ID: 1168371281

View in Genome Browser
Species Human (GRCh38)
Location 19:55836531-55836553
Sequence CCAATCATTAAGGACCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 99}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168371272_1168371281 21 Left 1168371272 19:55836487-55836509 CCAATCAAATGGCACCACGGATC 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1168371281 19:55836531-55836553 CCAATCATTAAGGACCAGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 99
1168371273_1168371281 7 Left 1168371273 19:55836501-55836523 CCACGGATCTTTTCTTCCCGCTT 0: 1
1: 0
2: 1
3: 6
4: 125
Right 1168371281 19:55836531-55836553 CCAATCATTAAGGACCAGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 99
1168371274_1168371281 -9 Left 1168371274 19:55836517-55836539 CCCGCTTCCAGCCGCCAATCATT 0: 1
1: 0
2: 0
3: 22
4: 95
Right 1168371281 19:55836531-55836553 CCAATCATTAAGGACCAGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 99
1168371275_1168371281 -10 Left 1168371275 19:55836518-55836540 CCGCTTCCAGCCGCCAATCATTA 0: 1
1: 0
2: 0
3: 12
4: 71
Right 1168371281 19:55836531-55836553 CCAATCATTAAGGACCAGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168371281 Original CRISPR CCAATCATTAAGGACCAGGA AGG Intronic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
908660898 1:66434140-66434162 ACAATTATTTAGGACTAGGATGG + Intergenic
911101697 1:94100723-94100745 CCAGGCAGAAAGGACCAGGAGGG + Intronic
913311313 1:117498246-117498268 TAAAACATTGAGGACCAGGATGG + Intronic
916202278 1:162283620-162283642 CCAGTCAGTGAGGTCCAGGAAGG - Intronic
921133511 1:212239636-212239658 CCAATCAGTTGTGACCAGGATGG + Intergenic
924549201 1:245058845-245058867 TCAAACACTAAGAACCAGGAAGG - Intronic
1063435110 10:6023167-6023189 ACAATGAGTCAGGACCAGGAAGG - Intronic
1065270303 10:24024308-24024330 CCATTTATTTAGGACCAGGATGG - Intronic
1065306958 10:24378328-24378350 CCAATCAGGAAAGACCAGGCTGG + Intronic
1069044190 10:63724721-63724743 ACAAGCATTGAGGAGCAGGAGGG + Intergenic
1070354949 10:75630969-75630991 CCAAACATGAGGGACGAGGAGGG - Intronic
1074478189 10:113792268-113792290 ACAATCAATTAGGTCCAGGAAGG - Intergenic
1079855151 11:25593493-25593515 CCAGGCATTAAGTACTAGGAAGG + Intergenic
1080951203 11:37035281-37035303 CCAATCACAAAAGATCAGGATGG - Intergenic
1083249194 11:61454429-61454451 CCAATCATCCATGAGCAGGAGGG + Intronic
1084440701 11:69171194-69171216 GCAATCATGAAGGACCTGGTGGG - Intergenic
1087791927 11:102415073-102415095 ACAATCAAAAAGGACCAAGAAGG + Intronic
1088351669 11:108896762-108896784 CCAAGCATTCAGTACAAGGAAGG - Intronic
1088811282 11:113394452-113394474 CCATGCATTGAGGGCCAGGAAGG - Intronic
1090387992 11:126367528-126367550 ACAAGCATTCAGGACCTGGAAGG - Intronic
1097175259 12:57138901-57138923 CCAATCATCAAGGGTCAGGGAGG - Intronic
1099184446 12:79502671-79502693 CCAATCATGGAGGACGGGGAAGG + Intergenic
1100973254 12:100094318-100094340 CCAATAATTCAGGACCAGCCTGG - Intronic
1103920927 12:124398836-124398858 CCACTCATCCAGGACAAGGAGGG + Intronic
1106083131 13:26517108-26517130 CCAAGGATTAAGGAGCTGGAAGG - Intergenic
1106332207 13:28749566-28749588 CCAAGAATTAAAGACCAGGCTGG - Intergenic
1117860338 14:60084952-60084974 ACAATCTTTAAGAACCAGGAGGG - Intergenic
1118166870 14:63345315-63345337 CCAATCACTGACGAGCAGGAGGG + Intergenic
1118526778 14:66653280-66653302 CCAATGACTATGGAGCAGGATGG - Intronic
1122313415 14:100811602-100811624 CCTATCATTGAGGACTAGGTGGG + Intergenic
1126064927 15:44819396-44819418 CCAAACCTCGAGGACCAGGAGGG - Intergenic
1127634211 15:60853678-60853700 CCAATCATTGTGGCCCAGCAAGG + Intronic
1134868930 16:17634070-17634092 CAGATCTTAAAGGACCAGGATGG + Intergenic
1137601402 16:49758777-49758799 CCATTCTTTAAGGAACATGAGGG - Intronic
1140235367 16:73153899-73153921 TTAATAATTAAGGACAAGGATGG + Intergenic
1142680100 17:1542445-1542467 CCAATTTTTAAGAAGCAGGAAGG - Intronic
1147809234 17:43155438-43155460 CCAGTCATTCAAGACCAGCATGG - Intergenic
1157000653 18:43519498-43519520 CCAACTATTAAGGCCCTGGAGGG + Intergenic
1158651752 18:59294533-59294555 ACAATTATTAAGGACTACGAGGG - Intronic
1159952851 18:74497213-74497235 GCAAACATTAGGGACAAGGAAGG - Intronic
1168371281 19:55836531-55836553 CCAATCATTAAGGACCAGGAAGG + Intronic
927700857 2:25268043-25268065 CCAACCCTTAAGGTCCATGAAGG + Intronic
927912459 2:26910662-26910684 TCAATCATTCAGGACCAGCCTGG - Intronic
930570149 2:53076336-53076358 CTAATAATTAAGGATGAGGATGG - Intergenic
931223205 2:60306821-60306843 CCAAGCCTATAGGACCAGGAAGG - Intergenic
934131736 2:88955154-88955176 CCAGTCATTCAGGACAAGGGAGG - Intergenic
934133240 2:88969791-88969813 CCAGTCATTCAGGACAAGGGAGG - Intergenic
934136006 2:88996976-88996998 CCAGTCATTCAGCACCAGGGAGG - Intergenic
934220317 2:90076321-90076343 CCAGTCATTCAGTACCAGGGAGG + Intergenic
935799439 2:106678885-106678907 CAAATCGTGAAGGACCTGGAGGG - Intergenic
942082094 2:172410008-172410030 TCAATCAATAAGGACAAGAAAGG - Intergenic
945163932 2:206921933-206921955 CCCATCATTAAGGGTAAGGAGGG + Intergenic
1172919001 20:38465714-38465736 CCAATCATTATGGGCCAGGGTGG + Intergenic
1174515114 20:51085961-51085983 CCAATCACTGGGGACCGGGAAGG + Intergenic
1177230365 21:18312138-18312160 AAAATCATTAAGGATCAGAATGG + Intronic
1177809054 21:25905231-25905253 CCGAGCATCGAGGACCAGGAGGG + Intronic
1181897379 22:26122377-26122399 CCAATCATTGTGGAGAAGGAGGG - Intergenic
1182776517 22:32835211-32835233 GCAATCAATAAGGGCCAAGATGG + Intronic
1183104259 22:35605028-35605050 ACAATGACTAAGGACCAGGTGGG + Intergenic
1184201106 22:42970346-42970368 AAAATCATCAAGGACCTGGATGG + Intronic
1184759233 22:46535555-46535577 CTGAGCATTAAGGCCCAGGATGG - Exonic
949655981 3:6220060-6220082 CCATTCATTCAGGACCATGTGGG + Intergenic
951251692 3:20401459-20401481 CCAAGCATTAAGGCCCAGAGTGG - Intergenic
951702713 3:25512202-25512224 CCAATCTTTAGAGACCAGGATGG - Intronic
952248216 3:31621156-31621178 ACAATCATTAAAGAACAGGATGG + Intronic
955691400 3:61594125-61594147 CCAAACATTCAGGAACAGGTAGG - Intronic
957589738 3:82180536-82180558 CCAAGCATTCAGGACCAGCATGG - Intergenic
961591054 3:127982292-127982314 CCAGTCCTTAAGGACAAGAAAGG + Intronic
964211836 3:154237124-154237146 CCACTGATTAAGACCCAGGATGG - Intronic
969550736 4:7865271-7865293 TCATGCATTAAGCACCAGGAGGG + Intronic
973781220 4:54289933-54289955 CCAATGTTTAAGGATCATGAAGG + Intronic
976662870 4:87558465-87558487 CCAAGGATTAAGGATGAGGATGG + Intergenic
978507011 4:109469289-109469311 ACTAACATTAAGGACCAGGGAGG - Intronic
982114553 4:152086933-152086955 CCAACCATTAGAGGCCAGGAAGG + Intergenic
984067802 4:175070779-175070801 AAAATCATTCAGGAACAGGAAGG - Intergenic
986074109 5:4316697-4316719 CCAATCAGTTGGGACCAGGAGGG + Intergenic
990788653 5:59451982-59452004 CCAATCCATGAGGCCCAGGACGG + Intronic
994802146 5:104392102-104392124 GAAATCATAAATGACCAGGATGG - Intergenic
997551772 5:134759191-134759213 CCAATCACTAACGTCCTGGAGGG - Intronic
1001485243 5:172115216-172115238 CCAATCAGTGAGGCCCAGGCAGG - Intronic
1001833796 5:174812873-174812895 ACAATTAATAATGACCAGGATGG + Intergenic
1004915221 6:20325778-20325800 CCAGTCATTCAAGACCAGGCTGG + Intergenic
1005058897 6:21757857-21757879 AGAATTATCAAGGACCAGGACGG - Intergenic
1008443141 6:51556008-51556030 CCAATCCCTAAGGAACAGAAAGG + Intergenic
1011060645 6:83262692-83262714 GCAATAACTAATGACCAGGAAGG + Intronic
1012238523 6:96845778-96845800 CCAATCACAAAAGACCAAGAAGG + Intergenic
1013960342 6:115891478-115891500 GAATTCATTAAGGACCAGTAAGG + Intergenic
1016820939 6:148345412-148345434 CTAATCATTCAGGATCAGGCTGG + Intronic
1016888992 6:148986958-148986980 CCAATCCTTAATCACCAGTAGGG - Intronic
1018082610 6:160271318-160271340 CCCCTCATTAAGGAACGGGAAGG + Intronic
1032497339 7:132372424-132372446 CAAATCCTAAAGGAACAGGAGGG - Intronic
1036543945 8:9748165-9748187 CCCACCATGAAGAACCAGGAAGG + Exonic
1037973630 8:23192815-23192837 CCAGTCGTTAAGGACCAGAAGGG - Intronic
1042594986 8:70437409-70437431 CCAATTATTAAGCACCTGGTAGG - Intergenic
1044577534 8:93787130-93787152 CCAATCACTAGGGGCCAGCATGG - Intronic
1047122814 8:121925488-121925510 CCAATAAATAAGGACCGGGCAGG + Intergenic
1053382081 9:37657378-37657400 ACAATTATTAAAGACGAGGATGG + Intronic
1057081393 9:92176927-92176949 GCAAGCACTAAGGAGCAGGAGGG + Intergenic
1057320920 9:94011757-94011779 TCAATCATGAAGGATGAGGAAGG + Intergenic
1058991502 9:110258104-110258126 CAAATCATTGAGTTCCAGGAAGG + Intergenic
1059197877 9:112387947-112387969 CCAAGCATTCAAGACCAGGCTGG + Intronic
1059393667 9:114017222-114017244 CCCACCATCAAGGACCAAGAGGG - Intronic
1185919735 X:4077845-4077867 TCAATCCCTGAGGACCAGGATGG + Intergenic
1190846607 X:54198320-54198342 TGATTCATTTAGGACCAGGAGGG + Exonic
1192369586 X:70502210-70502232 CAAATCATTGAGGACCAGTCTGG + Exonic
1193647605 X:84088676-84088698 CCAAGCAGTCAGGACAAGGAAGG - Intronic
1195624661 X:106995661-106995683 TCAATCTTTAAGGACCAGGTTGG + Intronic
1200125167 X:153810052-153810074 CGAATGACTAAGGACCAAGAAGG + Intronic