCCCCACACACAGTTCCCCCTGG + Intergenic
979638940 4:122989573-122989595 GAACCAGCCACTGTAGACCCAGG - Intronic
980633159 4:135464451-135464473 GAGTCACACTCTGTAGACCCAGG - Intergenic
981644733 4:146986043-146986065 GACACACACAGTGTTGCCCTGGG + Intergenic
984102332 4:175500142-175500164 TACCCTCACACTGCCGCCCCAGG - Intergenic
984539192 4:181016211-181016233 GCTCCACACTCTGTAGCCCATGG + Intergenic
984554943 4:181202398-181202420 GACGGCCACACTGAAGCCCCAGG + Intergenic
985745175 5:1642749-1642771 GACCCAGAGACCGTAGCCCTGGG + Intergenic
987601621 5:20079219-20079241 CAACCCCACACTGCAGCCCCTGG + Intronic
988146045 5:27309969-27309991 GAACAACACACTGTAGGCCTGGG + Intergenic
1000442374 5:161279278-161279300 CACCCACACACTGAAGTCCCAGG + Intergenic
1001375371 5:171251678-171251700 GACCCACACACTGAGCCCGCTGG - Intronic
1002990499 6:2233864-2233886 GATCGACAAACTGTATCCCCTGG - Intronic
1003114263 6:3273018-3273040 GCCCCAGACCCTGGAGCCCCGGG + Exonic
1003212170 6:4078560-4078582 GACACACACCCGGTGGCCCCAGG - Intronic
1006297822 6:33177839-33177861 GTCCCACACACTGCAGGCCTGGG - Intronic
1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG + Exonic
1007932163 6:45701444-45701466 ACCACACACACTGTAGCACCAGG - Intergenic
1012474499 6:99604945-99604967 GGGCCACACACTGTGGCCTCTGG - Intergenic
1017796733 6:157851499-157851521 TTCCCACTCCCTGTAGCCCCTGG + Intronic
1019267682 7:127549-127571 GACCCACACAGAGTGGCCCTGGG + Intergenic
1019479306 7:1259279-1259301 GTGGCACACACTGTAGTCCCAGG + Intergenic
1019912706 7:4110389-4110411 GACCCAAACAGTGAAACCCCTGG - Intronic
1022443191 7:30450243-30450265 GACTCTCCCTCTGTAGCCCCAGG - Intronic
1022552838 7:31258076-31258098 GACCTACAGAATGTAACCCCTGG + Intergenic
1023707987 7:42962240-42962262 GACACACCCACTGCAGCCCAAGG + Intergenic
1024414952 7:49095983-49096005 GACCCCCTCACTTTAGCCCTTGG - Intergenic
1025016916 7:55447072-55447094 GAACTCCACACTGGAGCCCCTGG - Intronic
1028841326 7:95432921-95432943 GACCCAAACTCTGGAACCCCAGG - Intronic
1033466087 7:141591116-141591138 GAGTCTCACTCTGTAGCCCCAGG + Intronic
1036407483 8:8468172-8468194 GACCGACACACAGAAGCCCCAGG - Intergenic
1039970908 8:42320893-42320915 GACACACACACCGAAGCTCCAGG - Intronic
1041178355 8:55221469-55221491 GGCCCACACACTGAAGGCCCTGG + Intronic
1041556834 8:59167101-59167123 TCCCCACACCCTTTAGCCCCTGG + Intergenic
1043879662 8:85528019-85528041 GACCTACACACTGGAGCAGCAGG - Intergenic
1046762138 8:118032211-118032233 GACCCTCAATCTGTAGTCCCCGG + Intronic
1049362378 8:142218396-142218418 AACCCACACAGTGAAGCTCCAGG - Intronic
1049395833 8:142400079-142400101 GAGCCACACACTGTAATCCCAGG - Intronic
1049611093 8:143555669-143555691 AGCCCACACACTGCTGCCCCTGG - Intronic
1049759089 8:144323827-144323849 GGCCCACACAGTGCAGCTCCAGG + Intronic
1055028263 9:71745239-71745261 GACCCTCACATTGAGGCCCCGGG + Exonic
1056751199 9:89352544-89352566 GTCCCACATCCTGTAACCCCAGG - Intronic
1062245235 9:135562652-135562674 CAACCACACAGTGCAGCCCCAGG + Intronic
1062619396 9:137412717-137412739 GACTCACACACTGTGTCCACTGG + Intronic
1185536190 X:863249-863271 GACCCACACATTTTAAGCCCCGG + Intergenic
1186423558 X:9445282-9445304 GAGGCACACACTTTAGTCCCTGG - Intergenic
1188260341 X:28016135-28016157 GGACCTCATACTGTAGCCCCAGG - Intergenic
1188339201 X:28977935-28977957 GAGTCTCACTCTGTAGCCCCAGG - Intronic
1188470171 X:30529302-30529324 GACCTATATACTGTAGTCCCAGG + Intergenic
1190158498 X:48012887-48012909 GAGCCTCACTCTGTCGCCCCAGG - Intronic
1190165638 X:48071127-48071149 AACCCACATACTGTTACCCCTGG + Intronic
1190174194 X:48135156-48135178 GAGCCTCACTCTGTCGCCCCAGG - Intergenic
1195616158 X:106913763-106913785 GACCCACACCCTGAAGGACCTGG - Intronic
1200022234 X:153221818-153221840 GACCCAAACACTGTAATACCTGG - Intergenic
1200745107 Y:6897305-6897327 GAGGCACACACTTTAGTCCCTGG - Intergenic